ID: 1130002646

View in Genome Browser
Species Human (GRCh38)
Location 15:80060167-80060189
Sequence TGCGAGCGGTTGGCTGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130002632_1130002646 13 Left 1130002632 15:80060131-80060153 CCGCGGAGGCCGCGACGCGCGCC 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1130002646 15:80060167-80060189 TGCGAGCGGTTGGCTGGCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 100
1130002636_1130002646 -8 Left 1130002636 15:80060152-80060174 CCGCCCCGAGCGGGTTGCGAGCG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1130002646 15:80060167-80060189 TGCGAGCGGTTGGCTGGCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 100
1130002633_1130002646 4 Left 1130002633 15:80060140-80060162 CCGCGACGCGCGCCGCCCCGAGC 0: 1
1: 0
2: 1
3: 104
4: 587
Right 1130002646 15:80060167-80060189 TGCGAGCGGTTGGCTGGCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 100
1130002630_1130002646 29 Left 1130002630 15:80060115-80060137 CCTCAGTTCTTCAGGGCCGCGGA 0: 1
1: 0
2: 0
3: 13
4: 93
Right 1130002646 15:80060167-80060189 TGCGAGCGGTTGGCTGGCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130002646 Original CRISPR TGCGAGCGGTTGGCTGGCGG GGG Intronic
903935314 1:26891084-26891106 TGCTGGTGGGTGGCTGGCGGCGG + Exonic
905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG + Intergenic
905511828 1:38527883-38527905 TGTGGGCTGTTGGCTGGAGGCGG - Intergenic
917744739 1:177996459-177996481 TGAGAGCGGGTGGCTGAGGGAGG + Intergenic
922294646 1:224238991-224239013 TGCCAGAGGTTGGGAGGCGGGGG - Intronic
1069544896 10:69320754-69320776 TGCTGGCTGTTGGCTGCCGGTGG + Intronic
1070257785 10:74826083-74826105 TGAGAGCTGATCGCTGGCGGCGG - Intronic
1073009280 10:100347225-100347247 TGCGAGGAGTTGACTGGCGCGGG - Exonic
1074818607 10:117163208-117163230 TGGGAGCGATTTTCTGGCGGTGG + Intergenic
1081992155 11:47343643-47343665 TGCGGGCGGTGGGGTGGCCGGGG - Intronic
1083234816 11:61344591-61344613 GGCGAGCGGATGGCTTGAGGTGG - Intronic
1083579087 11:63813535-63813557 GGCGAGCGGCGGGCGGGCGGCGG + Exonic
1084871130 11:72099157-72099179 TGCGAGCGGAAGGCAGGCTGTGG + Exonic
1087609838 11:100420995-100421017 TGGGACAGGATGGCTGGCGGTGG - Intergenic
1092203821 12:6603549-6603571 TGAGAGAGGTGGGGTGGCGGGGG + Intronic
1103074249 12:117969250-117969272 AGCGAGCGATCGGCGGGCGGGGG + Intergenic
1103457036 12:121076092-121076114 GGCGGGCGGTTGCCAGGCGGAGG - Intergenic
1103698542 12:122835643-122835665 GGCGAGCGGGCGGCGGGCGGCGG + Exonic
1105738827 13:23300595-23300617 TGCAAGCCGTTGCCTGGCCGAGG + Intronic
1114519157 14:23321889-23321911 GGCGAGCGGGTGGCAGGCGGGGG + Intronic
1117014147 14:51501362-51501384 TGGGAGGGGTTGGTTGGGGGAGG - Intronic
1117523887 14:56578408-56578430 TGCCAGCTGTTGGCTAGAGGCGG + Intronic
1119483610 14:74974718-74974740 TGCAAGCTGTTGGCTGCGGGAGG + Intergenic
1122117574 14:99535506-99535528 TGGGAGGGGTTGGCTGTAGGGGG - Intronic
