ID: 1129985830

View in Genome Browser
Species Human (GRCh38)
Location 15:79919266-79919288
Sequence TCTTCCACACAGAGCCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 256}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129985821_1129985830 0 Left 1129985821 15:79919243-79919265 CCTCCCGGCACCGGTCCCTGCCC 0: 1
1: 0
2: 2
3: 41
4: 459
Right 1129985830 15:79919266-79919288 TCTTCCACACAGAGCCAGGCTGG 0: 1
1: 0
2: 2
3: 20
4: 256
1129985819_1129985830 10 Left 1129985819 15:79919233-79919255 CCTTTGCTCTCCTCCCGGCACCG 0: 1
1: 0
2: 1
3: 21
4: 211
Right 1129985830 15:79919266-79919288 TCTTCCACACAGAGCCAGGCTGG 0: 1
1: 0
2: 2
3: 20
4: 256
1129985818_1129985830 13 Left 1129985818 15:79919230-79919252 CCTCCTTTGCTCTCCTCCCGGCA 0: 1
1: 1
2: 2
3: 27
4: 337
Right 1129985830 15:79919266-79919288 TCTTCCACACAGAGCCAGGCTGG 0: 1
1: 0
2: 2
3: 20
4: 256
1129985816_1129985830 19 Left 1129985816 15:79919224-79919246 CCTTCGCCTCCTTTGCTCTCCTC 0: 1
1: 1
2: 9
3: 144
4: 1150
Right 1129985830 15:79919266-79919288 TCTTCCACACAGAGCCAGGCTGG 0: 1
1: 0
2: 2
3: 20
4: 256
1129985815_1129985830 20 Left 1129985815 15:79919223-79919245 CCCTTCGCCTCCTTTGCTCTCCT 0: 1
1: 0
2: 7
3: 83
4: 1017
Right 1129985830 15:79919266-79919288 TCTTCCACACAGAGCCAGGCTGG 0: 1
1: 0
2: 2
3: 20
4: 256
1129985814_1129985830 21 Left 1129985814 15:79919222-79919244 CCCCTTCGCCTCCTTTGCTCTCC 0: 1
1: 0
2: 5
3: 65
4: 621
Right 1129985830 15:79919266-79919288 TCTTCCACACAGAGCCAGGCTGG 0: 1
1: 0
2: 2
3: 20
4: 256
1129985823_1129985830 -4 Left 1129985823 15:79919247-79919269 CCGGCACCGGTCCCTGCCCTCTT 0: 1
1: 0
2: 2
3: 28
4: 387
Right 1129985830 15:79919266-79919288 TCTTCCACACAGAGCCAGGCTGG 0: 1
1: 0
2: 2
3: 20
4: 256
1129985824_1129985830 -10 Left 1129985824 15:79919253-79919275 CCGGTCCCTGCCCTCTTCCACAC 0: 1
1: 1
2: 0
3: 71
4: 727
Right 1129985830 15:79919266-79919288 TCTTCCACACAGAGCCAGGCTGG 0: 1
1: 0
2: 2
3: 20
4: 256
1129985822_1129985830 -3 Left 1129985822 15:79919246-79919268 CCCGGCACCGGTCCCTGCCCTCT 0: 1
1: 1
2: 4
3: 41
4: 388
Right 1129985830 15:79919266-79919288 TCTTCCACACAGAGCCAGGCTGG 0: 1
1: 0
2: 2
3: 20
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129985830 Original CRISPR TCTTCCACACAGAGCCAGGC TGG Intronic
900361174 1:2289806-2289828 TCTTCCACCAAGAGCCTGGCTGG + Intronic
901111741 1:6802661-6802683 TACTCCACACACACCCAGGCTGG - Intronic
901243428 1:7709047-7709069 TCTGTCACACGCAGCCAGGCTGG + Intronic
902974887 1:20081446-20081468 GCTTCCACCCAGGGCCACGCAGG + Intronic
903982560 1:27199898-27199920 TCTTCCTCTCTGACCCAGGCGGG - Intergenic
904028452 1:27519562-27519584 TCTTCTGCAGAGGGCCAGGCTGG - Intergenic
904256387 1:29257556-29257578 CCTTCCCCAGAGACCCAGGCTGG - Intronic
