ID: 1130000123

View in Genome Browser
Species Human (GRCh38)
Location 15:80039030-80039052
Sequence AGGGTGGACTTTGCCCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130000123_1130000127 -8 Left 1130000123 15:80039030-80039052 CCCCCAAGGGCAAAGTCCACCCT No data
Right 1130000127 15:80039045-80039067 TCCACCCTGACCCTCCCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130000123 Original CRISPR AGGGTGGACTTTGCCCTTGG GGG (reversed) Intergenic
No off target data available for this crispr