ID: 1130005014

View in Genome Browser
Species Human (GRCh38)
Location 15:80087359-80087381
Sequence GTGGAGTGGTATTCTATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130005011_1130005014 -9 Left 1130005011 15:80087345-80087367 CCATTTTAGTGGATGTGGAGTGG 0: 2
1: 1
2: 25
3: 252
4: 996
Right 1130005014 15:80087359-80087381 GTGGAGTGGTATTCTATTGTGGG 0: 1
1: 0
2: 3
3: 22
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130005014 Original CRISPR GTGGAGTGGTATTCTATTGT GGG Intronic
901623385 1:10607243-10607265 GGTGGGTGGTATTCCATTGTAGG + Intronic
902609912 1:17591013-17591035 GTGGGGTGGTATTCTTTGGTTGG - Intronic
905747553 1:40431830-40431852 GCTGTGTAGTATTCTATTGTAGG - Intergenic
906003882 1:42452131-42452153 GTGAAGTGGTATTCAATAATAGG - Intronic
908678514 1:66632890-66632912 GTTGAGTGGTATTTAAGTGTGGG - Intronic
909447692 1:75766043-75766065 GTGAAGTCTGATTCTATTGTGGG - Intronic
910159983 1:84262521-84262543 GTGGAATTGTAATCTATTCTTGG - Intergenic
912133401 1:106629638-106629660 GTGGTATGGTTGTCTATTGTTGG - Intergenic
914436925 1:147668975-147668997 GTGGAGTGCTTTTGTATCGTTGG - Intronic
916375240 1:164146691-164146713 GTGTGTTGGTATTCTATTGGAGG - Intergenic
916820008 1:168388929-168388951 GGGGACTTGTATTCTAATGTGGG + Intergenic
919998978 1:202780644-202780666 GCTGAGTGGTATTTTATTGTTGG - Intronic
924037478 1:239952436-239952458 GTGGAGTGGTATCTCATTGCTGG - Intergenic
924041309 1:239986376-239986398 GTGGAGTGGTATCTCATTGTTGG + Intergenic
1063855559 10:10248260-10248282 TTGCAGGGGTATTATATTGTTGG - Intergenic
1064389347 10:14928084-14928106 GTGGAGTGGAATTCTATTTCTGG + Exonic
1065410315 10:25419709-25419731 GTGAAGTGGTATCTCATTGTGGG + Intronic
1067820073 10:49520712-49520734 GGGGAGTGGTAGTCTATTCAGGG - Intronic
1069796440 10:71055224-71055246 GTGGAGTGGTATCTTATTGTTGG - Intergenic
1070960510 10:80497141-80497163 GTTGTGTAATATTCTATTGTGGG + Intronic
1072861686 10:99012741-99012763 GTTGAGTGTTATTCTCTTCTTGG - Intronic
1073906674 10:108288844-108288866 GTGAAGTGGTATCTCATTGTGGG + Intergenic
1075004803 10:118822253-118822275 GTTGAGTAGTATTCCATTGTGGG - Intergenic
1080063697 11:27984649-27984671 GTGGAGTGGGATAATATTATGGG - Intergenic
1081489614 11:43557255-43557277 GTGGAGAAGTATTCTGTAGTGGG + Intronic
1082694928 11:56351141-56351163 GCTGAGTAGTATTCTATTTTAGG - Intergenic
1085536631 11:77224464-77224486 CTGGAGAGATATTCTGTTGTTGG + Intronic
1085630705 11:78114076-78114098 ATAGATTGGTATACTATTGTGGG - Intronic
1088502253 11:110494039-110494061 GTGGAATGGTATAATATTCTGGG + Intergenic
1090568775 11:128024911-128024933 GTGGTGTGGTATTTAAGTGTGGG - Intergenic