905360786 1:37418869-37418891 ACATACACACAGAGCCAGGAAGG + Intergenic
905537782 1:38736943-38736965 TCTCCCACACAGGGCAAGCCTGG + Intergenic
905880830 1:41462820-41462842 GCCTCCCCACACAGCCAGGCAGG - Intergenic
906237209 1:44219256-44219278 CCTTCCACCCTGAGCTAGGCTGG - Intronic
906344332 1:45005853-45005875 GCTTCCACACAAAACCAGGCAGG + Exonic
910483908 1:87689364-87689386 TCGTCCTCACAGAGCAAGTCTGG - Intergenic
912856916 1:113177769-113177791 TCTTGCACAAGCAGCCAGGCAGG - Intergenic
915080655 1:153349592-153349614 TCATGCACCCAGACCCAGGCTGG + Intergenic
915593287 1:156882600-156882622 CATTCCACCCAGAGCCAGGGAGG + Intergenic
916189971 1:162168981-162169003 TCTCCCTCAGAGAGCCATGCTGG + Intronic
916566940 1:165988839-165988861 ATTTACACACATAGCCAGGCTGG - Intergenic
917040422 1:170800092-170800114 TGTTTCACAGAGAGCCTGGCAGG - Intergenic
917077527 1:171220731-171220753 TTTTTCACATAGAGCCTGGCTGG - Intergenic
921067383 1:211632553-211632575 TCTGCCACCCGCAGCCAGGCTGG + Intergenic
923329149 1:232906614-232906636 CCTTCCTCACAGTGTCAGGCTGG + Intergenic
924710103 1:246524297-246524319 TCTGGAACACAGAGGCAGGCTGG + Intergenic
1063671708 10:8104617-8104639 GATTCCACATGGAGCCAGGCAGG + Intergenic
1067059147 10:43068997-43069019 CCATCCGCTCAGAGCCAGGCCGG + Intergenic
1067174175 10:43930839-43930861 TCCTCCACACAGCCCCAAGCAGG - Intergenic
1070501240 10:77074515-77074537 TCGTCCTCACAGAGACAGGATGG + Intronic
1070619736 10:78000032-78000054 TCTTCCACACAATGGCCGGCCGG - Exonic
1071512815 10:86275013-86275035 CCTTCAACACTTAGCCAGGCTGG - Intronic
1074287967 10:112116121-112116143 TCTTCCACAAAGAGGCCGACTGG + Intergenic
1075670287 10:124259854-124259876 TCTTCCACACTGAACAGGGCTGG - Intergenic
1076379812 10:130017245-130017267 CCATCCACAGAGAGCCGGGCAGG + Intergenic
1077025574 11:438457-438479 CCTGACACACACAGCCAGGCAGG + Intronic
1078191404 11:9094629-9094651 GCCTCCACCCAGAGCCATGCGGG - Intronic
1078864843 11:15287824-15287846 TGTTCCACAAAGAGGCAGGTAGG + Intergenic
1079104322 11:17560779-17560801 CCTTCACCACAGAGCCAGGTGGG - Exonic
1079134403 11:17768255-17768277 TTTTCCAGACAGAGACTGGCAGG + Intronic
1080775812 11:35385592-35385614 AATTCCACAATGAGCCAGGCCGG + Intronic
1081170774 11:39867784-39867806 TCTTGCAGAGAGAGGCAGGCTGG - Intergenic
1082708801 11:56527629-56527651 TCTCCCTCACACAGCCAGTCAGG + Intergenic
1083803342 11:65059040-65059062 TCTTCCACTGACACCCAGGCTGG + Intergenic
1084390118 11:68869925-68869947 TTTTCCAGATAGAGCCGGGCTGG - Intergenic
1084486445 11:69450943-69450965 CCTTCCAAACACAGCCAGGTGGG + Intergenic
1084979297 11:72820830-72820852 CCTTCAACCCAGAGCCAAGCAGG - Intronic
1085523808 11:77153104-77153126 TCCTCCACTCGGAGCCATGCAGG - Intronic
1086153696 11:83641773-83641795 ACTTCAACACAGAGGCAGGTTGG - Intronic
