ID: 1129996005

View in Genome Browser
Species Human (GRCh38)
Location 15:80006821-80006843
Sequence CTGCTGTGCTCCAGGACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129996005_1129996009 -1 Left 1129996005 15:80006821-80006843 CCATTTGTCCTGGAGCACAGCAG No data
Right 1129996009 15:80006843-80006865 GCACCTGTTGGGCTCCCTGCTGG No data
1129996005_1129996013 20 Left 1129996005 15:80006821-80006843 CCATTTGTCCTGGAGCACAGCAG No data
Right 1129996013 15:80006864-80006886 GGCCTCCTTTCCTGTGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129996005 Original CRISPR CTGCTGTGCTCCAGGACAAA TGG (reversed) Intergenic
No off target data available for this crispr