1092445510 12:8552953-8552975 ATGGAGTTGTATTCTGTTTTTGG - Intergenic
1093044150 12:14422744-14422766 GTTGAATGATATTCTGTTGTAGG + Intronic
1094377714 12:29809035-29809057 GCTGAGTGGTATTGAATTGTAGG - Intergenic
1095602162 12:44026207-44026229 CTGCAGTGGTATTATCTTGTTGG + Intronic
1098386994 12:69930179-69930201 GGGGAGTGGTATTCTGGGGTAGG + Intronic
1098476896 12:70915394-70915416 GTGAGGTGCTATTCTATTGGAGG + Intronic
1099232828 12:80047819-80047841 GCTGAGTGATATTCCATTGTAGG - Intergenic
1099794323 12:87378739-87378761 GTGAAGTGGTATTTCATTGTGGG - Intergenic
1100076262 12:90787905-90787927 GCCGAGTAGTATTCTATTGCAGG - Intergenic
1100642036 12:96491290-96491312 CTGGGGTGGAATTGTATTGTGGG + Intronic
1103033748 12:117639900-117639922 GAAGAGTGCTATTCTACTGTCGG - Intronic
1103079081 12:118009060-118009082 GGGCAGTGGTATTCCATGGTTGG + Intergenic
1103229971 12:119321203-119321225 ACTGAGTGGTATTCTGTTGTAGG + Intergenic
1103335031 12:120182966-120182988 GAGGAGTGGTTTTTTAGTGTAGG - Intronic
1104283557 12:127401320-127401342 GTTGATTGGCATTCCATTGTGGG + Intergenic
1107146034 13:37061137-37061159 ATAAAGTGGTATTTTATTGTGGG + Intergenic
1111764135 13:92505751-92505773 GTTTAGTAGTATTCTATAGTCGG - Intronic
1112585275 13:100713466-100713488 GTGGAATAGTATTCCACTGTAGG + Intergenic
1113157578 13:107341259-107341281 GTGGAGTGGTCTTTCATTTTTGG + Intronic
1115382742 14:32758289-32758311 CTGGATTGGTATTCTGATGTAGG - Intronic
1115686307 14:35799840-35799862 GTGAAGTGGGTTTATATTGTTGG - Intronic
1116684662 14:48022694-48022716 GTGGAGTGGTATTCTGTTCTTGG + Intergenic
1119936533 14:78597262-78597284 GTGGAGGGGTATTTTATTTAGGG - Intronic
1120412478 14:84175138-84175160 GTGGAGTGGTATTGTTATTTGGG - Intergenic
1122908107 14:104811965-104811987 GTGTAGTGGTATCTTGTTGTGGG - Intergenic
1123738914 15:23215473-23215495 ATGCAGTGGTATTTTAATGTTGG + Intergenic
1124290135 15:28444444-28444466 ATGCAGTGGTATTTTAATGTTGG + Intergenic
1124293103 15:28473124-28473146 ATGCAGTGGTATTTTAATGTTGG - Intergenic
1124679201 15:31715190-31715212 GTGCAGTGGGAAGCTATTGTTGG - Intronic
1125375376 15:39023179-39023201 GTGGAGGGGTAATATATTGGTGG + Intergenic
1127027339 15:54821538-54821560 GTGGAGTTGTATTTTGCTGTTGG + Intergenic
1127334119 15:57966880-57966902 GTGGAGTCGCATCCTGTTGTAGG - Intronic
1127750383 15:62034161-62034183 GCTGTATGGTATTCTATTGTGGG - Intronic
1129684732 15:77678860-77678882 ATGTAGTGGTATTGCATTGTGGG + Intronic
1130005014 15:80087359-80087381 GTGGAGTGGTATTCTATTGTGGG + Intronic
1131273814 15:90963756-90963778 GTGAAGTGGTATTTCATTGTGGG + Intergenic
1135167616 16:20154457-20154479 GTGAAGTGGTATCTCATTGTGGG + Intergenic
