ID: 1130003829

View in Genome Browser
Species Human (GRCh38)
Location 15:80074215-80074237
Sequence CTGGATATTAAAATCAGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 802
Summary {0: 1, 1: 0, 2: 6, 3: 123, 4: 672}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130003826_1130003829 15 Left 1130003826 15:80074177-80074199 CCACTTTCCAAGATGTAGATGGA 0: 1
1: 0
2: 3
3: 7
4: 138
Right 1130003829 15:80074215-80074237 CTGGATATTAAAATCAGCTGAGG 0: 1
1: 0
2: 6
3: 123
4: 672
1130003827_1130003829 8 Left 1130003827 15:80074184-80074206 CCAAGATGTAGATGGATATAAAG 0: 1
1: 0
2: 0
3: 11
4: 183
Right 1130003829 15:80074215-80074237 CTGGATATTAAAATCAGCTGAGG 0: 1
1: 0
2: 6
3: 123
4: 672
1130003824_1130003829 28 Left 1130003824 15:80074164-80074186 CCTATTTTCAACACCACTTTCCA 0: 1
1: 0
2: 3
3: 21
4: 336
Right 1130003829 15:80074215-80074237 CTGGATATTAAAATCAGCTGAGG 0: 1
1: 0
2: 6
3: 123
4: 672

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130003829 Original CRISPR CTGGATATTAAAATCAGCTG AGG Intronic
900705758 1:4079060-4079082 ATGCAGTTTAAAATCAGCTGAGG + Intergenic
900844244 1:5083445-5083467 CTGCATATTACAATCAGCCAAGG - Intergenic
901767668 1:11514247-11514269 TTGGATATCAAAATCACCTGGGG - Intronic
902104708 1:14024890-14024912 GTGTATATTAATGTCAGCTGGGG - Intergenic
902320069 1:15656047-15656069 CAGGAGTTCAAAATCAGCTGGGG - Intronic
903000050 1:20258749-20258771 CTGCACATTAGAATCATCTGGGG + Intergenic
903274171 1:22210303-22210325 CTGGATCTTGAAATCAAGTGTGG + Intergenic
904072678 1:27813828-27813850 CTGCATATTATAATCACCTGGGG - Intronic
904123010 1:28215429-28215451 GTGAATATTAGAATCACCTGTGG + Intronic
904230180 1:29063105-29063127 CTGGAAATTAAAATCTGTTTGGG - Intronic
904953759 1:34266065-34266087 CTGAATATTAGAATCACCTGGGG - Intergenic
905093153 1:35446066-35446088 CTGTAGATTAAATTCACCTGGGG + Intronic
905338144 1:37259568-37259590 CTGCACATTAGAATCACCTGGGG - Intergenic
905439464 1:37985387-37985409 CTGCACATTAGAATCACCTGGGG + Intronic
906436319 1:45799839-45799861 TAGGATATTATAATTAGCTGAGG - Intronic
907183847 1:52594062-52594084 CTGCACCTTAAAATCAGCTGGGG + Intergenic
908419380 1:63944934-63944956 TTGCATATTAAAATTACCTGGGG + Intronic
909039531 1:70632224-70632246 CTGCACATTAAAATCAGCAAGGG + Intergenic
909815493 1:79987409-79987431 CTGTAAATTAAAATGATCTGGGG + Intergenic
909965213 1:81900994-81901016 CTGCATATTAAATACAGCTGAGG + Intronic
910836676 1:91519918-91519940 TTGTACATTAAAATCACCTGAGG + Intronic
911528805 1:99018843-99018865 CTACATATTGAAATCACCTGGGG - Intergenic
911697585 1:100908955-100908977 CTGAACATTAAAATCTGCTATGG - Intronic
911819382 1:102397890-102397912 CTGAATATTCAAATGAGATGAGG + Intergenic
912322128 1:108723869-108723891 CTGCATAGTAGAATCAACTGGGG - Intronic
912428414 1:109614601-109614623 CTGTACACTAGAATCAGCTGGGG - Exonic
913090945 1:115476132-115476154 CTGCATATTAGAGTCACCTGGGG + Intergenic
913414661 1:118591615-118591637 CTGCACATTAAAATCATCTGGGG + Intergenic
913503084 1:119489617-119489639 TTGCCTATTAAAATCACCTGGGG + Intergenic
914331922 1:146680124-146680146 CTAAATATTTAAATAAGCTGTGG + Intergenic
916166324 1:161969961-161969983 CTGCACATTAGAATCACCTGGGG - Intergenic
916276100 1:162994972-162994994 CTGAACATTAAAATCATCTGAGG + Intergenic
916422192 1:164647687-164647709 CTGAACATTAAAATCACCTGGGG + Intronic
916494810 1:165336828-165336850 ATGGAGATTAAAATCTGATGGGG + Intronic
917380430 1:174400362-174400384 GTGGATTTTAAAGTCTGCTGGGG - Intronic
917409093 1:174739623-174739645 CTGCTTATTAAAATCACCTGGGG - Intronic
917838355 1:178958434-178958456 CTGTACATTAAGATCACCTGGGG - Intergenic
918307829 1:183263456-183263478 CTGCACATTAGAATCACCTGAGG + Intronic
919201781 1:194364484-194364506 CTGGATAATAGAATCACCTTAGG - Intergenic
919550259 1:198977040-198977062 CTCGTTCTTAAAATCAACTGTGG - Intergenic
919896048 1:202010453-202010475 CTGAATATGCAAATCACCTGGGG + Exonic
920419205 1:205819054-205819076 CTGCATATTAGAATCTCCTGGGG + Intergenic
920598429 1:207297110-207297132 CTTGGCATTAAAAACAGCTGTGG - Intergenic
920690530 1:208143120-208143142 CTGCACATTAGAATCATCTGGGG + Intronic
921548412 1:216501854-216501876 CTGCATATTGAAATCACCTGGGG - Intergenic
921663624 1:217839064-217839086 CTGGATATTAAAAGCGACTTTGG + Intronic
921777723 1:219121853-219121875 CTGCACATTAGAATCAGCAGGGG + Intergenic
923152566 1:231246841-231246863 CTGCACATTAAAATAACCTGGGG - Intronic
923333809 1:232950168-232950190 CTGCAGAATAGAATCAGCTGGGG - Intergenic
924465331 1:244294344-244294366 CTACATATTAGAATCACCTGGGG - Intergenic
1062903730 10:1165868-1165890 CTGGAGAGGAAAATCAGTTGCGG - Intergenic
1064484833 10:15775420-15775442 CTGGATATTAAAATAATTGGAGG - Intergenic
1064678372 10:17784544-17784566 CTGTACATTAAAATCAACTATGG + Intronic
1064834119 10:19505924-19505946 CTGCATATTAGAATCATCTAGGG + Intronic
1066501821 10:36002311-36002333 CTGCATATTAGAATCAACTGGGG + Intergenic
1066707268 10:38194182-38194204 CTGCACATTAAAATCAACTGAGG - Intergenic
1066982435 10:42430559-42430581 CTGTACATTAAAATCAACTGAGG + Intergenic
1067166584 10:43870314-43870336 CTGCCTCTTAAAATCAGCTGAGG + Intergenic
1068299338 10:55118474-55118496 CTGTATATTAAAATTTTCTGAGG + Intronic
1068602071 10:58966941-58966963 CTGCATATTAGAATCACCTGGGG - Intergenic
1068647030 10:59479537-59479559 CTGGAAATTGAAATCATTTGAGG - Intergenic
1068900524 10:62264731-62264753 CTGCATATTAGAATCATCTGAGG + Intronic
1068943571 10:62705476-62705498 CTGTAAATTAGAATCACCTGGGG + Intergenic
1069383271 10:67861897-67861919 CTTGCTATTAAAATCCTCTGGGG - Intergenic
1069412836 10:68170802-68170824 CTGCACATTAAAATAATCTGTGG - Intronic
1069601379 10:69710352-69710374 CTGCATATTCAAACCACCTGGGG - Intergenic
1069848421 10:71389386-71389408 CTGCACATTAGAATCATCTGAGG + Intergenic
1069874449 10:71553131-71553153 CTGCATATTAGAATCACCTGGGG - Intronic
1070131576 10:73659208-73659230 TTGCATATTAGAATCATCTGTGG - Intronic
1070318366 10:75335527-75335549 CTGAACATTGAAATCACCTGGGG - Intergenic
1071883256 10:89922334-89922356 CTGATTATCAAAATCATCTGGGG + Intergenic
1072088245 10:92101437-92101459 CTGGCTATTAGGATGAGCTGGGG - Intronic
1072223019 10:93343525-93343547 CAGCATATTAAAATCATTTGAGG + Intronic
1072255381 10:93615708-93615730 CTGCATATTAGAAGTAGCTGGGG - Intronic
1072398277 10:95068219-95068241 CTGGGCATTAGAATCACCTGGGG - Intronic
1072732751 10:97858741-97858763 CTGGATGTGAAAAGCATCTGGGG + Intronic
1072806746 10:98428381-98428403 CTGCATATTGAACTCACCTGGGG - Intronic
1072848267 10:98857017-98857039 CTGGAGAGAAGAATCAGCTGAGG - Intronic
1072882823 10:99245220-99245242 CTGCACATTAAAATCATCTGAGG + Intergenic
1073151934 10:101317604-101317626 CTACACATTAGAATCAGCTGGGG - Intergenic
1073257669 10:102164277-102164299 CTGAAAATTAGAATCATCTGAGG + Intergenic
1073299443 10:102461906-102461928 CTGCACGTTAAAATCACCTGAGG - Intronic
1073485294 10:103813826-103813848 CTGTACATTACAATCACCTGGGG + Intronic
1073981406 10:109158177-109158199 CTGCACATTAAAATCATCTGTGG - Intergenic
1074007751 10:109445634-109445656 CTGCACATTAGAATCAACTGGGG - Intergenic
1074224281 10:111468347-111468369 CTGTATATTAAAATCATCTATGG - Intergenic
1074262050 10:111863826-111863848 TTGGACATTTAAATCAGCTGGGG + Intergenic