1089622267 11:119728842-119728864 TCTTCCACGCAGAGCGGGGCTGG + Exonic
1090755928 11:129791927-129791949 AATTCAATACAGAGCCAGGCAGG - Intergenic
1091047406 11:132336864-132336886 TCTTCAAACCTGAGCCAGGCAGG - Intergenic
1091740523 12:2958215-2958237 TCTTTCACACAGATCCAGCCTGG - Intergenic
1092956939 12:13560005-13560027 CATTCCACACAAAGACAGGCTGG - Exonic
1092997247 12:13962137-13962159 TCTTCCACACAGTGAGCGGCAGG + Intronic
1094492724 12:30971016-30971038 TCTCACACACAGAGCCAGCTGGG + Intronic
1099973944 12:89526439-89526461 TTTTCCACACAGTGCCCTGCAGG + Intergenic
1100339009 12:93660240-93660262 CATGCCACACAGAGCCAGGTGGG - Intergenic
1102017991 12:109661111-109661133 CCCACCACACAGAGCCAGGATGG + Intergenic
1103351522 12:120286987-120287009 TCTTGCACACACAGTCAGGGTGG + Intergenic
1103722738 12:122983262-122983284 TCTTCCACTCTGAGGCAGGGAGG + Intergenic
1103997705 12:124840870-124840892 TCTTCAAGACTGAGTCAGGCTGG + Intronic
1104195272 12:126531161-126531183 TCTTCCTCACTTACCCAGGCTGG + Intergenic
1104661699 12:130616083-130616105 TCTTGGACACAGAGCCCAGCGGG - Intronic
1110780598 13:79460544-79460566 TTTTTGAGACAGAGCCAGGCTGG - Intergenic
1112562007 13:100523513-100523535 TCTTCAGCACAGAGCAATGCTGG + Intronic
1113079724 13:106505931-106505953 TCTTACACACAGAGCCATATGGG + Intronic
1113579685 13:111420282-111420304 GGTTCCAGACACAGCCAGGCTGG - Intergenic
1113895456 13:113761269-113761291 TCTACTCCACAGAGCCAGGAAGG - Intronic
1114406846 14:22464779-22464801 TGATCCACACATAGACAGGCTGG - Intergenic
1114573896 14:23695304-23695326 TTTTCCAGATAGAGCCGGGCTGG - Intergenic
1114676043 14:24440968-24440990 TCCACTACAGAGAGCCAGGCAGG - Exonic
1116304898 14:43240484-43240506 TTTACCACACAGATTCAGGCAGG + Intergenic
1116710347 14:48360430-48360452 TCTGTCACCCAGACCCAGGCTGG + Intergenic
1117297294 14:54391948-54391970 TGTTTCACCCAGAGCCAGCCCGG + Intergenic
1118595230 14:67430261-67430283 TCATCTATACAGAGTCAGGCTGG + Intergenic
1119320491 14:73727277-73727299 ACTTCCACACAGAGGCAGGGCGG + Intronic
1121541196 14:94728049-94728071 TCTTCCACACCCAGCCTTGCAGG - Intergenic
1122098441 14:99388376-99388398 GCCACAACACAGAGCCAGGCTGG + Intergenic
1124112454 15:26804593-26804615 TTTCCCACACAGAGGCAGTCAGG - Intronic
1124373366 15:29115783-29115805 TCGGCCACACAGATCCCGGCGGG + Intronic
1125733682 15:41908985-41909007 CAGTCCTCACAGAGCCAGGCTGG - Intronic
1126467191 15:48972022-48972044 GCCTCCACACAGACCCATGCTGG - Intergenic
1127238002 15:57076621-57076643 TTTTTGAGACAGAGCCAGGCTGG - Intronic
1129985830 15:79919266-79919288 TCTTCCACACAGAGCCAGGCTGG + Intronic
1130145777 15:81272812-81272834 TTTCCCACACAGAGGGAGGCTGG - Intronic
1131256908 15:90869123-90869145 TCTTCCTCCCAGAGCCCTGCTGG + Intronic
