ID: 1129986418

View in Genome Browser
Species Human (GRCh38)
Location 15:79923299-79923321
Sequence GTCCCCTCGGGGCTTCCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 158}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129986418_1129986424 -6 Left 1129986418 15:79923299-79923321 CCAAGGGGAAGCCCCGAGGGGAC 0: 1
1: 1
2: 0
3: 13
4: 158
Right 1129986424 15:79923316-79923338 GGGGACCCCGCGCCGTAGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 41
1129986418_1129986434 27 Left 1129986418 15:79923299-79923321 CCAAGGGGAAGCCCCGAGGGGAC 0: 1
1: 1
2: 0
3: 13
4: 158
Right 1129986434 15:79923349-79923371 CCGGCGAACCGCGATGGAGCCGG 0: 1
1: 0
2: 0
3: 2
4: 34
1129986418_1129986431 8 Left 1129986418 15:79923299-79923321 CCAAGGGGAAGCCCCGAGGGGAC 0: 1
1: 1
2: 0
3: 13
4: 158
Right 1129986431 15:79923330-79923352 GTAGGAGGGAGTGGAGGAGCCGG 0: 1
1: 0
2: 13
3: 227
4: 2177
1129986418_1129986426 -1 Left 1129986418 15:79923299-79923321 CCAAGGGGAAGCCCCGAGGGGAC 0: 1
1: 1
2: 0
3: 13
4: 158
Right 1129986426 15:79923321-79923343 CCCCGCGCCGTAGGAGGGAGTGG 0: 1
1: 0
2: 0
3: 8
4: 137
1129986418_1129986432 21 Left 1129986418 15:79923299-79923321 CCAAGGGGAAGCCCCGAGGGGAC 0: 1
1: 1
2: 0
3: 13
4: 158
Right 1129986432 15:79923343-79923365 GAGGAGCCGGCGAACCGCGATGG 0: 1
1: 0
2: 0
3: 5
4: 38
1129986418_1129986436 29 Left 1129986418 15:79923299-79923321 CCAAGGGGAAGCCCCGAGGGGAC 0: 1
1: 1
2: 0
3: 13
4: 158
Right 1129986436 15:79923351-79923373 GGCGAACCGCGATGGAGCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 19
1129986418_1129986423 -7 Left 1129986418 15:79923299-79923321 CCAAGGGGAAGCCCCGAGGGGAC 0: 1
1: 1
2: 0
3: 13
4: 158
Right 1129986423 15:79923315-79923337 AGGGGACCCCGCGCCGTAGGAGG 0: 1
1: 0
2: 1
3: 3
4: 42
1129986418_1129986422 -10 Left 1129986418 15:79923299-79923321 CCAAGGGGAAGCCCCGAGGGGAC 0: 1
1: 1
2: 0
3: 13
4: 158
Right 1129986422 15:79923312-79923334 CCGAGGGGACCCCGCGCCGTAGG 0: 1
1: 0
2: 0
3: 5
4: 76
1129986418_1129986429 2 Left 1129986418 15:79923299-79923321 CCAAGGGGAAGCCCCGAGGGGAC 0: 1
1: 1
2: 0
3: 13
4: 158
Right 1129986429 15:79923324-79923346 CGCGCCGTAGGAGGGAGTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 107
1129986418_1129986435 28 Left 1129986418 15:79923299-79923321 CCAAGGGGAAGCCCCGAGGGGAC 0: 1
1: 1
2: 0
3: 13
4: 158
Right 1129986435 15:79923350-79923372 CGGCGAACCGCGATGGAGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129986418 Original CRISPR GTCCCCTCGGGGCTTCCCCT TGG (reversed) Intronic
900483138 1:2909027-2909049 CTCCTCTCTGAGCTTCCCCTTGG - Intergenic
900574460 1:3376173-3376195 GACCCCTGGGGGCTTCCACATGG + Intronic
901082542 1:6591723-6591745 GCTCCCTTGGGGCTACCCCTTGG - Exonic
902043174 1:13506967-13506989 ATCCCCTCCTGGGTTCCCCTGGG + Intronic
904970834 1:34418345-34418367 GTCCCCTCTGGGAACCCCCTGGG + Intergenic
906531453 1:46526262-46526284 CTCCCCTCGGGAGCTCCCCTAGG + Intergenic