1074302857 10:112248674-112248696 CTGGACATTAAAATCATTTAGGG + Intergenic
1074799345 10:116983530-116983552 CTACACATTAAAATCACCTGCGG + Intronic
1074902691 10:117832740-117832762 CTGCACCTTAAAATCACCTGGGG + Intergenic
1075018259 10:118927143-118927165 CTGAATGTTCAAATCACCTGGGG - Intergenic
1075129176 10:119724165-119724187 CTGCATAGTAAAGTCATCTGGGG + Intergenic
1075129189 10:119724286-119724308 CTGCCTATTAGAATCACCTGGGG - Intergenic
1075589239 10:123679525-123679547 CTGGCAATTAGAATCATCTGAGG - Intronic
1075690606 10:124391529-124391551 CTGGATATTAAATGCTCCTGGGG - Intergenic
1076205791 10:128601254-128601276 GTGGATATTAAGATCTGCTAGGG + Intergenic
1077668117 11:4133885-4133907 CTGCATCTTAGAATCAACTGGGG + Intronic
1078038595 11:7835479-7835501 CTGGATATCAAAATCACCTGAGG - Intergenic
1078270910 11:9793795-9793817 CTGAACATTAGAATCACCTGGGG - Intronic
1078350880 11:10592164-10592186 CTGCACATTAGAATCACCTGGGG + Intronic
1078639308 11:13080422-13080444 CTGCATATTAGAATCACCTGGGG + Intergenic
1079029237 11:16973562-16973584 CTGCACATTAAAATCACTTGGGG + Intronic
1079631878 11:22687433-22687455 CTGCACATTAGAATCACCTGGGG - Intronic
1079936270 11:26620564-26620586 ATGGATTTTAAAATCAGAGGAGG - Intronic
1080928760 11:36785371-36785393 GTGCACATTAAAATCACCTGGGG - Intergenic
1082873980 11:57969733-57969755 CTGCACATTAAAATCACCAGTGG - Intergenic
1085574819 11:77592837-77592859 CTCTGTATTAAAATCACCTGGGG + Intronic
1085983484 11:81754363-81754385 ATGGATAATAAAATCTTCTGGGG - Intergenic
1086538945 11:87884716-87884738 AGGGATATCAAAATCAGTTGAGG + Intergenic
1087050686 11:93883560-93883582 ATTTATATTAAGATCAGCTGGGG + Intergenic
1087132659 11:94681823-94681845 CTGGTTATAAAAATCAGCAAAGG - Intergenic
1087173369 11:95073753-95073775 GTGCATATTAGAATCACCTGGGG - Intergenic
1087342972 11:96932266-96932288 CTGGATATTAAAAGTAGCTCTGG - Intergenic
1088436351 11:109817374-109817396 CTGATTATTAAAATCATCTGAGG + Intergenic
1088501632 11:110489392-110489414 CTGTATGTTACAATCACCTGGGG + Intergenic
1088603042 11:111500254-111500276 ATGGGTATTAGAATCACCTGGGG - Intronic
1088756386 11:112888767-112888789 CTGCCCATTAAAATCAGCTGGGG - Intergenic
1089105390 11:115998986-115999008 CTGTATATTAATATCACCTGAGG - Intergenic
1089457895 11:118635932-118635954 CTGGATATTAGAGCCAGCTAGGG + Intronic
1089995999 11:122908130-122908152 CTAAATATTAGAATCACCTGGGG - Intronic
1090331488 11:125935823-125935845 CAGAATATTAGAAACAGCTGTGG + Intergenic
1090432901 11:126661693-126661715 CTGCATGTTAGAATCACCTGAGG + Intronic
1090477501 11:127036857-127036879 CAGGAAAATCAAATCAGCTGAGG + Intergenic
1091638616 12:2216739-2216761 CTGCCTATTAGAATCACCTGGGG - Intronic
1094569771 12:31631593-31631615 CTGGCTACTATAAGCAGCTGAGG + Intergenic
1095862123 12:46929171-46929193 CTGCAAATAAGAATCAGCTGGGG - Intergenic
1098069120 12:66652752-66652774 CTTGTTATTGAAATCAGCTTTGG - Intronic
1098147979 12:67517059-67517081 CTGTACATTAGAATCACCTGGGG + Intergenic
1098174321 12:67775046-67775068 ATAGATCTTAAAATCAGTTGGGG + Intergenic
1098363059 12:69674297-69674319 CTGCACATTAAAATCACCCGAGG + Intronic
1099013691 12:77321258-77321280 CTGCATATTACAATCACCTGAGG - Intergenic
1099117966 12:78650920-78650942 CAGGATTTCAAAACCAGCTGGGG + Intergenic
1099858266 12:88197808-88197830 CTTCATATTAGAATCATCTGAGG + Exonic
1100467516 12:94859966-94859988 CTGGTTATTAGAATCAGTTGTGG - Intergenic
1100692769 12:97056654-97056676 CTGCACATTAGAATCACCTGTGG + Intergenic
1100713211 12:97279143-97279165 CTGAATATTAGAAGCACCTGGGG - Intergenic
1100873534 12:98938472-98938494 CTGCACATGAAAATCATCTGGGG - Intronic
1101208991 12:102517450-102517472 CTGCATATTAGAATCACCTAAGG - Intergenic
1101294403 12:103406181-103406203 CTGTACATCAAAATCACCTGAGG + Intronic
1101604417 12:106237202-106237224 CTGGACATTAAAATCAGAGAGGG + Intergenic
1102753771 12:115320330-115320352 CTGCATGTTAGAATCATCTGGGG - Intergenic
1103065856 12:117896854-117896876 CTCCATATTAGAATCACCTGGGG - Intronic
1104417626 12:128608320-128608342 CTGCATATTAGAATCACCTGGGG + Intronic
1104913910 12:132254310-132254332 ATGCATATTAAAAGCAGCGGAGG - Intronic
1108158039 13:47607851-47607873 CTTGATATCAAAATCAGATAAGG + Intergenic
1108180430 13:47835118-47835140 CTGCACATTCAAATCACCTGTGG + Intergenic
1108710686 13:53029409-53029431 CTATATATTAGAATCACCTGGGG - Intronic
1109766384 13:66905390-66905412 CTGTATATTAGAATCACCTGGGG + Intronic
1109923988 13:69109897-69109919 CTACACATTAAAATCATCTGGGG + Intergenic
1110624815 13:77641540-77641562 CTGCATATTATAATCATCTGGGG + Intronic
1110652508 13:77958673-77958695 CTGCACATTAAAATAACCTGGGG - Intergenic
1110792539 13:79601366-79601388 CTGCACATTAGAATCACCTGAGG + Intergenic
1110911028 13:80963648-80963670 CAGTATCTTAAAATTAGCTGAGG - Intergenic
1111131717 13:83985545-83985567 CTAAATATTAAAATCATCTTGGG - Intergenic
1111857081 13:93651814-93651836 CTGCACATTAGAATCACCTGGGG + Intronic
1112033642 13:95478423-95478445 CTGTATGTTTAAATCACCTGGGG - Intronic
1113318629 13:109210049-109210071 CATGATATGAAAATCAGCAGAGG + Intergenic
1114436648 14:22712454-22712476 CTGGATATTAACATCACAGGAGG - Intergenic
1115253775 14:31376914-31376936 CTGGAGTTCAAGATCAGCTGGGG + Intronic
1115282922 14:31685057-31685079 CTGTATATTAGAATCATCTAGGG + Intronic
1116339993 14:43710327-43710349 CTGAATATCAGAATCATCTGAGG - Intergenic
1116446005 14:45012391-45012413 CTGCACATTAGAATCATCTGAGG - Intronic
1116550754 14:46234747-46234769 CTGCATGTCAAAATCACCTGAGG + Intergenic
1117140595 14:52787152-52787174 CTGGATATAGAAATAAGTTGGGG - Intronic
1117401061 14:55358755-55358777 CTGCACATTAGAATCAACTGTGG + Intronic
1117526196 14:56607818-56607840 CTGCACATTAAAATCACCTGGGG - Intronic
1117789112 14:59319855-59319877 ATGGATATGAAAATCACCTGAGG - Intronic
1118132582 14:62983684-62983706 CTATATATTAGAATCATCTGGGG + Intronic
1119804266 14:77472499-77472521 CCTGATATTAGAATCACCTGGGG - Intergenic
1119910304 14:78343951-78343973 CTGCACATTAGAATCATCTGAGG + Intronic
1120245044 14:81996332-81996354 CTGGATATTAACATCAGTGTTGG + Intergenic
1122046253 14:99026084-99026106 CTGCATATTAGAATCATCTGGGG - Intergenic
1124378946 15:29148414-29148436 CTGGATACTAAAATCGGTGGAGG + Intronic
1124684774 15:31772638-31772660 CTGCACATTGAAATCAGCTGGGG - Intronic
1124819270 15:33028088-33028110 CTACATATTACAATCACCTGGGG + Intronic
1125500702 15:40238974-40238996 CTGAATTTACAAATCAGCTGGGG - Intronic
1125882359 15:43205755-43205777 CTGCACATTAGAATCACCTGGGG - Intronic
1125901422 15:43351522-43351544 CTGGATATTAAAATTACCTAAGG - Intronic
1126130401 15:45335436-45335458 CTGTATATTAAAATCATTTGAGG - Intergenic
1126507919 15:49429637-49429659 CTAAATATTACAATCAGCTGGGG + Intronic
1126580707 15:50240158-50240180 CTGCACATTAGAATCATCTGGGG + Intergenic
1126634715 15:50769128-50769150 CTGCATATTAGAATCATCTGGGG - Intergenic
1126927779 15:53609790-53609812 CTGTATATGTAAATCATCTGTGG - Intronic
1127055589 15:55127766-55127788 CTGGACATTGGAATTAGCTGTGG + Intergenic
1127268176 15:57377445-57377467 CTGCACATTAGAATCACCTGCGG - Intronic
1127313358 15:57771581-57771603 CTGCACATTAGAATCATCTGAGG + Intronic
1127710252 15:61590079-61590101 CTGCATATTGGAATCAGCTGAGG + Intergenic