1131528292 15:93170400-93170422 TATTCCACAGAAAGCCAGACCGG - Intergenic
1131614484 15:94000760-94000782 GCTTCCAGTTAGAGCCAGGCTGG + Intergenic
1131953617 15:97707653-97707675 TCTTTCAAACAAAGCCTGGCAGG + Intergenic
1132330769 15:101011038-101011060 TCTTGAACCCAGAGCCAGGCAGG - Intronic
1132675430 16:1119370-1119392 ACATCCACACAGAGCCGCGCCGG - Intergenic
1134044674 16:11092512-11092534 TTTTTGAGACAGAGCCAGGCTGG - Intronic
1135932814 16:26753667-26753689 TTTTCCATAAAGAGCCAGACTGG - Intergenic
1137039661 16:35599162-35599184 TTTCTCACATAGAGCCAGGCTGG + Intergenic
1137518162 16:49168397-49168419 TATTCCACACAGTGTCAGGATGG + Intergenic
1141509189 16:84501609-84501631 GCTTGGACGCAGAGCCAGGCTGG + Intronic
1141681512 16:85546946-85546968 GCTTCCACCCAAAGCCTGGCTGG + Intergenic
1142811205 17:2396445-2396467 TCTCTCACCCAGAACCAGGCAGG - Intronic
1142996584 17:3764130-3764152 GCTTCTACACAGCACCAGGCAGG + Intronic
1143010734 17:3864985-3865007 CCTTCCACACAGAGCAGGCCAGG + Intronic
1144014501 17:11181347-11181369 TCTGTCACCCAGACCCAGGCTGG + Intergenic
1144337305 17:14282942-14282964 TCCTTCACACAGAGACAGCCTGG - Intergenic
1144642077 17:16943168-16943190 GCCTCCCCACAGAGCCACGCAGG + Intronic
1144705958 17:17368014-17368036 TCTCCAAGACTGAGCCAGGCAGG + Intergenic
1145006592 17:19342034-19342056 TCTACCCCTCACAGCCAGGCAGG - Intronic
1145772567 17:27504243-27504265 CCAGCCTCACAGAGCCAGGCTGG - Intronic
1146431637 17:32801727-32801749 TCTTACAAACAGAGCTAGGAAGG - Intronic
1147914207 17:43877060-43877082 TGCTCCCCACAGGGCCAGGCTGG - Intronic
1151262677 17:72929080-72929102 TCCTCTACACAGACCCAGCCTGG + Intronic
1151278770 17:73056111-73056133 TCTTCCCCACAGAGCCCCGAGGG + Intronic
1153636250 18:7116408-7116430 TCTGCTGCGCAGAGCCAGGCTGG - Intronic
1155577454 18:27263676-27263698 CTATCCACACAGAGCCAGCCAGG - Intergenic
1159789381 18:72758804-72758826 TCTGTCACCCAGACCCAGGCTGG - Intronic
1160010426 18:75103276-75103298 TCTTCCACAATGAGCAGGGCTGG - Intergenic
1160222411 18:76986709-76986731 TCTGCCATGTAGAGCCAGGCTGG - Intronic
1160318059 18:77866495-77866517 TCTTCAGGACAGAGCCAGGCAGG - Intergenic
1160625701 18:80203432-80203454 TCATCCACAGAGACCCAGGACGG + Intronic
1160834254 19:1117159-1117181 TCTTCCAATCAGAGCCAGCCAGG - Intronic
1161266189 19:3365905-3365927 TTCTCCCCCCAGAGCCAGGCAGG - Intronic
1161595679 19:5149979-5150001 TGGTGGACACAGAGCCAGGCAGG - Intronic
1162057195 19:8071771-8071793 TCTTCCATACAGACCCTGGCCGG - Intronic
1163237722 19:16039083-16039105 TCTACGACACAGAGCCGGGCAGG + Intergenic
1166081855 19:40448711-40448733 TCACCCAAACAGAGACAGGCTGG + Intronic
1202647661 1_KI270706v1_random:157104-157126 TCCTCAGCACAGACCCAGGCGGG - Intergenic
924958311 2:10800-10822 TCTTCACCACAGACCCGGGCGGG - Intergenic