908835900 1:68230084-68230106 GTGCCCTTAGGGCTTCTCCTTGG + Intronic
910346744 1:86247629-86247651 TTCCCCTGAGGGCTTCCGCTGGG + Intergenic
914196046 1:145448613-145448635 GGCACCACGGGGCTTCCCGTGGG + Intergenic
915724703 1:158008984-158009006 GTCACCTCGGGGCTTTCCTTGGG + Intronic
916802977 1:168231747-168231769 GACTCCTCAGGGCTTCCTCTGGG + Intronic
923698934 1:236281844-236281866 GTCCCCTTGGGTCGTCGCCTGGG - Exonic
924615040 1:245605700-245605722 GGCCCCTTGCTGCTTCCCCTGGG - Intronic
1065092879 10:22252596-22252618 GTCCCCTGGGGGCTGCCGCGGGG - Intergenic
1065943700 10:30587907-30587929 GGCCCCTAGGGGCAGCCCCTGGG + Intergenic
1069719670 10:70541453-70541475 CTTCCCTCAGGGCTTCCCCGAGG + Exonic
1071614297 10:87060795-87060817 GTCCATTCTGGGCTTCCCCAAGG - Exonic
1072315261 10:94196417-94196439 TTCCCCTCGGAGCTTCTCCTGGG - Intronic
1073444196 10:103571156-103571178 CTCCCCTCATGGCATCCCCTGGG + Intronic
1073763156 10:106652459-106652481 GCCCCCGCGGGGCTTTCCCTGGG + Exonic
1074371696 10:112905666-112905688 GTACCCTGGGGGCTTCTCCTTGG + Intergenic
1075631046 10:124000864-124000886 CTCCCCTCGGTGCTTCCCAGTGG - Intergenic
1076100161 10:127770974-127770996 ATCTCCTCTGGGCCTCCCCTTGG + Intergenic
1076885707 10:133261526-133261548 GTTCCCTCTGGGCACCCCCTGGG - Intergenic
1077161405 11:1114228-1114250 GTCTCCACGGGGCTTCTCCTGGG + Intergenic
1078642968 11:13113563-13113585 GTCCCCTTGGGGCCTCCTGTCGG + Intergenic
1079083635 11:17430436-17430458 GTCCCCACGTGGCTGCCCCATGG - Intronic
1082693450 11:56332071-56332093 GTCCCCGCAGAGCTTCCCTTCGG - Intergenic
1083832567 11:65242138-65242160 GCCCCCTGGGGGCTTCTCCCAGG + Intergenic
1083941149 11:65896638-65896660 GTACCCTCTGGGCCTCCCGTGGG + Intronic
1084751035 11:71204646-71204668 GTCCCCTCGAGGTTTCAGCTGGG + Intronic
1089962610 11:122629131-122629153 GACCCCTTGTGGCTTTCCCTGGG - Intergenic
1095465248 12:42483077-42483099 GTTCTCTCGGGGCTTCGCGTCGG - Intronic
1095971171 12:47902937-47902959 GTCCTCTCGGAGCTTCCTCTGGG + Intronic
1096497286 12:52045873-52045895 CTGCCCTGGGGGCTTCCCGTGGG - Intronic
1096775054 12:53958495-53958517 GTCTCCTGTGGTCTTCCCCTGGG + Exonic
1102692475 12:114772240-114772262 GACCCCTGGGGGCTTCCTTTTGG + Intergenic
1103558362 12:121779300-121779322 CTCCCCTCCAGGCTGCCCCTGGG - Exonic
1112319716 13:98395350-98395372 TTACCCGCGGGGCTTCTCCTCGG - Exonic
1112706932 13:102080908-102080930 GTTGCCTAGTGGCTTCCCCTGGG - Intronic
1114533028 14:23407219-23407241 GTCATCTTGGTGCTTCCCCTGGG + Exonic
1115238482 14:31231706-31231728 GTCCCCTCTGTGCTTCTCTTTGG + Intergenic
1117336469 14:54760552-54760574 GGCTCCTGGGGGCTTCCCCTGGG + Intronic
1118564817 14:67128090-67128112 GTCTCCCCGTGGCTTACCCTTGG + Intronic
1119820939 14:77616131-77616153 GGCCCCTCATCGCTTCCCCTGGG + Intronic
1121637107 14:95461448-95461470 CTCCCCTCTGGGCTTAGCCTTGG + Intronic
1129986418 15:79923299-79923321 GTCCCCTCGGGGCTTCCCCTTGG - Intronic