1139496444 16:67322995-67323017 GTGAAGTAGTATTCTGTTGTGGG - Intronic
1139829745 16:69787706-69787728 GAGGAGTGATCTTCTATTGGTGG - Intronic
1147876568 17:43625608-43625630 GTGAAGTGGTATTTCATTGTGGG - Intergenic
1150589157 17:66546873-66546895 GTGATGTGGTATAATATTGTTGG - Intronic
1151510759 17:74558177-74558199 CTGGAGTGGCATTCTGTGGTAGG + Intergenic
1154142748 18:11839703-11839725 GTGGAATCATATTCCATTGTAGG - Intronic
1156425701 18:37009689-37009711 GTGGAATGTTGTTCTAATGTTGG + Intronic
1156740192 18:40316831-40316853 GATGAGTAGTATTCTATTGTAGG + Intergenic
1159505657 18:69332015-69332037 CTGAAGTAGTATTTTATTGTAGG + Intergenic
1163576844 19:18115836-18115858 GAGGAGTGCAATTGTATTGTAGG - Intronic
927043076 2:19249422-19249444 TTGGGTTGGTAATCTATTGTGGG - Intergenic
928425664 2:31175648-31175670 GTGAAGTGGGATTCTACTGGAGG - Intronic
929095616 2:38260751-38260773 GTGGACACGTATTCTATTCTTGG + Intergenic
931365488 2:61615342-61615364 GGGTAGTGGTATTCCATTGTGGG + Intergenic
931996115 2:67840788-67840810 GTTAAGTGGTATTTTATTTTTGG - Intergenic
934547422 2:95229646-95229668 ATGGTGTGGTATTCCACTGTAGG + Intronic
936252974 2:110882170-110882192 GTGTAGTGGTATCTCATTGTGGG + Intronic
936404722 2:112192608-112192630 CTGCAGTGGTATTTCATTGTTGG - Intergenic
937618989 2:123963986-123964008 GTGAAGTGGTATTCCTTGGTGGG - Intergenic
938926752 2:136050183-136050205 GAGGAGTGGCCTTCTACTGTAGG - Intergenic
940261382 2:151783292-151783314 GCAGAGTAGTATTCCATTGTAGG + Intergenic
943096862 2:183439674-183439696 ATACAGTGGTATTGTATTGTGGG + Intergenic
944165588 2:196716398-196716420 GTTGCTTAGTATTCTATTGTAGG - Intronic
944701578 2:202250751-202250773 GTGGTGTGGTAATCTGTGGTAGG + Intergenic
944806612 2:203287954-203287976 GTGGAGTGTTTTTTTATCGTCGG + Intronic
944917362 2:204374758-204374780 GTAAAGTGCTATTCTACTGTTGG + Intergenic
945141997 2:206696745-206696767 GAGGAGTGGTGGTCTATTCTAGG - Intronic
945461233 2:210111283-210111305 GTTGAGCAGTATTCCATTGTAGG - Intronic
946167350 2:217872837-217872859 GCTGAATGATATTCTATTGTAGG - Intronic
1168915559 20:1482783-1482805 GTTGAATAGTATTCCATTGTGGG + Intronic
1169669849 20:8084909-8084931 GTGTAGTGGTATCTCATTGTAGG + Intergenic
1172087846 20:32402162-32402184 GGTGAGTAGTATTCTATTCTTGG + Intronic
1174943037 20:54953075-54953097 GCTAAATGGTATTCTATTGTAGG - Intergenic
1177360363 21:20061336-20061358 GTGAAGTGGTATCTCATTGTGGG - Intergenic
1178375476 21:32063972-32063994 GTTGAGTGATATTTTATTGTTGG + Intergenic
1178489182 21:33037173-33037195 GTGGAATCATATTCTGTTGTGGG + Intergenic
1179064122 21:38008107-38008129 GTGAAGTGGTATCGCATTGTGGG - Intronic
1179214731 21:39357704-39357726 AAGGAGTGGTAGTCTATTGGCGG + Intergenic