925286479 2:2719402-2719424 CCTTCCTCACAGAGGGAGGCAGG - Intergenic
926610428 2:14941309-14941331 TTTTCCACCCAGAGCAATGCTGG + Intergenic
928215708 2:29359795-29359817 TCTTCAAGACAGAGACAGGAGGG - Intronic
933181857 2:79235994-79236016 TCTGCTCCTCAGAGCCAGGCAGG - Intronic
933756357 2:85641872-85641894 TCTGTCACCCAGACCCAGGCTGG - Intronic
934856265 2:97732330-97732352 TTTTCCACACAGACCCACACAGG - Intronic
935281546 2:101522188-101522210 CCTTCCACCTAGAGCCAGGGAGG + Intergenic
936877911 2:117214604-117214626 ACATCCCCAAAGAGCCAGGCTGG + Intergenic
942250224 2:174040870-174040892 TCTTCCACTCTGGCCCAGGCTGG - Intergenic
945569101 2:211441743-211441765 TCTTCCACACAGCCCTAGGGAGG + Intronic
945906488 2:215599589-215599611 TCCACCTCACAGAGCTAGGCAGG - Intergenic
946851399 2:223910109-223910131 TCTTTGTCACAGAGCCAGCCAGG - Intronic
1169318088 20:4609588-4609610 CCTTCCACACAGGCCCAGGGAGG - Intergenic
1170964618 20:21055319-21055341 TCTGACACACAGACCCAGGAAGG - Intergenic
1173252193 20:41369955-41369977 AGTTCCTCCCAGAGCCAGGCTGG - Intergenic
1174088439 20:48027168-48027190 TATTCCCCACAGAGCCCGGAGGG + Intergenic
1174343617 20:49914081-49914103 TCCTGAACACAGAGACAGGCAGG + Intronic
1174378417 20:50141182-50141204 TCCTCAACTGAGAGCCAGGCAGG + Intronic
1174391292 20:50219900-50219922 TCTTCCTCATACAGCCAAGCAGG + Intergenic
1174785068 20:53424712-53424734 TCTTCCTCTCCCAGCCAGGCAGG + Intronic
1175730491 20:61350545-61350567 TCTCCCACCCAGGGTCAGGCAGG + Intronic
1175999403 20:62825252-62825274 TCTTCCAGACAGGGCCTGGCTGG + Intronic
1176001289 20:62832453-62832475 TGTTGCACCCAGAGCCATGCAGG - Intronic
1176287307 21:5024930-5024952 TCTTCCAAACAGGAACAGGCTGG - Intronic
1176604199 21:8815656-8815678 TCCTCAGCACAGACCCAGGCGGG + Intergenic
1178297593 21:31423392-31423414 TCTTCAAGATAGTGCCAGGCTGG - Intronic
1179869874 21:44238545-44238567 TCTTCCAAACAGGAACAGGCTGG + Intronic
1179906127 21:44424241-44424263 CCTGCCCCACAGAGCAAGGCTGG - Intronic
1180001178 21:44996192-44996214 GCTTCCACCCAGAGCCACTCTGG - Intergenic
1180146924 21:45926643-45926665 TGCTCCACACAGTGCCAGGACGG + Intronic
1180159340 21:45992152-45992174 TGTTCCCCACAGGGCCAGCCGGG + Exonic
1180346490 22:11707263-11707285 TCCTCAGCACAGACCCAGGCGGG + Intergenic
1180354253 22:11825387-11825409 TCCTCAGCACAGACCCAGGCGGG + Intergenic
1180384002 22:12166968-12166990 TCCTCAGCACAGACCCAGGCGGG - Intergenic
1181452937 22:23036004-23036026 TCTTGCACACATAGCCCTGCTGG + Intergenic
1181559339 22:23690990-23691012 TCTTCAAGACAGAGCCAGTAGGG - Exonic
1181618033 22:24068321-24068343 CCTCCCACACATAGCCATGCTGG - Intronic
1181626201 22:24123926-24123948 TCAACCACACAGCTCCAGGCAGG - Intronic
1183542284 22:38436409-38436431 TGTTCCACACAGAGCTGGGCTGG + Intronic