1127825586 15:62699883-62699905 CTGGCCATTAGAATCACCTGGGG - Intronic
1128229295 15:66023812-66023834 CAGGGGATTAAAACCAGCTGGGG + Intronic
1128229756 15:66026133-66026155 CTGCACATTAGAATCACCTGGGG - Intronic
1128303326 15:66581076-66581098 CTGTAAATTAACATCACCTGGGG + Intergenic
1128933001 15:71722195-71722217 TTGCATATCAAAAACAGCTGCGG - Intronic
1129145469 15:73642901-73642923 CTGCATATTGGAATCACCTGGGG - Intergenic
1129664200 15:77570328-77570350 CTGTATATTAATATGATCTGTGG - Intergenic
1130003829 15:80074215-80074237 CTGGATATTAAAATCAGCTGAGG + Intronic
1130327487 15:82892653-82892675 GGGAGTATTAAAATCAGCTGAGG + Intronic
1130574527 15:85080109-85080131 ATTGATATTAATATCAGATGAGG + Intronic
1130764145 15:86852849-86852871 TTGCATATTAGAATCAACTGGGG + Intronic
1131032084 15:89194937-89194959 CTGCATATTAGAATCAGTTGTGG - Intronic
1131359308 15:91775530-91775552 CTGAATATTTAAATCCTCTGGGG + Intergenic
1131391133 15:92049721-92049743 CTAGATATTAACAGCAGCAGTGG + Intronic
1131769429 15:95718846-95718868 CTACATATTAAAAACACCTGGGG + Intergenic
1132270915 15:100524097-100524119 CTGAAAATTAAAATCAACTAGGG - Intronic
1133323206 16:4927450-4927472 CTGTACATTAGAATCACCTGAGG - Intronic
1134226220 16:12392730-12392752 GTGGTTTTTAAAAACAGCTGAGG - Intronic
1134328569 16:13229516-13229538 CTGCATATTAGAATCACCTGAGG + Intronic
1135139855 16:19912086-19912108 TTGCACATTAAAATCATCTGGGG + Intergenic
1135151353 16:20009275-20009297 CTGCACATTATAATCACCTGAGG - Intergenic
1135310698 16:21402716-21402738 CTTGATATTATCATCTGCTGAGG + Exonic
1135310719 16:21402842-21402864 CTTGATATTATCATCTGCTGAGG + Exonic
1135310741 16:21402968-21402990 CTTGATATTATCATCTGCTGAGG + Exonic
1135310763 16:21403094-21403116 CTTGATATTATCATCTGCTGAGG + Intronic
1135310785 16:21403220-21403242 CTTGATATTATCATCTGCTGAGG + Intronic
1135310810 16:21403359-21403381 CTTGATATTATCATCTGCTGAGG + Intronic
1135310831 16:21403485-21403507 CTTGATATTATCATCTGCTGAGG + Intronic
1135310852 16:21403611-21403633 CTTGATATTATCATCTGCTGAGG + Intronic
1135310874 16:21403737-21403759 CTTGATATTATCATCTGCTGAGG + Intronic
1135310895 16:21403863-21403885 CTTGATATTATCATCTGCTGAGG + Intronic
1135310912 16:21403989-21404011 CTTGATATTATCATCTGCTGAGG + Intronic
1135310929 16:21404093-21404115 CTTGATATTATCATCTGCTGAGG + Intronic
1135310992 16:21404459-21404481 CTTGATATTATCATCTGCTGAGG + Intronic
1135311015 16:21404583-21404605 CTTGATATTATCATCTGCTGAGG + Intronic
1135311037 16:21404709-21404731 CTTGATATTATCATCTGCTGAGG + Exonic
1135351505 16:21733338-21733360 CTGCACATTAGAATCACCTGGGG + Intronic
1135363646 16:21835150-21835172 CTTGATATTATCATCTGCTGAGG + Exonic
1135363668 16:21835276-21835298 CTTGATATTATCATCTGCTGAGG + Exonic
1135363690 16:21835402-21835424 CTTGATATTATCATCTGCTGAGG + Exonic
1135363712 16:21835528-21835550 CTTGATATTATCATCTGCTGAGG + Intronic
1135363734 16:21835654-21835676 CTTGATATTATCATCTGCTGAGG + Exonic
1135363756 16:21835780-21835802 CTTGATATTATCATCTGCTGAGG + Exonic
1135363781 16:21835919-21835941 CTTGATATTATCATCTGCTGAGG + Intronic
1135363801 16:21836045-21836067 CTTGATATTATCATCTGCTGAGG + Exonic
1135363823 16:21836171-21836193 CTTGATATTATCATCTGCTGAGG + Exonic
1135363845 16:21836297-21836319 CTTGATATTATCATCTGCTGAGG + Exonic
1135363862 16:21836423-21836445 CTTGATATTATCATCTGCTGAGG + Exonic
1135363901 16:21836656-21836678 CTTGATATTATCATCTGCTGAGG + Exonic
1135363923 16:21836782-21836804 CTTGATATTATCATCTGCTGAGG + Exonic
1135363945 16:21836908-21836930 CTTGATATTATCATCTGCTGAGG + Exonic
1135363966 16:21837034-21837056 CTTGATATTATCATCTGCTGAGG + Exonic
1135363988 16:21837160-21837182 CTTGATATTATCATCTGCTGAGG + Exonic
1135380647 16:21993564-21993586 CTGCAAATTAGAATCACCTGAGG + Intronic
1135447853 16:22534188-22534210 CTTGATATTATCATCTGCTGAGG - Exonic
1135447875 16:22534314-22534336 CTTGATATTATCATCTGCTGAGG - Exonic
1135447896 16:22534440-22534462 CTTGATATTATCATCTGCTGAGG - Exonic
1135447914 16:22534554-22534576 CTTGATATTATCATCTGCTGAGG - Exonic
1135447936 16:22534680-22534702 CTTGATATTATCATCTGCTGAGG - Exonic
1135447953 16:22534784-22534806 CTTGATATTATCATCTGCTGAGG - Exonic
1135447970 16:22534910-22534932 CTTGATATTATCATCTGCTGAGG - Exonic
1135447992 16:22535036-22535058 CTTGATATTATCATCTGCTGAGG - Exonic
1135448013 16:22535162-22535184 CTTGATATTATCATCTGCTGAGG - Exonic
1135448035 16:22535288-22535310 CTTGATATTATCATCTGCTGAGG - Exonic
1135448056 16:22535414-22535436 CTTGATATTATCATCTGCTGAGG - Exonic
1135448077 16:22535540-22535562 CTTGATATTATCATCTGCTGAGG - Exonic
1135448102 16:22535679-22535701 CTTGATATTATCATCTGCTGAGG - Exonic
1135448124 16:22535805-22535827 CTTGATATTATCATCTGCTGAGG - Exonic
1135448146 16:22535931-22535953 CTTGATATTATCATCTGCTGAGG - Exonic
1135449987 16:22549466-22549488 CTGCACATTAGAATCACCTGGGG + Intergenic
1135478467 16:22799627-22799649 CTGCACATTAGAATCACCTGGGG - Intergenic
1135814876 16:25623318-25623340 CTGCATATTAGAACAAGCTGGGG + Intergenic
1135885876 16:26307216-26307238 GTGAATATTAAAATTACCTGGGG + Intergenic
1136257546 16:29052256-29052278 CTTGATATTATCATCCGCTGAGG - Exonic
1136307423 16:29381791-29381813 CTTGATATTATCATCTGCTGAGG + Exonic
1136307444 16:29381917-29381939 CTTGATATTATCATCTGCTGAGG + Exonic
1136307466 16:29382043-29382065 CTTGATATTATCATCTGCTGAGG + Exonic
1136307488 16:29382169-29382191 CTTGATATTATCATCTGCTGAGG + Exonic
1136307511 16:29382308-29382330 CTTGATATTATCATCTGCTGAGG + Exonic
1136307533 16:29382434-29382456 CTTGATATTATCATCTGCTGAGG + Exonic
1136307555 16:29382560-29382582 CTTGATATTATCATCTGCTGAGG + Exonic
1136307577 16:29382686-29382708 CTTGATATTATCATCTGCTGAGG + Exonic
1136307599 16:29382812-29382834 CTTGATATTATCATCTGCTGAGG + Exonic
1136307621 16:29382938-29382960 CTTGATATTATCATCTGCTGAGG + Exonic
1136307639 16:29383064-29383086 CTTGATATTATCATCTGCTGAGG + Exonic
1136307657 16:29383189-29383211 CTTGATATTATCATCTGCTGAGG + Exonic
1136307678 16:29383315-29383337 CTTGATATTATCATCTGCTGAGG + Exonic
1136307699 16:29383441-29383463 CTTGATATTATCATCTGCTGAGG + Exonic
1136307720 16:29383567-29383589 CTTGATATTATCATCTGCTGAGG + Exonic
1136307741 16:29383693-29383715 CTTGATATTATCATCTGCTGAGG + Exonic
1136307761 16:29383819-29383841 CTTGATATTATCATCTGCTGAGG + Exonic
1136320968 16:29484121-29484143 CTTGATATTATCATCTGCTGAGG + Intronic
1136320989 16:29484247-29484269 CTTGATATTATCATCTGCTGAGG + Intronic
1136321011 16:29484373-29484395 CTTGATATTATCATCTGCTGAGG + Intronic
1136321036 16:29484512-29484534 CTTGATATTATCATCTGCTGAGG + Intronic
1136321058 16:29484638-29484660 CTTGATATTATCATCTGCTGAGG + Intronic
1136321080 16:29484764-29484786 CTTGATATTATCATCTGCTGAGG + Exonic
1136321102 16:29484890-29484912 CTTGATATTATCATCTGCTGAGG + Exonic
1136321134 16:29485123-29485145 CTTGATATTATCATCTGCTGAGG + Exonic
1136321156 16:29485249-29485271 CTTGATATTATCATCTGCTGAGG + Exonic
1136435541 16:30223461-30223483 CTTGATATTATCATCTGCTGAGG + Exonic
1136435562 16:30223587-30223609 CTTGATATTATCATCTGCTGAGG + Exonic
1136435584 16:30223713-30223735 CTTGATATTATCATCTGCTGAGG + Exonic
1136435606 16:30223839-30223861 CTTGATATTATCATCTGCTGAGG + Exonic
1136435628 16:30223965-30223987 CTTGATATTATCATCTGCTGAGG + Exonic