1179473254 21:41626184-41626206 GTGGTGTGGTACTCTGCTGTGGG - Intergenic
1181713849 22:24709594-24709616 GTGGGGTGATATTTCATTGTGGG + Intergenic
1182223258 22:28775280-28775302 GTTGTGTGGAATTCTATCGTAGG + Intronic
1183199019 22:36373208-36373230 GTGGAGTGGTCTTCCAAAGTCGG - Intronic
953572795 3:44085102-44085124 GTGAAGTAGTATTCCATAGTAGG + Intergenic
954770170 3:52960067-52960089 GTGTAGTAGTATTCCATTGAAGG - Intronic
955776607 3:62440506-62440528 GTGGAATGGTATAATATTATGGG - Intronic
956115794 3:65917237-65917259 GTGTAGTGGTATCTCATTGTTGG - Intronic
958845653 3:99261464-99261486 GAGGAGTGGTACTATATTGAGGG + Intergenic
959982580 3:112532718-112532740 GTGTAGTCATATTCTATTGTTGG + Exonic
961846931 3:129773157-129773179 GTTGCATGGTATTCCATTGTGGG - Intronic
962290104 3:134128491-134128513 ATGAAGTGGTATCTTATTGTGGG - Intronic
962784739 3:138757432-138757454 GTGAAGTGGTATCTCATTGTGGG - Intronic
962812103 3:138968226-138968248 GCTGAGTGGTATTCCATTGTTGG + Intergenic
962894637 3:139703105-139703127 GTGAAGTGGTATCTCATTGTAGG - Intergenic
967751304 3:193119269-193119291 GTGGAGAAGAATTCTATTGTGGG - Intergenic
969062241 4:4446595-4446617 GTGGAGTGGTATTTCATTGTGGG - Intronic
971458171 4:26863662-26863684 GTGGTGTGGTATCATATTGTAGG + Intronic
972748233 4:41962273-41962295 GTGGAATGGTCTATTATTGTTGG - Intergenic
972807191 4:42541310-42541332 GTGTACTGGTATTTTATTGTTGG - Intronic
974809309 4:66925273-66925295 GTGTAGTTGACTTCTATTGTAGG - Intergenic
975016389 4:69425822-69425844 GTATGGTGGTATTGTATTGTGGG + Intergenic
975414470 4:74091298-74091320 ATGGATTGGCATTCTATTTTTGG + Intergenic
976136816 4:81946688-81946710 GTGGAGTGTTCTTTTATTTTTGG - Intronic
978896468 4:113894357-113894379 ATGGAGTGTTATTCTATTGAGGG - Intergenic
980809054 4:137852206-137852228 GGGGAGTGATTCTCTATTGTTGG + Intergenic
982434387 4:155367032-155367054 ATGGTGTGATATTTTATTGTGGG - Intronic
988026745 5:25703619-25703641 GTTGAGAAGTATTCTATTTTGGG + Intergenic
991188088 5:63834545-63834567 GTGTAGTGGTATTAGAATGTGGG + Intergenic
992336815 5:75779625-75779647 ATGGATAGCTATTCTATTGTGGG - Intergenic
995551216 5:113283461-113283483 GTGAAGTGGTATCTCATTGTGGG - Intronic
996000022 5:118349532-118349554 GTGTATTGGTATCTTATTGTTGG + Intergenic
996170664 5:120286610-120286632 GTGGAGTGGTATTTTACAGTGGG + Intergenic
996605802 5:125320274-125320296 GTGAAGTGGTATCTTATTGAAGG + Intergenic
997497726 5:134344587-134344609 GTGAAGTGGTATCTCATTGTGGG - Intronic
999782968 5:154865661-154865683 GTGAAGTGGTATCCCAATGTGGG - Intronic
1000754347 5:165138219-165138241 GTGTGGTGGAATTCTCTTGTGGG + Intergenic