1122238203 14:100344836-100344858 GGCGGGCGGTTGCCGGGCGGAGG - Intronic
1124100377 15:26687498-26687520 TGGGAGAGGTAGGCAGGCGGAGG - Intronic
1125626897 15:41116181-41116203 TGCGGGCGCTGGGCCGGCGGCGG + Exonic
1129929437 15:79398147-79398169 TGCCAGGGGTTGGATGGAGGAGG - Intronic
1130002646 15:80060167-80060189 TGCGAGCGGTTGGCTGGCGGGGG + Intronic
1136498416 16:30658099-30658121 TGGGGGCGGTTGGCCGCCGGGGG - Intergenic
1145391568 17:22459710-22459732 TGCCCGCGGTTTGCTGGCCGGGG - Intergenic
1146256622 17:31394914-31394936 TTCCAGCGGTGGGGTGGCGGGGG + Intronic
1146393616 17:32444511-32444533 TGAGAGCGGTAAGATGGCGGCGG + Exonic
1146911372 17:36650547-36650569 TGCGATGGGTTGGCAGGAGGAGG - Intergenic
1147360561 17:39927288-39927310 TGCGAGCGGGAGGCCGGGGGTGG - Intronic
1147914597 17:43878945-43878967 TGGGAGAGGTGGGCTGGAGGTGG - Intronic
1149136426 17:53370675-53370697 TGCCTGTGGTTGGCTGGCTGTGG - Intergenic
1149478954 17:56986177-56986199 TGCGAGAGGGAGGCTGGAGGAGG - Intronic
1149597889 17:57874842-57874864 TTCGGGCGGGTGGCCGGCGGCGG + Intronic
1149891316 17:60392324-60392346 TGCGCGCGGTTAGCTTGGGGAGG - Intronic
1151670341 17:75568724-75568746 TGGGAGAGTTTGGCTTGCGGTGG - Intronic
1152349795 17:79778183-79778205 TCCGGGCGGGTGACTGGCGGCGG + Exonic
1152645282 17:81465794-81465816 TGGGAGCGGGGGGCTGGAGGCGG - Exonic
1160811512 19:1014909-1014931 CGGGAGCCGTTGGCTGGCAGAGG - Intronic
1161752924 19:6110542-6110564 TGCGCGAGGCTGGCTGGCGGCGG - Intronic
1161857192 19:6772746-6772768 TGCGGGCGGGTGGGTGGTGGAGG + Exonic
1163267826 19:16232303-16232325 TGAGAGCTGTAGGCTGGCGCCGG - Intronic
1167072956 19:47231157-47231179 TGCGAGCGGGCGCCTGGCGGCGG - Intronic
1168365973 19:55787815-55787837 TGAGAGCTGTTGGCTGGAAGAGG - Intronic
925307143 2:2856425-2856447 TGTCAGCGGTCGGCTGGCAGAGG + Intergenic
929138218 2:38644871-38644893 AATGAGCGGTTGCCTGGCGGTGG + Intergenic
931692642 2:64848203-64848225 TTCGAGGGGTTGGCTGTTGGGGG + Intergenic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
933728166 2:85437956-85437978 TGCAAGCGGGAGGCTGGGGGCGG + Intergenic
935726863 2:106031058-106031080 TGAGAGCAGCTGGCTGGGGGTGG - Intergenic
938875972 2:135531694-135531716 CGCTACCGGTTGGCGGGCGGGGG - Intronic
945688625 2:213005177-213005199 TGGGAGTGGTTGGGTGGGGGGGG + Intronic
946027270 2:216679437-216679459 AGCGAGCGGTTTGCTTGCTGGGG + Intronic
947548958 2:231032921-231032943 TGCCAGGTGTTGGCTGACGGAGG + Intergenic
1176005859 20:62861914-62861936 TGCGGGCGGTTGGGCGGGGGCGG - Intergenic
1176162241 20:63653729-63653751 TGTGAGCGGTTGGAGGGTGGGGG - Intergenic
1178910597 21:36670178-36670200 TGGGGGAGGTTGGGTGGCGGGGG - Intergenic
1181966052 22:26657434-26657456 CGGGAGCGGCTGGCGGGCGGAGG - Intergenic
1182321786 22:29482439-29482461 CACGAGCGGGTTGCTGGCGGGGG + Intronic
1182355267 22:29719955-29719977 GGCGGGCGGGCGGCTGGCGGGGG + Intergenic
1184225796 22:43128262-43128284 GGCGGGCGGCTGGCTGGCGGAGG + Intronic