1136435648 16:30224091-30224113 CTTGATATTATCATCTGCTGAGG + Exonic
1136435673 16:30224230-30224252 CTTGATATTATCATCTGCTGAGG + Exonic
1136435695 16:30224356-30224378 CTTGATATTATCATCTGCTGAGG + Exonic
1136435717 16:30224482-30224504 CTTGATATTATCATCTGCTGAGG + Exonic
1136435749 16:30224715-30224737 CTTGATATTATCATCTGCTGAGG + Exonic
1136435771 16:30224841-30224863 CTTGATATTATCATCTGCTGAGG + Exonic
1136435793 16:30224967-30224989 CTTGATATTATCATCTGCTGAGG + Exonic
1136435815 16:30225093-30225115 CTTGATATTATCATCTGCTGAGG + Exonic
1136435837 16:30225219-30225241 CTTGATATTATCATCTGCTGAGG + Exonic
1139195407 16:64912805-64912827 CTGCACATTAAAATCACTTGGGG + Intergenic
1139321185 16:66115665-66115687 CTGCATATTAGAATCACCTGGGG + Intergenic
1139873237 16:70124490-70124512 CTGCACATTAGAATCAGCTGGGG + Intronic
1140001629 16:71030789-71030811 CTAAATATTTAAATAAGCTGTGG - Intronic
1140362544 16:74356815-74356837 CTGCACATTAGAATCAGCTGGGG - Intergenic
1143360130 17:6362748-6362770 CTGCATATTAGAATCATCTGAGG - Intergenic
1143855871 17:9848462-9848484 CTGCATATTAGAATCATCTGGGG - Intronic
1144406935 17:14960971-14960993 CTGCATATTAGAATCCACTGGGG - Intergenic
1145741027 17:27274726-27274748 CAGGGAACTAAAATCAGCTGAGG + Intergenic
1145845042 17:28031195-28031217 CTGCATATTAGAATCTACTGGGG + Intergenic
1146773937 17:35595573-35595595 CTGCACATTAAAATAATCTGGGG - Intronic
1146780627 17:35668355-35668377 CTGTACATTAGAATCAACTGGGG + Intronic
1147344377 17:39779023-39779045 CTGCATTTTAAAATCATCTGGGG - Intronic
1149040381 17:52181594-52181616 TTGGACATTTAAGTCAGCTGCGG - Intergenic
1149174426 17:53853006-53853028 TTGGAAATTAAGATCAGCTGAGG + Intergenic
1149355917 17:55839423-55839445 CTGAATGTTAAAATCACCTGGGG + Intronic
1149555437 17:57570300-57570322 CTGCATATCATAATCACCTGGGG - Intronic
1149851076 17:60034508-60034530 CTGCTCATTAAAATCACCTGGGG - Intergenic
1149859090 17:60112006-60112028 CTGCTCATTAAAATCACCTGGGG + Intergenic
1150313869 17:64152370-64152392 CTGCATGTTAAAATCACCTGGGG - Intronic
1150446381 17:65229935-65229957 CTGGACATTAGAATCCACTGGGG + Intergenic
1150496030 17:65608408-65608430 CTGCACATCAAAATCACCTGAGG - Intronic
1151185548 17:72361472-72361494 CTGAAAACTAAAATCAGCTCAGG + Intergenic
1153021174 18:630407-630429 CTCTATTTTAAAATCAGTTGAGG - Intronic
1153167497 18:2279461-2279483 CTGGAGATTAAATCCATCTGTGG - Intergenic
1153602181 18:6791644-6791666 CTGGAAATTCAAGTCATCTGCGG - Intronic
1153700746 18:7691549-7691571 CTGCATATTAAAATCAGTGATGG + Intronic
1153772923 18:8429617-8429639 CTGCACATTCAAATCACCTGGGG - Intergenic
1153982392 18:10321525-10321547 GTGGATATAAAAATAATCTGGGG - Intergenic
1154959681 18:21295862-21295884 CTGCACATGAAAATCACCTGCGG + Intronic
1155063597 18:22250086-22250108 ATGGATATGAAAAATAGCTGAGG - Intergenic
1155566031 18:27135609-27135631 CTGAATATTAAAATCACCTGGGG + Intronic
1157348250 18:46860255-46860277 CTGCATATTAGCATCAGCTGGGG - Intronic
1157649005 18:49308479-49308501 CTGGACTTTAAAATCATGTGTGG - Intronic
1158170728 18:54596394-54596416 CTGCATATTAGAATCACCTGGGG + Intronic
1158251992 18:55499545-55499567 CTGTACATTAGAATCAACTGGGG + Intronic
1158578661 18:58662188-58662210 CTGCATATTAGAATCATTTGGGG - Intergenic
1158614772 18:58976814-58976836 CTACATATAAAAATCAACTGAGG - Intronic
1159605270 18:70468375-70468397 CTGTACATTACAATCACCTGGGG - Intergenic
1160125802 18:76170261-76170283 CTGCTTATTAGAATCACCTGAGG + Intergenic
1160300459 18:77673258-77673280 CTGGATTTTAGCATCTGCTGTGG - Intergenic
1162318184 19:9953947-9953969 CTAAATATGTAAATCAGCTGGGG + Intergenic
1162932963 19:13966347-13966369 CTGGCCATCAAAATCACCTGCGG + Intronic
1162952202 19:14078148-14078170 CTGAATATTAAACTCAACTGAGG + Intergenic
1164136917 19:22424604-22424626 CTGCATGTAAAAATCACCTGGGG + Intronic
1164898343 19:31896933-31896955 CTGGGTATCAGAATCACCTGTGG + Intergenic
1166414591 19:42585084-42585106 CTGGAGTTTGAAACCAGCTGGGG + Intronic
925890978 2:8434280-8434302 CTGGACAGTAAAGTCACCTGGGG - Intergenic
926168633 2:10536762-10536784 CTGCATATTCAACTCACCTGGGG - Intergenic
926667175 2:15538554-15538576 CTGTATCTTAGAATCACCTGGGG - Intronic
927128981 2:20040837-20040859 CTGTATATAAAAATTAGCAGGGG + Intronic
928469246 2:31557290-31557312 CTGCACATTAAAATCATCTGGGG - Intronic
928613787 2:33016559-33016581 CTGTACATTAGAATCACCTGGGG - Intronic
928675456 2:33646700-33646722 CAGGATTTTAAAATTATCTGGGG + Intergenic
929114574 2:38433526-38433548 CTGCATATTACAATCACATGGGG - Intergenic
929290358 2:40183756-40183778 CTGCATATTAGAATCACCTGTGG + Intronic
930174279 2:48285603-48285625 CTGGACATTACAATCTCCTGGGG - Intergenic
930608892 2:53519932-53519954 CTGCATGTTAGAATCACCTGGGG - Intergenic
930672014 2:54161220-54161242 CTGCATATCAGAATCACCTGGGG + Intronic
930693742 2:54390504-54390526 CTGTGTATTCAAATCACCTGGGG - Intergenic
931070546 2:58643707-58643729 CTGCATGTTGAAATCAGCTGGGG - Intergenic
931070856 2:58647936-58647958 CTGCACATTAGAATCACCTGGGG + Intergenic
931190978 2:59999948-59999970 CTGAAACTTAAAATCATCTGGGG + Intergenic
931580631 2:63768593-63768615 CTGTACATTAAAAGCACCTGGGG - Intronic
931956758 2:67435758-67435780 ATGGCTATTAAAATCACCTGGGG - Intergenic
932001207 2:67886789-67886811 CTGCACATTAGAATCACCTGGGG + Intergenic
932118670 2:69077992-69078014 CTCAACATTAAAATCACCTGGGG - Intronic
932946897 2:76245167-76245189 CTTGATACTAAAAACAGATGAGG - Intergenic
933333681 2:80926685-80926707 CTGCATATTATTATCACCTGGGG - Intergenic
933681968 2:85109941-85109963 CTGGATATAAAAATCAACATGGG - Intergenic
934090354 2:88545628-88545650 CTGTACATTAGAATCACCTGTGG + Intergenic
935006520 2:99084191-99084213 CTGCATATTAGAATCAAATGAGG - Intronic
935419394 2:102851690-102851712 CTGCAAATTAAAATCACCTGGGG - Intergenic
936616980 2:114057786-114057808 CTGCATATTAGAATCACCTGGGG + Intergenic
936930818 2:117786953-117786975 CTGAACATTATAATCAACTGGGG + Intergenic
937078260 2:119122922-119122944 CTGCATCTTACAATCACCTGGGG + Intergenic
937137843 2:119570549-119570571 ATGGAAAGTAAAATCAGCTTTGG - Intronic
937475234 2:122209212-122209234 CAGGATATTCAAAACAGCAGAGG + Intergenic
937527989 2:122794795-122794817 ATGGTTACTAAAATCAGTTGAGG + Intergenic
938592668 2:132754461-132754483 TTGGATATTAAAATGAGGTATGG - Intronic
938621211 2:133055729-133055751 CTGGCTATTATAATGAGATGTGG - Intronic
938684335 2:133722502-133722524 CAGCATATTAAAATCATGTGGGG - Intergenic
938756280 2:134382331-134382353 TTGCATATTATAATCACCTGGGG - Intronic
938961968 2:136352217-136352239 CTGCACATTAGAATCACCTGGGG + Intergenic
938970427 2:136426171-136426193 CTGCATATTAGAATCACTTGGGG + Intergenic
939042389 2:137206568-137206590 TTGCATATTAGAATCACCTGGGG - Intronic
939095348 2:137827512-137827534 CTGCATATTGAGATCAACTGGGG + Intergenic
939234234 2:139470413-139470435 CTGCACATTAGAATCAGTTGGGG - Intergenic
939562631 2:143750784-143750806 CTGCATATTAATATCATCTGTGG - Intronic
939614562 2:144348035-144348057 CTGCACATTAGAATCACCTGGGG + Intergenic
940316576 2:152334014-152334036 CTGCATATCAAAATCACCTGGGG + Intergenic
940407338 2:153320126-153320148 CTGCACATTGAAATCACCTGTGG - Intergenic
941323501 2:164084687-164084709 CTGCACATTACAATCACCTGGGG - Intergenic