1130907587 15:88251495-88251517 CTCCCCTCGGGGCCTCCAGTTGG - Intronic
1131464651 15:92645674-92645696 GACCCCATGGGGCTGCCCCTAGG - Intronic
1131519106 15:93099960-93099982 GTCACCTCCAGACTTCCCCTGGG - Intergenic
1132407465 15:101552481-101552503 GTCCCCTCGAGGACTCTCCTTGG - Intergenic
1133655800 16:7862547-7862569 GTCCCATGGGGGCTTCTTCTAGG + Intergenic
1134111206 16:11516409-11516431 GTTCCCTGGGAGCTTCCCATGGG - Intronic
1134395013 16:13854616-13854638 GTCCCCTAGGTGTTCCCCCTGGG + Intergenic
1138238989 16:55411358-55411380 GTCCCAGCAGTGCTTCCCCTTGG + Intronic
1138311467 16:56027117-56027139 TTCCCACCGGGGCTTCCCATTGG + Intergenic
1139408580 16:66739918-66739940 GCCCACTTGGGGCTTCCCTTTGG + Intronic
1139953098 16:70681343-70681365 GTCCCCTCGGGGTTTCCCAGGGG + Intronic
1140700270 16:77575073-77575095 GTCCCCTCCAGGATTTCCCTGGG - Intergenic
1142347122 16:89561071-89561093 CTGCGCTCGGGGCTGCCCCTGGG + Intronic
1142887217 17:2920349-2920371 GGCCCCTGGGGGCATCCCCTGGG - Intronic
1143503469 17:7351802-7351824 GCCCCCTCGGGAATTCCCCGGGG + Intergenic
1144831863 17:18136348-18136370 GTCCCCTGGGGGCTTTCCGGAGG + Intronic
1146492163 17:33291314-33291336 GCCCCCTCGGGGCTGTCCCCAGG - Intronic
1147861814 17:43528284-43528306 CTCCCCTGGGGGTTTCACCTGGG - Exonic
1149569983 17:57665563-57665585 GTCCTCAAGGGGCTGCCCCTGGG + Intronic
1151662439 17:75525860-75525882 GCCCCCTCGGGGCTTCCACCTGG + Intronic
1151678175 17:75610511-75610533 ATCCCCTCCAGGCCTCCCCTGGG + Intergenic
1151963383 17:77419137-77419159 CTCCCCTCGGGGGTTCCCACAGG - Intronic
1154294658 18:13137634-13137656 TTCTCCTGGGGGCTTCCCCAGGG + Intergenic
1156242416 18:35267109-35267131 GTCCCCTCTTGGCTTCCTCGGGG + Intronic
1160497996 18:79386432-79386454 CTCCCCTGGGGTCTTCACCTTGG - Intergenic
1160755920 19:757177-757199 GTCCCCACGGGGGCTCCACTCGG + Exonic
1162019443 19:7862051-7862073 GCCCCCTAGGGCCATCCCCTCGG + Intronic
1162096354 19:8312150-8312172 GTCTCCTGGGGGCTCCCTCTTGG - Intronic
1162382683 19:10340736-10340758 GTCCCCTTGGCGCCTTCCCTTGG - Intergenic
1162562014 19:11422438-11422460 GGCCTGTCGGGGCTTCCCCTGGG + Intronic
1162785747 19:13033598-13033620 GTCCCCTGTGGGCATGCCCTTGG + Intronic
1162913297 19:13861596-13861618 GCCTCCTCGGGGCTTTCTCTCGG + Intergenic
1163163635 19:15480448-15480470 TTCCCCTGGGGGCCACCCCTGGG + Intronic
1163243314 19:16077061-16077083 GTCCGGTCGCGGGTTCCCCTCGG - Intronic
1163417241 19:17194231-17194253 GTCCACTGTGGGCTTTCCCTTGG - Intronic
1163696969 19:18768927-18768949 CTCTCCACGGGGCTACCCCTTGG + Intronic
1164149143 19:22533182-22533204 GTCCCATCAGGCTTTCCCCTCGG + Intergenic
1164155609 19:22595494-22595516 GTCCCATCAGGCTTTCCCCTCGG - Intergenic
1165213889 19:34255178-34255200 GTCCCCGCGGACCCTCCCCTCGG - Intronic
1165330680 19:35139808-35139830 GTCCCCGGGGGGCCTCCCTTGGG - Intronic
1165796994 19:38525357-38525379 GTCCCCCCGGCGCTTCTTCTTGG - Exonic
1167433037 19:49464188-49464210 GCCCCCGCGGGGCGTCCCGTTGG - Exonic