1003448586 6:6209273-6209295 GTGAAGTGGTATTTCATGGTGGG - Intronic
1004219318 6:13731963-13731985 GTGGAGTGATATGATATTGACGG + Intergenic
1005139156 6:22607629-22607651 GGGGAGTGGTATAGTATTGGAGG - Intergenic
1005764118 6:28993956-28993978 GTGGATTGTAATTCTATTCTGGG + Intergenic
1009659621 6:66594053-66594075 GCAGAGTGGTTTTCTATTTTAGG + Intergenic
1010635124 6:78249419-78249441 TGGGAGTGATATTCTCTTGTAGG + Intergenic
1010674321 6:78723384-78723406 ATGGAGTGGAACTCAATTGTGGG + Intergenic
1012679913 6:102167249-102167271 GTGGTGTTGTATTTTATTGAAGG - Intergenic
1015458679 6:133462534-133462556 GTAGCTTTGTATTCTATTGTAGG + Intronic
1016697454 6:147014569-147014591 GCTGAGTAGTATTCTACTGTAGG - Intergenic
1018903248 6:168061609-168061631 CTGGAGTGGAATTCTATAGATGG - Intronic
1020045022 7:5034202-5034224 GTGGAGGGGTATTCAAAGGTCGG + Intronic
1020290425 7:6718572-6718594 GTGGAGGGGTATTCGATGGTCGG + Intergenic
1020923735 7:14297485-14297507 GTGGAGTTGAATTTTATTGAAGG - Intronic
1021752233 7:23813896-23813918 GTGGTGTGGTTTTCCTTTGTTGG + Intronic
1022025793 7:26446502-26446524 GCTGAGTAATATTCTATTGTAGG + Intergenic
1023240299 7:38138491-38138513 GCTGAGTGGTATTCCACTGTAGG - Intergenic
1024940831 7:54761325-54761347 ATGGAGTACTATTCTGTTGTGGG - Intergenic
1026747486 7:73024466-73024488 GTGGAGGGGTATTCGAAGGTCGG + Intergenic
1026751136 7:73052605-73052627 GTGGAGGGGTATTCGAAGGTCGG + Intergenic
1026754785 7:73080719-73080741 GTGGAGGGGTATTCGAAGGTCGG + Intergenic
1026758437 7:73108753-73108775 GTGGAGGGGTATTCGAAGGTCGG + Intergenic
1027033692 7:74909758-74909780 GTGGAGGGGTATTCGAAGGTCGG + Intergenic
1027088968 7:75284732-75284754 GTGGAGGGGTATTCGAAGGTCGG - Intergenic
1027092611 7:75312660-75312682 GTGGAGGGGTATTCGAAGGTCGG - Intergenic
1027096254 7:75340627-75340649 GTGGAGGGGTATTCGAAGGTCGG - Intergenic
1027323088 7:77027065-77027087 GTGGAGGGGTATTCGAAGGTCGG + Intergenic
1027522314 7:79224611-79224633 GCTGAGTGGTATTCCATTGATGG - Intronic
1029397259 7:100316897-100316919 GTGGAGGGGTATTCGAAGGTCGG - Intronic
1034659247 7:152755058-152755080 GTGGAGTAGGATGCCATTGTTGG + Intergenic
1034763957 7:153699989-153700011 GTGAAGCAGTATTCTACTGTGGG + Intergenic
1035089110 7:156290637-156290659 GCTGAGTGGTATTCCATTGCAGG + Intergenic
1035418883 7:158710765-158710787 GCTGAGTCATATTCTATTGTGGG - Intergenic
1035797791 8:2375516-2375538 GTGGAGTGGTGTTCGATTCAAGG + Intergenic
1036165243 8:6426536-6426558 GCTGAGTAGTATTCTATTGTAGG + Intronic
1036447400 8:8833836-8833858 GTTGAGTAGTATTCCATTTTAGG - Intronic
1036980492 8:13464665-13464687 GTGGAGGGTTATTCCATTGAGGG - Intronic
1038037916 8:23702236-23702258 GTGGAGGGGTCTTCTTTTGGGGG + Intergenic