941658779 2:168172906-168172928 CTGCATATTGAAATCACCTGGGG + Intronic
941673935 2:168324137-168324159 CTGGATTTAAAAGGCAGCTGAGG - Intergenic
942068793 2:172296599-172296621 ATGTATATAAAAATCACCTGGGG - Intergenic
942574716 2:177351189-177351211 CTGTATAACAAGATCAGCTGGGG + Intronic
942667487 2:178335606-178335628 TTGGATATTAAAGTCAACTATGG + Intronic
942804059 2:179909094-179909116 CTGTACATTAACATCACCTGGGG + Intergenic
943035050 2:182733399-182733421 CTACACATTAAAATCACCTGAGG + Intronic
943041775 2:182812786-182812808 CTGTATATTAGAATCACCGGAGG + Intergenic
943114900 2:183656380-183656402 ATGGATTGTAAAATAAGCTGGGG - Intergenic
943686840 2:190827433-190827455 CTGCATGTTAGAATCACCTGTGG + Intergenic
944285042 2:197939813-197939835 CTGCATATTAGAATCACTTGGGG - Intronic
944869448 2:203895069-203895091 CTGCACATTAGAATCAACTGGGG - Intergenic
944887339 2:204076903-204076925 CTGCATGTTGAAATCACCTGGGG + Intergenic
944928751 2:204494032-204494054 CTGGGAATAAAAATCAGATGTGG - Intergenic
945056905 2:205877308-205877330 CTGCATGTTAGAATCAGCTGGGG - Intergenic
945286606 2:208088772-208088794 CTGCACATTAGAATCAGCTGAGG + Intergenic
945448270 2:209964065-209964087 ATGCCTATCAAAATCAGCTGAGG + Intronic
945594329 2:211773122-211773144 CTGGGTCTTAAAAGCAGTTGAGG + Intronic
945705254 2:213222380-213222402 CTGAATTTTAAAATTAGGTGAGG - Intergenic
945783989 2:214211214-214211236 CTGCATATTAGAATCACCAGGGG + Intronic
945843160 2:214912525-214912547 CTGCATATTGAAATTACCTGGGG - Intergenic
946465677 2:219909917-219909939 CTGCACATTAACATCTGCTGTGG - Intergenic
946774265 2:223121186-223121208 CTGTACATTAAAATCACTTGGGG + Intronic
946827556 2:223694604-223694626 CTGCATATTAAAATCACCTTGGG + Intergenic
1169051692 20:2583987-2584009 CTGCATAATAGAATCACCTGGGG - Intronic
1169053220 20:2597925-2597947 CTGCATACTAGAATCACCTGAGG + Intronic
1169182307 20:3580357-3580379 CTGGGTATTCTAATCTGCTGTGG + Intronic
1169480371 20:5974671-5974693 CTGCATATTAGAATCATCTGTGG - Intronic
1169776855 20:9264731-9264753 CTGCATATTGGAATCACCTGGGG + Intronic
1170866706 20:20164174-20164196 CTGAATACAAAAAGCAGCTGAGG - Exonic
1170962465 20:21037582-21037604 CTGCACATTAGAATCACCTGGGG - Intergenic
1171306888 20:24114304-24114326 GTGCATATTGGAATCAGCTGTGG - Intergenic
1172583951 20:36069442-36069464 CTGGCTATTAAGACTAGCTGTGG + Intergenic
1172943234 20:38668863-38668885 CTGCATGTTAGAATCAGCTGAGG - Intergenic
1173258944 20:41416038-41416060 CTGCACATTGGAATCAGCTGGGG - Intronic
1173330214 20:42069836-42069858 CTGGAAATTAACATAAACTGAGG - Intergenic
1173340221 20:42146580-42146602 CTGCATAGTAGCATCAGCTGGGG - Intronic
1173438737 20:43056491-43056513 CTAGATCTTCAAATCACCTGAGG + Intronic
1173969544 20:47141339-47141361 CTGCATATTGAAATCACCTGGGG + Intronic
1174002096 20:47382291-47382313 CTACACATTAGAATCAGCTGGGG - Intergenic
1174283719 20:49457407-49457429 CTGCACATGAGAATCAGCTGAGG - Intronic
1174606539 20:51766176-51766198 CTGCATGTTAAAATCATCAGGGG + Intronic
1174718542 20:52786099-52786121 ATGGAGATTAAAATCTACTGTGG + Intergenic
1175210272 20:57349825-57349847 CTGCATCTTAGAATCACCTGGGG + Intergenic
1176864839 21:14041675-14041697 CTGGTTATTTAAATGAGATGGGG + Intergenic
1176908599 21:14535159-14535181 CCTAATATTAAAATCATCTGGGG - Intronic
1176920337 21:14680175-14680197 CTGCACATTAGAATCACCTGGGG + Intergenic
1177805936 21:25874828-25874850 CTGTGTATTAGAATCATCTGGGG + Intergenic
1177861974 21:26464795-26464817 CTGGAAATCAGAATCACCTGTGG + Intergenic
1178713509 21:34942242-34942264 CTGCAATTTAAAATAAGCTGTGG - Intronic
1181977169 22:26738235-26738257 CTGCACATTAAAATTACCTGAGG - Intergenic
1182717416 22:32368845-32368867 CTGGACTTTAAAATGGGCTGAGG - Intronic
1183023698 22:35047999-35048021 CTGGATCTTAGAATATGCTGGGG - Intergenic
949256846 3:2058588-2058610 CTGGATATTGAAATCACATAGGG + Intergenic
949311894 3:2709318-2709340 CTGCATATTAGAATCATCTGGGG + Intronic
949329853 3:2909516-2909538 CTGCAGATTACAATCATCTGGGG + Intronic
949744207 3:7269511-7269533 CTGCATATTAGAATCACCAGGGG - Intronic
949882358 3:8671894-8671916 CTGGATATTACAATCCACGGTGG + Intronic
950057702 3:10040479-10040501 CTGCACATTAAAATCATTTGTGG + Intronic
950357895 3:12427040-12427062 CTACATATTAAAATTATCTGGGG - Intronic
950406177 3:12806522-12806544 CTGCATGTTAGAATCACCTGGGG + Intronic
951225518 3:20116549-20116571 CTGCATATTAAAATTACCTGGGG - Intronic
951613470 3:24518614-24518636 ATGGACATTAAAATCAGCCAAGG - Intergenic
952051060 3:29385230-29385252 CTGGGCATTAAAAACAACTGTGG - Intronic
952091522 3:29892520-29892542 CTGGAGAGCAAAATCACCTGTGG + Intronic
952180762 3:30914138-30914160 CTGCACATTCAAATCACCTGGGG - Intergenic
952284278 3:31953232-31953254 CTGCATATTAAAAGTATCTGAGG - Intronic
953494063 3:43371522-43371544 CTGCATGTTAGAATCAGTTGGGG - Intronic
953584036 3:44183962-44183984 CTACATATTAGAATCAGCTAAGG + Intergenic
953600571 3:44359743-44359765 ATGGAGATTAAAATCAGCAAAGG - Intronic
954180210 3:48875708-48875730 CTGGATTTTAAACTCAGCATTGG - Intronic
955016647 3:55076989-55077011 CTTCATATTAACATCACCTGGGG - Intergenic
955639734 3:61069319-61069341 CTGCATATTGAAATCATCTTAGG + Intronic
956060244 3:65341559-65341581 CTGCAGATTAGAATCACCTGGGG + Intergenic
956060274 3:65341965-65341987 CTGCATATTAGAATCACATGGGG - Intergenic
956061016 3:65348379-65348401 CTCTCTATTAAAATCACCTGGGG + Intergenic
956105728 3:65816151-65816173 CTCTACATTAAAATCACCTGGGG - Intronic
956180968 3:66518095-66518117 CTGCATATTAAAATCACCTGGGG - Intergenic
956938991 3:74135674-74135696 TTGCATATTAGAATCACCTGGGG + Intergenic
957065428 3:75518159-75518181 CTGCACATCAGAATCAGCTGGGG + Intergenic
958593920 3:96197798-96197820 CTGGACACCAAAATCAGTTGTGG - Intergenic
958665004 3:97126237-97126259 CTGGCCATTAGAATCAGGTGGGG - Intronic
959535717 3:107482835-107482857 CTGAATATCAGAATCATCTGGGG + Intergenic
959942014 3:112090204-112090226 CTGCCCATTAGAATCAGCTGAGG - Intronic
960594556 3:119396320-119396342 CTGCATATCAGAATCACCTGGGG - Intronic
960938228 3:122916373-122916395 CTGCACATTAGAATCACCTGAGG + Intronic
961011784 3:123441151-123441173 CTGGTCATCAAAATCACCTGGGG + Intronic
962423724 3:135250576-135250598 CTGCACATTAGAATCACCTGAGG - Intronic
962487837 3:135862370-135862392 CTGCATGTTAGAATCATCTGGGG - Intergenic
962873199 3:139516066-139516088 TTGCATATTAAAATCACCTGGGG + Intergenic
962942614 3:140139476-140139498 CTGCATATTGGAATCATCTGAGG + Intronic
963126060 3:141817895-141817917 CTGCACATTAGAATCACCTGGGG - Exonic
963751789 3:149187534-149187556 CTGCACATTAGAATCAACTGGGG - Intronic
963767275 3:149350595-149350617 CTACACATTAAAATCACCTGGGG - Intergenic
963966340 3:151375102-151375124 GTGCATATTGGAATCAGCTGGGG + Intronic
964182839 3:153908437-153908459 ATGGGTATGAAAATCAGTTGTGG + Intergenic
964317483 3:155459627-155459649 CTGGAAAATATAAACAGCTGGGG - Intronic
964363479 3:155923741-155923763 CTGTATGTTAGAATCATCTGGGG + Intronic
965346810 3:167561332-167561354 CTGTACATTAAAACCACCTGGGG + Intronic
965376232 3:167927707-167927729 CTTCATATTAGAATCATCTGAGG + Intergenic
965508091 3:169538089-169538111 CTGCACATTAGAATCAACTGGGG - Intronic
965642879 3:170849407-170849429 CTGCACGTTAAAGTCAGCTGGGG - Intronic