1167622121 19:50566384-50566406 GGAGCCTCGGGGCTGCCCCTCGG - Intronic
930015020 2:46964269-46964291 TTTCCCCCGGGGCTTCCCTTTGG - Intronic
932736605 2:74259013-74259035 GCCTCCTCTGGGCTTCCCCAAGG + Intronic
940728641 2:157363667-157363689 GTCTCCTGGGTGTTTCCCCTAGG - Intergenic
941036890 2:160578674-160578696 CTTCCCTAGGGGCTTCCCTTAGG + Intergenic
945032887 2:205682106-205682128 GTCCCCCCGGGGTCTCCCTTGGG + Intronic
948624768 2:239262068-239262090 GGTCCCTCAGGGCTTTCCCTTGG - Intronic
1172793068 20:37519577-37519599 GTCTCCCCGGGGCTTCTCCTGGG + Intronic
1172951309 20:38724918-38724940 GTCCCCGCAGGGCTCTCCCTCGG - Exonic
1174382260 20:50163668-50163690 TTCCTCTGTGGGCTTCCCCTGGG + Intergenic
1175819925 20:61903706-61903728 GCCCCCTGGGGGCTGCCTCTCGG - Intronic
1176040042 20:63060545-63060567 GTCCCCTCCTGGCTGGCCCTGGG + Intergenic
1178811486 21:35886443-35886465 GTCACCTGGGGGCTTCCCAGAGG + Intronic
1179304804 21:40144424-40144446 GTTCCCTCGGGTCTGCCCCGGGG - Intronic
1179397602 21:41056022-41056044 GTGCCCTCGGGGCCTACCATTGG + Intergenic
1181174744 22:21029116-21029138 GTCTCCTCCAGGCTGCCCCTGGG + Exonic
1182103668 22:27674130-27674152 GTCCCCGGGGGGCCTCCCCCGGG - Intergenic
1182258538 22:29055571-29055593 GTCCCTTGGGGGCTGCTCCTCGG + Exonic
1183076968 22:35433442-35433464 GTCTGTTAGGGGCTTCCCCTGGG + Intergenic
1183332634 22:37229627-37229649 GTCCCCCCAGGACTCCCCCTAGG + Intronic
1183978601 22:41527085-41527107 GTCCCCTCGGGGCCTCGTTTGGG + Exonic
950569600 3:13791912-13791934 GTGCCCTGGGGGCTGACCCTGGG + Intergenic
953469967 3:43158176-43158198 GTGCCCTGAAGGCTTCCCCTTGG - Intergenic
954326455 3:49866797-49866819 GTCCCGTTTGGGCTTTCCCTGGG - Intronic
954411439 3:50372934-50372956 GCCCCCTCCCAGCTTCCCCTTGG - Intronic
955414366 3:58678817-58678839 GGTCCCTCACGGCTTCCCCTTGG + Intergenic
963843399 3:150130784-150130806 CTCCCCTCCAGGCTTCTCCTGGG - Intergenic
967236049 3:187384494-187384516 GTGCCCAAGGGGCTTCTCCTTGG - Intergenic
968513408 4:1005066-1005088 GTGCCCTGGGGGCTCCCCCGTGG - Intergenic
968693307 4:2008175-2008197 CTCCCATCGGGGTTTCCCGTCGG - Intronic
969296066 4:6271125-6271147 GTGGCCTCTGGGCTTCCCGTGGG - Intronic
969373014 4:6746279-6746301 CTGCCCTCAGGGCTTCTCCTGGG - Intergenic
973279269 4:48341925-48341947 GTCTCCTCGGGGCTTCCCCTTGG + Exonic
975778913 4:77819484-77819506 GTGCCGCCGCGGCTTCCCCTCGG - Intronic
984698920 4:182806362-182806384 CTTCCCTCTGGCCTTCCCCTGGG + Intergenic
984837922 4:184039716-184039738 GCCGCCTCTGGCCTTCCCCTTGG + Intergenic
985113939 4:186572906-186572928 GTCCCCTCGGGCCTCCTCCCCGG - Intergenic
985722660 5:1497871-1497893 GTCCTCCAGGGGCTGCCCCTTGG - Intronic
987151096 5:15040867-15040889 GTCCCCTTGGGTCTTATCCTAGG + Intergenic
987243921 5:16029103-16029125 GTCCCCTCTTGCCTGCCCCTGGG - Intergenic
993567106 5:89489571-89489593 GTACCCTAGGGTCTTTCCCTAGG - Intergenic
998040962 5:138950853-138950875 GTCCCCTCGGGGCCTGGTCTCGG + Intronic