1183734448 22:39636121-39636143 TTTACCACCCAGAGGCAGGCTGG + Intronic
1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG + Intronic
1184815304 22:46864429-46864451 ACTTCCACAGACAGCCAGGAGGG - Intronic
1184981329 22:48097674-48097696 TCCTCCACACAGAGGCTGTCAGG - Intergenic
1185277213 22:49954976-49954998 TCTCCCACCCAGAGCCAGGCCGG - Intergenic
949686244 3:6574994-6575016 TCTCCCACACTGGGCCAGGGTGG - Intergenic
950566164 3:13770909-13770931 TCTTCAAACCTGAGCCAGGCTGG + Intergenic
952577009 3:34787494-34787516 ACTTCCACTCTGAGCCATGCTGG - Intergenic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
956614438 3:71156897-71156919 CCTGCCACACTGGGCCAGGCTGG + Intronic
956738206 3:72255427-72255449 GCTTCCACAGGGAGCCAGGCAGG - Intergenic
956935614 3:74097518-74097540 TATTCAACACAATGCCAGGCAGG - Intergenic
958627525 3:96645485-96645507 TTTTCCACTCAGAGTCATGCAGG + Intergenic
961588915 3:127960182-127960204 CCTCCCACACAAAGCCTGGCAGG - Intronic
961721084 3:128896515-128896537 TCTGCCTCACGGAGCCAGCCAGG + Exonic
961725565 3:128926707-128926729 TACTCCAAATAGAGCCAGGCTGG - Intronic
964200419 3:154112665-154112687 TCTTCCAAACAGATCTGGGCAGG + Intergenic
968621044 4:1603598-1603620 TTCACCACCCAGAGCCAGGCTGG - Intergenic
968950227 4:3687693-3687715 TCTTCCCCGCGAAGCCAGGCCGG + Intergenic
968959021 4:3733480-3733502 ACTGCCGCCCAGAGCCAGGCAGG + Intergenic
969029788 4:4202725-4202747 TCTGCCCCACCCAGCCAGGCAGG - Intronic
969029948 4:4203861-4203883 TCTGCCCCACCCAGCCAGGCAGG - Intronic
969196281 4:5566324-5566346 TCTTCCACACTGGGCCAGGCAGG + Intronic
969558232 4:7928343-7928365 TCTACCACACGTACCCAGGCTGG + Intronic
969586841 4:8098817-8098839 GCCTCGACACTGAGCCAGGCAGG - Intronic
972449452 4:39182268-39182290 TCATCCAATCAGAGCCAGCCAGG + Intergenic
973171307 4:47147573-47147595 ATTTCCACACAGAGCAATGCAGG + Intronic
973373919 4:49275293-49275315 TCCTCAGCACAGACCCAGGCGGG - Intergenic
973383493 4:49334946-49334968 TCCTCAGCACAGACCCAGGCGGG + Intergenic
973387098 4:49519960-49519982 TCCTCAGCACAGACCCAGGCGGG + Intergenic
973597970 4:52512050-52512072 TCATCCAGACAGTGCCAGGTTGG + Intergenic
976149214 4:82076729-82076751 TCTTCCACATCCACCCAGGCAGG + Intergenic
976469003 4:85405198-85405220 CCTTCCAAACATAGACAGGCTGG - Intergenic
976538631 4:86246807-86246829 CCTCCCACACACAGCCAGTCTGG + Intronic
976867920 4:89753194-89753216 TCTGACTCAGAGAGCCAGGCTGG - Intronic
977561523 4:98537918-98537940 TCTTCCATGCTGAGCTAGGCTGG + Intronic
977839736 4:101688153-101688175 TCTTCTACACAAAGGGAGGCAGG + Intronic
978802367 4:112767529-112767551 TCTGACACCCAGTGCCAGGCTGG - Intergenic
978974235 4:114849206-114849228 TATTTCCCTCAGAGCCAGGCCGG + Intronic
980888260 4:138786336-138786358 TGCTCCACACAGAGGCAGCCAGG + Intergenic