1038108755 8:24469004-24469026 GGGGAGGGGTGTTCTATTTTGGG - Intronic
1038989600 8:32853573-32853595 GTTGGGGGGAATTCTATTGTTGG + Intergenic
1039007519 8:33056534-33056556 GTTGAGTAGTATTCCATGGTGGG - Intergenic
1039084529 8:33766775-33766797 GTGAAGTGATATTATATTGTAGG - Intergenic
1039649989 8:39330865-39330887 GTGAAGTGGTATCATCTTGTAGG + Intergenic
1040358088 8:46638874-46638896 GTGGAATGGTGTCATATTGTTGG + Intergenic
1041058776 8:54015967-54015989 GTAAAGTGGTATTTCATTGTGGG - Intronic
1041911326 8:63091736-63091758 GTGAGATGGTATTTTATTGTGGG - Intergenic
1043968993 8:86509394-86509416 CTCGAGTGGAATTCTTTTGTGGG + Intronic
1044046745 8:87444877-87444899 GTGGGGTGGTAATCTATATTTGG + Intronic
1046138254 8:110059531-110059553 GTGTATTGGTTTCCTATTGTTGG + Intergenic
1047737403 8:127777972-127777994 GTCCAGTGGTTCTCTATTGTAGG - Intergenic
1048232590 8:132658706-132658728 TTGAAGAGGTATTTTATTGTGGG - Intronic
1049677235 8:143896074-143896096 GCTGAGTAATATTCTATTGTAGG + Intergenic
1050404841 9:5296953-5296975 GTGGTGTTGAATTCTATTGAAGG - Intergenic
1051906477 9:22100852-22100874 GTGAAGTGGTACTTCATTGTGGG + Intergenic
1052065472 9:24013472-24013494 GAGTAGTAGTATTCTATTATAGG + Intergenic
1052502947 9:29316425-29316447 GTGTACAGGTATTCTATTTTTGG + Intergenic
1053220968 9:36312803-36312825 GTGCAGTGGTATCTCATTGTAGG - Intergenic
1056910926 9:90699911-90699933 GTTTACTGGTATTTTATTGTCGG - Intergenic
1057468943 9:95340617-95340639 GTGAAGTGGTATCTTACTGTGGG - Intergenic
1061025458 9:128045864-128045886 GTGAAGTGGTATCTCATTGTGGG - Intergenic
1188062747 X:25620752-25620774 GCTGAGTAGTATTCCATTGTAGG + Intergenic
1188083208 X:25871082-25871104 GTGTGGTGGTATTTGATTGTGGG + Intergenic
1189317478 X:40066169-40066191 CTGGGGTGGTATTCCATGGTGGG - Intronic
1189550086 X:42083917-42083939 GCTGAGTGATATTCTATTGAAGG + Intergenic
1189802119 X:44700977-44700999 GTGTAGTGGCATTTCATTGTGGG + Intergenic
1190621132 X:52287991-52288013 GTGGAGAGGAGTTCTATAGTGGG - Intergenic
1191820918 X:65306816-65306838 GCTGAGTGGTATTCTACTGAAGG - Intergenic
1191859081 X:65651257-65651279 GTGGTGTGGTCTTGTATTTTTGG - Intronic
1192248867 X:69394709-69394731 GTGGAGTGGGATGCTATTTAAGG - Intergenic
1193622546 X:83773653-83773675 GTGAAGTAGTATTGTATTCTTGG - Intergenic
1194433074 X:93836052-93836074 GCTGAGTAGTATTCTATTATGGG + Intergenic
1196002313 X:110798769-110798791 GCTGAGTGGTATTCCATGGTAGG + Intergenic
1197485600 X:127046382-127046404 GTGTAGTGGTATCTCATTGTTGG + Intergenic
1201736740 Y:17271319-17271341 TTGGTGTTGTATTCCATTGTTGG + Intergenic
1202063593 Y:20913979-20914001 ATGGATTGGTATTCTACTTTTGG + Intergenic