1184820399 22:46905581-46905603 TGCGGTCGGTTGGCGGGTGGGGG + Intronic
1185107641 22:48883368-48883390 TGCTGGCGCTCGGCTGGCGGTGG + Intergenic
956465030 3:69511596-69511618 TGGGAGCCATTGGCTGGGGGTGG - Intronic
963617968 3:147567755-147567777 TGGGAGCATTTGGCAGGCGGGGG - Intergenic
966206898 3:177414211-177414233 TGCAAGAGATTTGCTGGCGGGGG - Intergenic
967926601 3:194653782-194653804 TCCCAGCGCTTGGGTGGCGGAGG + Intronic
968895993 4:3403752-3403774 TGTGAGGGGCTGGCTTGCGGAGG - Intronic
969305897 4:6326167-6326189 TGGGAGGGGTTGGCTGGCTGAGG + Intronic
969330762 4:6472420-6472442 AGCGCGCGGTGGGCGGGCGGCGG + Intronic
969415638 4:7056130-7056152 TCTGACCAGTTGGCTGGCGGTGG + Exonic
983624811 4:169791736-169791758 GGCGGGCGGCTGTCTGGCGGCGG + Intergenic
988916094 5:35894784-35894806 TGCTAGAGGTTGGCTGGGCGTGG + Intergenic
997926200 5:138033069-138033091 GGAGAGCGGCTGGCGGGCGGAGG + Intronic
998181412 5:139948074-139948096 TGCCAGGGGTTGGGTGGGGGAGG - Intronic
1002827966 6:790922-790944 TTCGAGGTGTTGGCTGCCGGGGG + Intergenic
1004396121 6:15248122-15248144 TGCAAGCCCGTGGCTGGCGGCGG + Intronic
1004996807 6:21201225-21201247 TGCTAGCGGTTTGCTGATGGAGG - Exonic
1006871720 6:37257798-37257820 TGGGAGCGGGTGACCGGCGGCGG + Exonic
1007104385 6:39273529-39273551 TGGGAGGAGTAGGCTGGCGGGGG - Intergenic
1008527342 6:52420089-52420111 TGGGAGCTGTTGGGTGGCGCGGG - Intergenic
1008956615 6:57222365-57222387 TTCTGGCGGGTGGCTGGCGGCGG + Intergenic
1012058340 6:94444778-94444800 TGCGGGGGGTTGGGTGGGGGTGG + Intergenic
1013651545 6:112200092-112200114 TGCGAGCAGCTGGCAGGTGGAGG + Intronic
1027132251 7:75599338-75599360 TGGGGGAGGTTGGCTGGAGGAGG - Intronic
1029816518 7:103102003-103102025 TGCCAGTGGTTGGGGGGCGGGGG - Exonic
1037547831 8:19940453-19940475 AGCGGGCGGTTCCCTGGCGGCGG - Intronic
1043637480 8:82404512-82404534 TGCGATCGGCTGGCTGGAGGAGG + Intergenic
1045139229 8:99261287-99261309 TGCTAGGGTTTGGCTGGTGGGGG - Intronic
1048152098 8:131904109-131904131 GGCGAGGAGTGGGCTGGCGGCGG + Exonic
1049419094 8:142509084-142509106 TGTGAGCCGCTGGCTGGCGGGGG - Intronic
1059382026 9:113934206-113934228 TGGGAGGGGTTGTCTGGTGGAGG + Intronic
1060974304 9:127755369-127755391 TGGGAGCGGGGGGCGGGCGGAGG - Intronic
1061589389 9:131588821-131588843 TGCCAGGGGCTGGCTGGAGGTGG + Exonic
1061907854 9:133707997-133708019 TGCCAGCAGTTGGCAGGGGGCGG + Intronic
1062266676 9:135689717-135689739 TGAGAGGGGGAGGCTGGCGGTGG - Intergenic
1187048856 X:15675967-15675989 TGGGAGTGGGAGGCTGGCGGCGG + Intergenic
1187839283 X:23470088-23470110 TGCCAGGGGTTGGGTGGCGAGGG + Intergenic
1192366431 X:70477599-70477621 TGCGGGGGGTGGGGTGGCGGAGG - Intronic
1195238978 X:102932274-102932296 TGGGAGCGGTGGGGGGGCGGGGG + Intergenic
1198750305 X:139932205-139932227 TGCGGGCGGCTGGGGGGCGGGGG - Intronic
1200256586 X:154585816-154585838 TGGGAGCGGGTGGCGGGAGGTGG + Intronic
1200261183 X:154618587-154618609 TGGGAGCGGGTGGCGGGAGGTGG - Intronic