999397377 5:151238613-151238635 GCCCCATCGGGACTCCCCCTTGG + Intronic
1002316877 5:178349470-178349492 GTCCCCTCCGGCCCTCCGCTAGG + Intronic
1006379746 6:33690678-33690700 CACCCCTCGTGCCTTCCCCTGGG + Intronic
1007764527 6:44152811-44152833 GGCCCCTCGGGGCTCCCGCCCGG + Intronic
1013048868 6:106512592-106512614 CTCCCCTCGGAGCTGCCCTTTGG - Exonic
1013464916 6:110409520-110409542 GTGACCTGGGGGCTTCACCTGGG - Intronic
1016935842 6:149448934-149448956 GTCTTCTCTGGTCTTCCCCTGGG + Intronic
1017597425 6:156044401-156044423 GACCCCTCTGGGTTTCACCTCGG + Intergenic
1017976343 6:159360761-159360783 CTCCCATCAGGGCTTCCTCTGGG - Intergenic
1019067869 6:169317665-169317687 GTCTCCTCGGGACTGGCCCTGGG - Intergenic
1020785821 7:12571104-12571126 GCCCCCACGGGGCTGCCCTTTGG + Intronic
1026880306 7:73903442-73903464 GGCCCCTCTGGGCTTCCTCCTGG - Intergenic
1030321944 7:108178671-108178693 GACCCCTCGGGCCTTCCCCAGGG - Intronic
1032398942 7:131610404-131610426 GTCATCTTGGGGCCTCCCCTGGG + Intergenic
1034162381 7:149002877-149002899 CTCCCCTCAGCGCTTCTCCTGGG - Intergenic
1034343424 7:150371887-150371909 GTCACCGCGGGGCGGCCCCTGGG - Exonic
1034842943 7:154416639-154416661 ATCCACTGGGGGCATCCCCTTGG + Intronic
1034911742 7:155003172-155003194 GGCTCCTCGGCGCTCCCCCTCGG - Intergenic
1034936502 7:155203778-155203800 GACCCCACGGGGCGGCCCCTCGG - Intergenic
1035018501 7:155787212-155787234 GACGCCTCGGGGCTTACCTTGGG - Intergenic
1035388523 7:158490103-158490125 CTCCCCTTGAGGCCTCCCCTGGG + Intronic
1035741957 8:1935324-1935346 GTCCACTGGGGGCTTACTCTTGG + Intronic
1036122879 8:6037170-6037192 GTCGCCTCGTTGCTTCCCATTGG + Intergenic
1038349519 8:26763278-26763300 GTCCTCTGGGGACTTCCACTTGG + Intronic
1038689646 8:29749672-29749694 GACCCCTGGGGACTTCCTCTTGG - Intergenic
1039554356 8:38466275-38466297 GTCCCCTCTCGGCTGCCCCGCGG - Intronic
1043582710 8:81732556-81732578 GTCCCCTCGGCGCGGCCCCGGGG + Exonic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1049062927 8:140290160-140290182 GTCCCCTCAGGGCCTTGCCTGGG + Intronic
1049370196 8:142260715-142260737 GTGCCCTCTGTGCTTCCCCCAGG - Intronic
1058710145 9:107672146-107672168 GTCCCTTCAGGGCTAACCCTGGG - Intergenic
1059399431 9:114059596-114059618 ATCCCCTGGGACCTTCCCCTGGG - Intergenic
1060555044 9:124503760-124503782 GTCCCCTGGCGTCTTCCCCGCGG - Intronic
1060661222 9:125406338-125406360 CTCTCCTCTGGGCTTCCCCAAGG + Intergenic
1061970440 9:134041986-134042008 GTGCCCATGGGGCTGCCCCTTGG + Intronic
1062127303 9:134870542-134870564 GTGCCCTCGGGGGGTGCCCTGGG + Intergenic
1062518441 9:136947444-136947466 CTGCCCTCGGGGCAGCCCCTGGG + Intronic
1062698688 9:137888222-137888244 GGCACCACGGGGCTTCCCGTGGG - Intronic
1186395760 X:9207325-9207347 GTCTCCTCCGGGCTGCGCCTCGG - Intergenic
1189391548 X:40580928-40580950 GTCCCTTCGTCGCTTCCGCTGGG - Exonic
1196965369 X:121048752-121048774 GTCCATTCTGGGCTTCCCCAAGG + Exonic
1197280136 X:124526016-124526038 GTCTCCTTGGGACTTCCCTTAGG + Intronic