965969383 3:174534907-174534929 CTGCACATTAGAATCATCTGAGG + Intronic
966572580 3:181461952-181461974 TTGCACATTAAAATCATCTGGGG - Intergenic
966705530 3:182909761-182909783 CAGCATTTTAAAAGCAGCTGAGG + Intronic
966937783 3:184725158-184725180 CTGTACATTAGAATCACCTGGGG + Intergenic
967112923 3:186311083-186311105 CTGCATGTTGAAATCACCTGGGG + Intronic
967254178 3:187572948-187572970 CTGAACATTAGAATCAGCTGCGG - Intergenic
967613568 3:191537603-191537625 CTGCACATTAGAATCATCTGGGG - Intergenic
967706673 3:192659396-192659418 CTGTATATACACATCAGCTGGGG - Intronic
967743431 3:193028406-193028428 CTGCACATTAGAGTCAGCTGGGG + Intergenic
969235436 4:5862197-5862219 TTGGTTATTAAAAGCAGCGGTGG - Intronic
969318817 4:6397889-6397911 CTGTATCTTTATATCAGCTGGGG - Intronic
970330696 4:14980910-14980932 ATGGATATTAGAATCACCTGGGG + Intergenic
970365251 4:15351668-15351690 CTGCATATTAGAATCACCTGAGG - Intronic
970393373 4:15639695-15639717 CTGTATATTACAATGAGTTGGGG + Intronic
971175156 4:24275408-24275430 TAGGATATTAAATTCAACTGGGG - Intergenic
971975103 4:33674049-33674071 CTGAATATTAGAATCAAATGGGG - Intergenic
972133824 4:35866274-35866296 CTGGTTGTTAAAATGAGCTAGGG + Intergenic
972917772 4:43902397-43902419 CTCCATATGAAAATCAGATGGGG + Intergenic
973198430 4:47472614-47472636 CTGGAAATTAGAATCCACTGAGG + Intergenic
973249234 4:48044412-48044434 TTGCATATTCAAATCATCTGGGG - Intergenic
973305608 4:48645677-48645699 CTGCATATTAGAATCAGCCTGGG - Intronic
973952384 4:56029472-56029494 CTGGAGATTACAAGGAGCTGTGG + Intronic
974385813 4:61201197-61201219 CTGGATATAAAGATCGGCTGGGG + Intergenic
974606090 4:64152780-64152802 CTGTACATTAGAATCATCTGTGG - Intergenic
974869638 4:67624351-67624373 GTGGATAGTAAAAGCAGCTATGG + Intronic
974937698 4:68427995-68428017 CTGCACATTGAAATCATCTGGGG + Intergenic
975440909 4:74409396-74409418 CTGCATATTGGAATCATCTGTGG - Intergenic
975558979 4:75691891-75691913 CTGCATATTAGAATCACCTGAGG - Intronic
976160816 4:82196902-82196924 CTGAATATTAAATTCATCTGGGG + Intergenic
977513016 4:97985365-97985387 ATGCATATTAAAAACATCTGAGG - Intronic
977639715 4:99343254-99343276 CTGCATATTAGATTCATCTGGGG + Intronic
978107018 4:104915743-104915765 CTGCATTTCAAAATCACCTGAGG - Intergenic
979466017 4:121039513-121039535 CTGTATATTAGAATCACCTGGGG + Intronic
979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG + Intronic
979746975 4:124228191-124228213 CTGGATATTAAAGCCAGATAGGG + Intergenic
980785391 4:137547632-137547654 CTGTAGATTATAATCACCTGGGG - Intergenic
981227653 4:142315512-142315534 CTGTACATTAGAATCACCTGGGG + Intronic
981544675 4:145881942-145881964 CTGCACATTAAAATCATTTGAGG + Intronic
981703901 4:147639556-147639578 CTGCAAATTAAAATCACCTGGGG + Intronic
981733013 4:147919969-147919991 CTACATATTAGAATCATCTGCGG - Intronic
981818534 4:148859354-148859376 CTGTATATAAAAATCAGCAATGG + Intergenic
982105077 4:152004633-152004655 CTGCACATTAGAATCATCTGGGG - Intergenic
982138356 4:152294252-152294274 GTAGAGATTAGAATCAGCTGTGG - Intergenic
982676673 4:158383803-158383825 CTGGATATGAAAATTGGCTCAGG - Intronic
983610012 4:169632427-169632449 ATGGCTATTAAAAGAAGCTGGGG + Intronic
983737182 4:171076132-171076154 CTGCACATTAGAATCACCTGGGG + Intergenic
984083150 4:175274936-175274958 TTGCATATTAAAATCACCTGGGG - Intergenic
984485038 4:180357430-180357452 CTGTAGATAAAATTCAGCTGAGG + Intergenic
984989890 4:185369838-185369860 CTGCATGTTAAAATCACCCGAGG - Intronic
985878222 5:2617284-2617306 CTGGATAATAAAATTAGTTTTGG - Intergenic
987230579 5:15889704-15889726 CTGCATGTTGAAATCACCTGAGG - Intronic
989204964 5:38801125-38801147 CTGTATATTAAAATTACCTGGGG - Intergenic
989545472 5:42667489-42667511 CTGCACATTAGAATCACCTGGGG + Intronic
990086667 5:51987141-51987163 CTGCACATTAGAATCACCTGGGG - Intergenic
990371826 5:55127502-55127524 CTGTGTATTAGGATCAGCTGGGG + Intronic
990728720 5:58785325-58785347 CTGCACATTATAATTAGCTGGGG - Intronic
990739288 5:58895835-58895857 CAGGATATTAAGAGCAGCTTGGG - Intergenic
990850194 5:60194483-60194505 CTGCATATCAAAATTAGCTAGGG + Intronic
990897854 5:60718038-60718060 CTGCACATTACAATCACCTGGGG + Intergenic
991140338 5:63233216-63233238 CTGCAAATTAAAATTTGCTGAGG - Intergenic
991165272 5:63560058-63560080 CTGCATTTTGAAATCACCTGGGG + Intergenic
991435212 5:66591064-66591086 CTGCACATTAGAATCACCTGTGG - Intergenic
991978069 5:72202587-72202609 CTGCATATTAGAATCGCCTGGGG + Intronic
992405216 5:76450737-76450759 TAGGATATGAAAATCAGCTCAGG - Intronic
992667019 5:79020290-79020312 CTGGACATTAGAATCATCTGGGG - Intronic
992680014 5:79144104-79144126 CTAAATATTAGAATCACCTGGGG + Intronic
993531740 5:89033826-89033848 CAGCATTTTAAAATCAGATGAGG + Intergenic
993692852 5:91024089-91024111 CCGCACATTAGAATCAGCTGGGG - Intronic
993698874 5:91094760-91094782 AGGGATACTAAATTCAGCTGTGG + Intronic
993731957 5:91432918-91432940 ATGCATATTAAAATCACCTGGGG - Intergenic
993873397 5:93277741-93277763 ATGCTTATTAAAATCAGGTGTGG + Intergenic
994172202 5:96669865-96669887 CTGTATATTGGAATCATCTGGGG + Intronic
994188965 5:96846353-96846375 CTGCACATTAGAATCAACTGGGG + Intronic
994515619 5:100769272-100769294 CTGAACATTAAAAACAACTGAGG + Intergenic
994647298 5:102485721-102485743 ATACAGATTAAAATCAGCTGAGG - Intronic
995308217 5:110680089-110680111 TTGCATATTAAACTCACCTGGGG - Intronic
995785266 5:115820954-115820976 CTGGATCTTAAAATAAGATTGGG - Intergenic
996464276 5:123781632-123781654 CTGGATGTTAGATTCACCTGGGG + Intergenic
997848668 5:137311384-137311406 CCGCATATTAAAACCACCTGGGG + Intronic
998518944 5:142782503-142782525 CTGCACATTAGAATCACCTGGGG - Intronic
999376912 5:151093198-151093220 CTGCACATTTAAATCACCTGGGG + Intronic
999585023 5:153080590-153080612 CTGGATATTACTACCAACTGGGG + Intergenic
999830037 5:155309951-155309973 GTGAACATTAAAATCACCTGGGG - Intergenic
1000145457 5:158449221-158449243 CTGCATATTAAAATCACTTGAGG + Intergenic
1000245221 5:159443398-159443420 CTGCACATTGAAATCAGCTGGGG - Intergenic
1000421947 5:161047912-161047934 CTTCACATAAAAATCAGCTGGGG - Intergenic
1001089074 5:168723749-168723771 CTGCACATTAGAATCACCTGGGG + Intronic
1001156090 5:169273490-169273512 CTGCAAATTAGAATCACCTGAGG + Intronic
1001156106 5:169273604-169273626 CTGCACATTGAAATCACCTGGGG - Intronic
1001157190 5:169282981-169283003 CTGCATATTGCAATCATCTGGGG - Intronic
1001740379 5:174048240-174048262 CTGCATATTAGAATCACCTGGGG + Intronic
1002036633 5:176475818-176475840 CTGTACATTAGAATCAGCTGAGG + Intronic
1002965424 6:1961354-1961376 CTGTACATAAAAATCAACTGGGG - Intronic
1002995103 6:2275383-2275405 CTGCATATTAGAAGCATCTGGGG - Intergenic
1003316324 6:5015456-5015478 CTGCACATTAAAATCACCTGGGG + Intergenic
1003600803 6:7515362-7515384 CTGCACATTAAAATCACTTGGGG - Intergenic
1003850360 6:10215943-10215965 CTGCACATTAGAATCACCTGTGG - Intergenic
1004077431 6:12357362-12357384 CTGCATATTAAAAACACCTGTGG - Intergenic
1004455718 6:15789758-15789780 ATGCACATTAAAATCATCTGGGG + Intergenic
1004602903 6:17167635-17167657 TTGCATATTAGAATCATCTGGGG + Intergenic
1004699150 6:18062629-18062651 CTGGAGATTAAAATCACCCTCGG - Intergenic
1004705967 6:18124034-18124056 CTGTACATTATAATCACCTGGGG - Intergenic
1004793922 6:19060113-19060135 CTGCATATTAGAGTCACCTGGGG + Intergenic
