ID: 1130000127

View in Genome Browser
Species Human (GRCh38)
Location 15:80039045-80039067
Sequence TCCACCCTGACCCTCCCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130000120_1130000127 10 Left 1130000120 15:80039012-80039034 CCATGGCTCTAGCTGACTCCCCC No data
Right 1130000127 15:80039045-80039067 TCCACCCTGACCCTCCCCTATGG No data
1130000124_1130000127 -9 Left 1130000124 15:80039031-80039053 CCCCAAGGGCAAAGTCCACCCTG No data
Right 1130000127 15:80039045-80039067 TCCACCCTGACCCTCCCCTATGG No data
1130000119_1130000127 13 Left 1130000119 15:80039009-80039031 CCTCCATGGCTCTAGCTGACTCC No data
Right 1130000127 15:80039045-80039067 TCCACCCTGACCCTCCCCTATGG No data
1130000125_1130000127 -10 Left 1130000125 15:80039032-80039054 CCCAAGGGCAAAGTCCACCCTGA No data
Right 1130000127 15:80039045-80039067 TCCACCCTGACCCTCCCCTATGG No data
1130000123_1130000127 -8 Left 1130000123 15:80039030-80039052 CCCCCAAGGGCAAAGTCCACCCT No data
Right 1130000127 15:80039045-80039067 TCCACCCTGACCCTCCCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130000127 Original CRISPR TCCACCCTGACCCTCCCCTA TGG Intergenic
No off target data available for this crispr