983888630 4:173008165-173008187 TGTTCCGCACAGAACCATGCAGG + Intronic
984089971 4:175360973-175360995 TCTTCCATAAACAGACAGGCTGG - Intergenic
987114408 5:14714595-14714617 GCTTCCACCCAGAGGAAGGCAGG - Intronic
987155822 5:15089022-15089044 TCTTCCACAGTGAGCCAGTGAGG + Intergenic
995629948 5:114121837-114121859 CCTTCCACACACAGCCACCCAGG - Intergenic
997962993 5:138336904-138336926 TCGTCCTCACTGAGCCAGGGAGG - Intronic
999347384 5:150836352-150836374 TTTTTCACACAGAGCTGGGCTGG + Intergenic
1001470043 5:172005950-172005972 GCATCCACACAGACCTAGGCTGG + Intronic
1002765847 6:237950-237972 TGTTCCACACCTACCCAGGCTGG + Intergenic
1003108302 6:3231825-3231847 TCCTAGACACAGAGCCAGGCCGG + Intronic
1005155974 6:22806793-22806815 TCATCCCCACAGATTCAGGCAGG + Intergenic
1007360788 6:41353694-41353716 TCCCCCATACAGAGCCAGGAAGG + Intergenic
1008677938 6:53841225-53841247 TCTACCCTGCAGAGCCAGGCAGG - Intronic
1009636303 6:66269083-66269105 GCTGCCACACAGAACCACGCAGG - Intergenic
1009793982 6:68442344-68442366 TCTTCCCCACAGAACCAAGATGG + Intergenic
1010089303 6:71961192-71961214 TCTTCCAGAAAGATCCATGCAGG - Intronic
1013499910 6:110738901-110738923 TCTTCCACATAGTGCCCAGCAGG - Intronic
1014110890 6:117617573-117617595 TTTTTCACATAGAGCCAGGCTGG - Intergenic
1015161706 6:130159447-130159469 TCTGCCACACAGAGGCGGGTGGG + Intronic
1015288409 6:131510398-131510420 TCTTCCACCCACAGCCGTGCTGG - Intergenic
1015925567 6:138307286-138307308 TGTTCCACGCAGATCCAGTCGGG + Exonic
1017233961 6:152100194-152100216 TCTTCCAACCAGGGCCACGCTGG - Exonic
1017678814 6:156842958-156842980 TGTTGCACACACAGCAAGGCTGG - Intronic
1018026622 6:159811927-159811949 TCTTGCTCTCAAAGCCAGGCTGG + Intronic
1018395550 6:163375546-163375568 CCTTCCACTAAGAGCCAGTCGGG - Intergenic
1022226953 7:28372998-28373020 TCAGCAAAACAGAGCCAGGCAGG - Intronic
1022267519 7:28771909-28771931 TCAGCCACACAGAGGAAGGCTGG - Intronic
1022392447 7:29955281-29955303 TCTGCTCCCCAGAGCCAGGCGGG + Exonic
1022481793 7:30748961-30748983 TTCACCCCACAGAGCCAGGCAGG + Intronic
1023646906 7:42327326-42327348 TCATCTACAAAGACCCAGGCTGG + Intergenic
1026135947 7:67660886-67660908 TGTGCCAAACAAAGCCAGGCTGG + Intergenic
1026877359 7:73887233-73887255 TCACCCACGCAGAGGCAGGCAGG + Intergenic
1027482208 7:78712299-78712321 GCTTCCTCAGAGTGCCAGGCAGG - Intronic
1030550462 7:110952687-110952709 TCTTCAACACAGAGCCTAGCAGG - Intronic
1032373453 7:131384182-131384204 TCTACTACACAGAGCCAGCCAGG - Intronic
1032451606 7:132036536-132036558 TCTTCCTCACAAAGCCATCCTGG + Intergenic
1033361985 7:140644380-140644402 TCTTCCACACAGAGCAGCCCTGG + Intronic
1033561419 7:142535823-142535845 TGTTCCAGGCAGAGTCAGGCAGG - Intergenic
1035259359 7:157651953-157651975 TCTTCCAGACAGTCCAAGGCAGG + Intronic