1004989996 6:21126117-21126139 CAGGAAATTAAAATCATGTGTGG + Intronic
1005357340 6:24997212-24997234 CTGTATATTAGAATCACCTGGGG - Intronic
1005440197 6:25859380-25859402 CTGAATCTTGAAATCAGCTATGG + Intronic
1005517576 6:26569476-26569498 GTCGATATTAGAATCACCTGGGG + Intergenic
1005911725 6:30316136-30316158 CTGCACATTAGAATTAGCTGGGG - Intergenic
1006647124 6:35522511-35522533 CTGGACATTGAATTCACCTGGGG - Intergenic
1007012051 6:38427154-38427176 CTGAATATTAAAATCATCTGAGG + Intronic
1007422896 6:41730198-41730220 CTGGGTATTATGATCACCTGCGG - Intronic
1007687945 6:43678342-43678364 CTGCACATTAGAATCACCTGGGG - Intronic
1007926696 6:45655470-45655492 CTGCACATTAAAATCACCTGGGG - Intronic
1007990053 6:46245693-46245715 CTGCATATTAGAATCAGTGGGGG + Intronic
1008125052 6:47658691-47658713 CTGTATATGAATATCATCTGTGG + Intronic
1008172723 6:48229345-48229367 CTATATATTAAAATCACCTAGGG - Intergenic
1008559557 6:52710517-52710539 CTGCCTATTAGAATCATCTGAGG + Intergenic
1008874463 6:56310442-56310464 TTGGATATTAGCATCATCTGGGG - Intronic
1010070563 6:71739309-71739331 CTACACATTAAAATCACCTGGGG - Intergenic
1010169433 6:72957574-72957596 CTGCATATTAGAATCATCAGGGG - Intronic
1010187567 6:73160894-73160916 CTGCACATTAAAATCATTTGGGG - Intronic
1010532314 6:76983579-76983601 CTGCATATTAAAACCACTTGTGG - Intergenic
1010877641 6:81127615-81127637 CTGCATATTAAAATCACCTACGG + Intergenic
1011013307 6:82726434-82726456 CTGTATATTAGAATCACCTGGGG - Intergenic
1011177788 6:84584729-84584751 CTGGTTGTTAAAAAGAGCTGGGG - Intergenic
1011195019 6:84772465-84772487 CTGGATTTTAATTTCAGCTTTGG - Intergenic
1011777813 6:90751510-90751532 CTGCCCATTAAAATCACCTGAGG - Intergenic
1012506762 6:99955669-99955691 CTGCATATTAGAATCATCTGGGG - Intronic
1012775442 6:103489576-103489598 CTGGATATTAAAAACAGTATCGG - Intergenic
1012784671 6:103608390-103608412 CTGCACATTAGAATCATCTGGGG - Intergenic
1013024447 6:106256448-106256470 CTATATATTAGAATCATCTGGGG - Intronic
1013165262 6:107584274-107584296 CTGCATATTAGAATCATCTGGGG - Intronic
1013731989 6:113178894-113178916 CTGGATATAAAATTCAGAAGAGG - Intergenic
1014088845 6:117379626-117379648 CTGCATATTACAATGATCTGTGG + Intronic
1014112763 6:117638141-117638163 CTGCACATTAAATTCATCTGGGG - Intergenic
1015012870 6:128373424-128373446 TTGTATATTAAAATCACCTATGG + Intronic
1015859358 6:137659357-137659379 CTGCAAATTAGAATCACCTGGGG + Intergenic
1016696532 6:147002720-147002742 CTGCACATTAGAATCATCTGGGG + Intergenic
1017504800 6:155058353-155058375 ATGCATGTTAAAATCATCTGGGG - Intronic
1017625366 6:156342054-156342076 CTGCATATTAGAATCATCTGTGG - Intergenic
1017658941 6:156655443-156655465 CTGCGTATTAGAATCACCTGGGG + Intergenic
1017980787 6:159399619-159399641 CTGGATATTAAAGGAAGTTGGGG - Intergenic
1019878791 7:3840425-3840447 CTGTGTATTAAAATCACCTGAGG - Intronic
1020397262 7:7730340-7730362 CTGCATGTTAGAATCACCTGGGG - Intronic
1021216469 7:17921801-17921823 CTGCATATTGCAATCATCTGGGG - Intronic
1021221998 7:17985323-17985345 CTGCATATTAAAATCATTTGGGG + Intergenic
1021227241 7:18042553-18042575 CTGTGTGTTAAAATCACCTGAGG + Intergenic
1021799312 7:24287937-24287959 CTGCACATTAGAATCACCTGGGG - Intronic
1022285289 7:28950955-28950977 TTGCATATTAAGACCAGCTGTGG - Intergenic
1022319834 7:29278173-29278195 CTGCACATTGAAATCAACTGAGG + Intronic
1022978692 7:35581854-35581876 CTGAACATTACAATCACCTGGGG - Intergenic
1023142788 7:37118971-37118993 CTGGATTTAAAATTCAGCTCTGG + Intronic
1023476012 7:40578578-40578600 CTGATTATTAGCATCAGCTGGGG + Intronic
1024894813 7:54245779-54245801 CTGCAAATTATAATCACCTGGGG + Intergenic
1024938775 7:54740538-54740560 CTGCACATTAGAATCACCTGGGG + Intergenic
1025103860 7:56155023-56155045 CTGGACATTAGAATCATCTTGGG + Intergenic
1025717771 7:63978435-63978457 TTGGATACTAAAATCAGATATGG - Intergenic
1026173500 7:67975066-67975088 TTGCATATTAGAATCATCTGGGG - Intergenic
1026316895 7:69234946-69234968 CTGGACATTAGAATCATCTTGGG - Intergenic
1026323585 7:69288391-69288413 TTGCATATTAAAATCACCTAGGG + Intergenic
1026438197 7:70418144-70418166 CTGGAGTTCAAGATCAGCTGGGG - Intronic
1027585872 7:80057978-80058000 CTGCATGTTAAAATCACCTGGGG - Intergenic
1028314736 7:89386211-89386233 ATGGAAATAAAAATCAGCAGAGG - Intergenic
1028359649 7:89952495-89952517 CTGGATATTAGAATCACCTGTGG - Intergenic
1028519581 7:91715413-91715435 CTGCATATTAAAAGCACCTGGGG - Intronic
1030110112 7:106019788-106019810 CTGCATATTAGAATCAGCTAGGG + Intronic
1030318743 7:108142803-108142825 CTGCATATTAGAATCATCTGGGG + Intergenic
1030332192 7:108282978-108283000 CTGCATATTAGAATCATCTAGGG - Intronic
1030369577 7:108683357-108683379 CTGCATATTACAATTATCTGGGG + Intergenic
1030504203 7:110399120-110399142 CTGAATATTAAGATCAGCAGAGG + Intergenic
1030691292 7:112537454-112537476 CTGCATATTAGAGTCATCTGGGG - Intergenic
1031086060 7:117303030-117303052 CTACATATTAAAATCACCTGGGG + Intronic
1031097377 7:117436693-117436715 CTATATATTAAAATCACCAGAGG - Intergenic
1031149367 7:118035393-118035415 CTGCATAATATAATCACCTGGGG - Intergenic
1031771153 7:125846163-125846185 CTGACTATTATAATCAGCTGGGG + Intergenic
1031793122 7:126135345-126135367 CTGTACATTAGAATCACCTGGGG - Intergenic
1032636105 7:133710728-133710750 CTGCATATTAAAAATAGTTGAGG - Intronic
1032723916 7:134573797-134573819 CTGGGCATTAGAATCACCTGAGG + Intronic
1033276675 7:139976738-139976760 CTGCATTTTAGAATCCGCTGGGG - Intronic
1033360622 7:140636592-140636614 CTGTACCTTAAAATCATCTGGGG + Intronic
1034486341 7:151366418-151366440 CTGTACACTAGAATCAGCTGGGG + Intronic
1034552089 7:151827562-151827584 CTGCATGTTAGAATCACCTGAGG - Intronic
1034624804 7:152484443-152484465 CTGCACGTTACAATCAGCTGGGG - Intergenic
1035660222 8:1342108-1342130 CTGTACAGAAAAATCAGCTGGGG - Intergenic
1036463917 8:8978669-8978691 ATGCAAATTTAAATCAGCTGAGG - Intergenic
1036936538 8:13007718-13007740 CAGGATCTTAAAATCAGTGGGGG + Intronic
1038635955 8:29287302-29287324 CTGCACATTAAAATCACCTCGGG - Intergenic
1039254318 8:35702420-35702442 CTGCATATTAGAATCACCTGGGG - Intronic
1040624323 8:49128991-49129013 CTGCTTATTAAAATCTTCTGTGG + Intergenic
1042511605 8:69618063-69618085 CTGCACATTAGAATCATCTGGGG + Intronic
1042714982 8:71762774-71762796 CTATACATTAAAATCACCTGGGG - Intergenic
1043494893 8:80790246-80790268 CTGCACATTAAAATCCCCTGAGG - Intronic
1043586523 8:81776550-81776572 CTGGATATTAAAATCTGTGCTGG - Intergenic
1043637847 8:82409197-82409219 CTGCATATCAAAATCAAATGGGG + Intergenic
1043749537 8:83918203-83918225 CTGTACATTAGAATCAGCCGGGG - Intergenic
1044076643 8:87830728-87830750 CTGCACATCAGAATCAGCTGGGG + Intergenic
1044912964 8:97081453-97081475 CTGTACTTTAAAATCACCTGGGG + Intronic
1045062672 8:98422964-98422986 CTGCATATTCGAATCACCTGGGG - Intronic
1045528146 8:102959160-102959182 TTGGCTATTAGAATCACCTGGGG - Intronic
1045661910 8:104446851-104446873 CTGGATATTAAAATGTGCTCTGG - Intronic
1045875410 8:106975628-106975650 CTGGAACTTACAATCAGGTGAGG - Intergenic
1047500184 8:125434320-125434342 CTGGCTCTTAAAATCAAGTGTGG - Intronic
1047692476 8:127370455-127370477 CTGAATATTAGAGTCACCTGGGG - Intergenic
1047773046 8:128045965-128045987 CTGCATAATAGAATCACCTGGGG - Intergenic
1047900394 8:129415284-129415306 CTGTACATTAGAATCACCTGAGG - Intergenic
