ID: 1130002646

View in Genome Browser
Species Human (GRCh38)
Location 15:80060167-80060189
Sequence TGCGAGCGGTTGGCTGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130002633_1130002646 4 Left 1130002633 15:80060140-80060162 CCGCGACGCGCGCCGCCCCGAGC 0: 1
1: 0
2: 1
3: 104
4: 587
Right 1130002646 15:80060167-80060189 TGCGAGCGGTTGGCTGGCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 100
1130002636_1130002646 -8 Left 1130002636 15:80060152-80060174 CCGCCCCGAGCGGGTTGCGAGCG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1130002646 15:80060167-80060189 TGCGAGCGGTTGGCTGGCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 100
1130002630_1130002646 29 Left 1130002630 15:80060115-80060137 CCTCAGTTCTTCAGGGCCGCGGA 0: 1
1: 0
2: 0
3: 13
4: 93
Right 1130002646 15:80060167-80060189 TGCGAGCGGTTGGCTGGCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 100
1130002632_1130002646 13 Left 1130002632 15:80060131-80060153 CCGCGGAGGCCGCGACGCGCGCC 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1130002646 15:80060167-80060189 TGCGAGCGGTTGGCTGGCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130002646 Original CRISPR TGCGAGCGGTTGGCTGGCGG GGG Intronic