1035842928 8:2832055-2832077 TGTTTCACACACAGCCAGGGCGG + Intergenic
1036618082 8:10404224-10404246 TCCTCCACAAATAGCAAGGCAGG + Intronic
1036776184 8:11614319-11614341 GCTCCCTCACAGAGCCTGGCAGG + Intergenic
1037690901 8:21180663-21180685 TCTTTCTCAAAGAGCGAGGCAGG - Intergenic
1039953748 8:42191597-42191619 TCTTCTGGACAGAGCCAGTCAGG - Intronic
1047846800 8:128814980-128815002 TCTGCCACTCAGAGACAGGCTGG + Intergenic
1048413341 8:134198836-134198858 TCTTCCACAGTAGGCCAGGCTGG + Intergenic
1048689378 8:136943189-136943211 TAATCCACACAGAGCAATGCTGG + Intergenic
1049185422 8:141249247-141249269 ACATCCACACAGAGCCTTGCAGG + Intronic
1049206115 8:141364408-141364430 TCTTCCACCAAGAGGCAGGTGGG + Intronic
1049495044 8:142926102-142926124 TCTTCCCCACTGGGCCATGCAGG + Intergenic
1049852961 8:144843968-144843990 CCTTCCTCAGAGAGGCAGGCTGG + Intronic
1051371767 9:16364988-16365010 TCTTCCCCACAGAGTCAGGTGGG - Intergenic
1053887793 9:42657766-42657788 TCCTCAGCACAGAGCCGGGCGGG + Intergenic
1054226813 9:62465216-62465238 TCCTCAGCACAGAGCCGGGCGGG + Intergenic
1054351068 9:64017100-64017122 TCCTCAGCACAGACCCAGGCGGG + Intergenic
1056224862 9:84484751-84484773 TCAGCCCCAAAGAGCCAGGCTGG - Intergenic
1056689820 9:88798611-88798633 TCTTCCATAGAGACCCAGCCAGG - Intergenic
1056793278 9:89639849-89639871 CCTTCCCCCCAGAGCCAGGATGG - Intergenic
1057411397 9:94819324-94819346 TCTTCCAAATAGAGCCAGAGAGG + Intronic
1057453945 9:95190665-95190687 TCACCCACACAGTGCCAGGGCGG - Intronic
1059908729 9:119019249-119019271 CCTTCCACACATGGACAGGCTGG + Intergenic
1060187124 9:121570475-121570497 ATTTCCAGACAGAGCCACGCTGG + Intronic
1060403331 9:123360916-123360938 TTCTCCAGTCAGAGCCAGGCAGG - Intronic
1060431105 9:123552177-123552199 CCCTCCTTACAGAGCCAGGCAGG + Intronic
1061253037 9:129437619-129437641 TCTGCCACCCAGAGCCCCGCTGG - Intergenic
1061428835 9:130518345-130518367 TGTTCCACACAATGCCAGGGAGG + Intergenic
1203697618 Un_GL000214v1:113263-113285 TCCTCAGCACAGACCCAGGCGGG - Intergenic
1203551596 Un_KI270743v1:167753-167775 TCCTCAGCACAGACCCAGGCGGG + Intergenic
1186511624 X:10134138-10134160 TCTTGAACACAGAGCCAGCAGGG + Intronic
1186991101 X:15069116-15069138 TCTGCCACTCAAAGCCAAGCTGG + Intergenic
1193031776 X:76906684-76906706 TCTTTCAGCCAGAGCCAGCCTGG + Intergenic
1194936978 X:99961905-99961927 TCTTCCAAAGAGAGGTAGGCAGG - Intergenic
1195104935 X:101594290-101594312 TCTGACACACAGAGCTATGCAGG - Intergenic
1195435035 X:104833521-104833543 TCATCCACTCAGAGCCAGACTGG + Intronic
1198111693 X:133507867-133507889 TCATCCACACTGGGCCAGGTGGG - Intergenic
1199683323 X:150242605-150242627 TATTACACACACAGACAGGCGGG + Intergenic
1199771106 X:150975917-150975939 TCTTCCCCACAGGACCCGGCCGG + Intergenic