1047955975 8:129975910-129975932 CTGCACATGAAAATCACCTGGGG - Intronic
1047985952 8:130233947-130233969 CTGCAAGTTAGAATCAGCTGGGG + Intronic
1048179556 8:132182532-132182554 CACTATTTTAAAATCAGCTGCGG - Intronic
1048507822 8:135036440-135036462 CTGCATATTAAAATCACCCGGGG + Intergenic
1049911716 9:275444-275466 CTGGACATTAAAATTATCTAGGG + Intronic
1049927552 9:424226-424248 CTGCACATTAGAATCACCTGGGG + Intronic
1050072047 9:1825350-1825372 CTGCATATTAGAATCACCTGGGG - Intergenic
1051173213 9:14340490-14340512 CTGCACATTAGAATCATCTGGGG - Intronic
1051221370 9:14851731-14851753 CTGCATATTGGAATCACCTGGGG + Intronic
1051250477 9:15153755-15153777 CTGGAGATTAAACTCAGGTTGGG - Intergenic
1051734088 9:20180263-20180285 CTTGCTATTATGATCAGCTGAGG + Intergenic
1051750258 9:20334102-20334124 CTGCATATTAGAATAATCTGGGG + Intergenic
1051766401 9:20529076-20529098 CTGAACATTAAAATCATCTTGGG + Intronic
1052342363 9:27376646-27376668 CTGTACATTAGAATCATCTGAGG - Intronic
1052959396 9:34281890-34281912 CTGCATGTTAGAATCACCTGGGG + Intronic
1053475634 9:38380272-38380294 CTACATATTAGAATCATCTGGGG - Intergenic
1053546153 9:39025101-39025123 CTGGATGTTAAAATCACCCAGGG - Intergenic
1054767433 9:69053977-69053999 CTGCATATTGGAATCATCTGTGG - Intronic
1054931767 9:70642516-70642538 CTGCACATTAGAATCACCTGGGG + Intronic
1055148089 9:72960407-72960429 CTACACATTAAAATCACCTGGGG + Intronic
1055275394 9:74610298-74610320 CTGCATGTTAAAATCACTTGGGG - Intronic
1055335973 9:75233907-75233929 CTGTATATTAGAATCAGCTGAGG - Intergenic
1055816954 9:80218066-80218088 CTGGACATTGGAATCATCTGGGG + Intergenic
1056320153 9:85428206-85428228 CAGGAGATTAAAATCAGGGGAGG - Intergenic
1056905559 9:90644685-90644707 CTGCACATTAGAATCAGCAGGGG + Intergenic
1058109710 9:101018725-101018747 CTGGATATTGACAGCAGCAGTGG + Intergenic
1058767089 9:108192136-108192158 CTGGGTACTAAAAGCACCTGGGG - Intergenic
1058910674 9:109517516-109517538 ATGTGAATTAAAATCAGCTGGGG + Intergenic
1059024168 9:110606354-110606376 CTGCATATTAGAATCACCTGAGG - Intergenic
1059082180 9:111261771-111261793 CTGGCCATTAGAATCACCTGGGG - Intergenic
1059492904 9:114683853-114683875 CTGCGAATTAAAATCAACTGGGG - Intergenic
1059864875 9:118503345-118503367 CTGTGTATTAGAATCACCTGGGG - Intergenic
1059933449 9:119284051-119284073 ATGTATATTTGAATCAGCTGAGG - Intronic
1060452066 9:123752041-123752063 ATGGATATCAAAATCAGAGGTGG + Intronic
1062688042 9:137826437-137826459 CTGGAGGCTAAAGTCAGCTGGGG - Intronic
1186230382 X:7447264-7447286 CTGCATGTTAAAATCACATGGGG - Intergenic
1186883298 X:13887844-13887866 CTGTACATTGGAATCAGCTGAGG - Intronic
1186970183 X:14833641-14833663 CTGTACATTAGAATCACCTGGGG + Intergenic
1187233483 X:17444559-17444581 CTGTATATTAGAATCACCTAAGG - Intronic
1187407769 X:19019394-19019416 CTGCACATTAGAATCACCTGGGG - Intronic
1187439077 X:19301435-19301457 CTGAACATTAAAATCACCTGGGG + Intergenic
1187464166 X:19514252-19514274 CTACATATTAGAATCACCTGGGG - Intronic
1187598726 X:20802896-20802918 TTGGATATTAAGACCAGCTCTGG + Intergenic
1187774110 X:22735796-22735818 ATGGATATTAAAAACAACAGTGG - Intergenic
1187809777 X:23162827-23162849 ATGGACATTAGAATCAACTGGGG + Intergenic
1188024696 X:25195903-25195925 CTGCACATCAAAATCAGCTGAGG - Intergenic
1188054028 X:25521179-25521201 CTGCACATTAAAATCACCTGGGG + Intergenic
1188074798 X:25761809-25761831 CTGCAAATTACAATCACCTGAGG - Intergenic
1188086837 X:25909269-25909291 CTGCATATTAGAATCACCTGTGG + Intergenic
1188103726 X:26123139-26123161 TTGGATTTTTGAATCAGCTGAGG - Intergenic
1188160968 X:26802022-26802044 CTGCACATTGAAATCACCTGGGG + Intergenic
1188248349 X:27860508-27860530 ATGGCCATTAAAACCAGCTGAGG + Intergenic
1188387394 X:29577917-29577939 CTGTACATTAGAATCACCTGGGG + Intronic
1188749069 X:33883792-33883814 CTGCATATTAGAATAACCTGGGG - Intergenic
1189350425 X:40271648-40271670 CTGCATATTGACACCAGCTGGGG + Intergenic
1189534097 X:41918956-41918978 CTGCATATTAGAATCATCCGGGG - Intronic
1189841612 X:45084976-45084998 CTGTATATTAGAATCCTCTGGGG - Intronic
1189948063 X:46200549-46200571 ATGGATGTTAAAATCAGTGGGGG + Intergenic
1190148282 X:47918736-47918758 CAATATATTAAAATGAGCTGGGG + Exonic
1190468452 X:50750721-50750743 ATAGGTCTTAAAATCAGCTGAGG - Intronic
1190845856 X:54189973-54189995 CTGTATATTAGAATCACCTTGGG - Intergenic
1190915646 X:54809399-54809421 CTGGAGAGGAAAAGCAGCTGGGG - Intronic
1191677780 X:63809782-63809804 CTGTACATGAGAATCAGCTGGGG + Intergenic
1191735326 X:64382920-64382942 CTGCATACTAGAATCACCTGGGG - Intronic
1192150237 X:68707600-68707622 CTGCACATTAAAATCTCCTGGGG - Intronic
1192158798 X:68767515-68767537 CTGCATATTAGAATTACCTGTGG - Intergenic
1192547489 X:72026203-72026225 CTGCACATTAATATCACCTGGGG + Intergenic
1193027443 X:76859501-76859523 CTCCTTATTAAAATCTGCTGTGG - Intergenic
1193966912 X:87998868-87998890 TTGATTATTAAAATCTGCTGAGG - Intergenic
1194017710 X:88645378-88645400 CTGCATATTATAATTACCTGGGG + Intergenic
1194371652 X:93080603-93080625 CTGCAGATTATAATCAACTGGGG + Intergenic
1194421738 X:93683331-93683353 CTGTTTATTAAAATAAGCTCTGG - Intronic
1194887152 X:99330694-99330716 CTGGACATTAAAAGCAAGTGGGG + Intergenic
1194946541 X:100074920-100074942 CTGCACATTAAAATCACCTAGGG - Intergenic
1195037356 X:100982106-100982128 CTATATATTTCAATCAGCTGGGG + Intronic
1195591012 X:106627116-106627138 CTGTATATTGAAATCACTTGGGG + Intronic
1195595235 X:106681477-106681499 TTGCACATTAAAATCACCTGGGG - Intergenic
1195623260 X:106980568-106980590 CTGCTCATTAGAATCAGCTGAGG + Intronic
1195697257 X:107676433-107676455 CTGCAAATTATAATCACCTGGGG - Intergenic
1195965623 X:110427650-110427672 CTGTATATTAGAAGCACCTGGGG - Intronic
1196035234 X:111136741-111136763 CTGGATAATAAAAAGATCTGGGG + Intronic
1196070455 X:111515551-111515573 CTGCATATCAAAATCACCTGTGG + Intergenic
1196198977 X:112864118-112864140 CTGCACATTAAAATCAACTGGGG + Intergenic
1196787120 X:119430615-119430637 CTGCACATCAGAATCAGCTGGGG + Intronic
1197114915 X:122820009-122820031 CTGGATATTAAATTCTGGTTTGG - Intergenic
1197257765 X:124282429-124282451 CTGCACGTTAAAATCACCTGGGG - Intronic
1197331379 X:125157174-125157196 CTGCATATTAAGATCAGCTAGGG - Intergenic
1197587563 X:128367891-128367913 CTGCACATGAAAATCAGCTGAGG - Intergenic
1197676016 X:129331051-129331073 CTGCACATTAGAATCAGCTGGGG - Intergenic
1197978062 X:132186386-132186408 CTGCACATTAAAATCATCTGGGG - Intergenic
1198110490 X:133498566-133498588 CTGTATATTAGAATCACCTGGGG + Intergenic
1198110511 X:133498684-133498706 CTGCACATTAGAATCACCTGGGG - Intergenic
1198786621 X:140295848-140295870 CTGAATACTAGAATCAGCTTGGG - Intergenic
1198921986 X:141739295-141739317 CTATATATTAAAATCATTTGTGG - Intergenic
1199151802 X:144495958-144495980 CTGTATATTAGAATCACCTGGGG + Intergenic
1199819984 X:151435131-151435153 CTGCATATTACAATCGTCTGGGG - Intergenic
1199872252 X:151910134-151910156 CTGGATTCAAAAATCAGATGAGG + Intergenic
1199951691 X:152712374-152712396 CTGGATTTAAAAACCAGATGAGG + Intergenic
1199957992 X:152756074-152756096 CTGGATTTAAAAACCAGATGAGG - Intergenic
1200561955 Y:4715433-4715455 CTGAATATTGAAATCAGCCTGGG + Intergenic
1200679442 Y:6192494-6192516 CTGCAGATTATAATCAACTGGGG + Intergenic