ID: 1130006885

View in Genome Browser
Species Human (GRCh38)
Location 15:80108097-80108119
Sequence GATTGGTATTTATAAGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130006880_1130006885 10 Left 1130006880 15:80108064-80108086 CCTACTTAATAGGACTATTATGA 0: 1
1: 0
2: 7
3: 96
4: 527
Right 1130006885 15:80108097-80108119 GATTGGTATTTATAAGTGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130006885 Original CRISPR GATTGGTATTTATAAGTGCT TGG Intronic
901765707 1:11498739-11498761 GCCTGGTAGGTATAAGTGCTTGG - Intronic
907423422 1:54362877-54362899 GACAGGCATTTATAAGAGCTGGG + Intronic
908368444 1:63453238-63453260 CATCGGTATTTAAAAGTGGTAGG + Intronic
909691039 1:78408458-78408480 TATTGGTATTGATACGTGTTTGG + Intronic
910060281 1:83083150-83083172 GCATGGTCTTTATTAGTGCTTGG + Intergenic
910528434 1:88208197-88208219 CATTGGCATTTATGAGTACTTGG - Intergenic
911272044 1:95813830-95813852 TATTTGTATTTTTAAATGCTGGG + Intergenic
918577041 1:186073889-186073911 TATTGGTAATTATAAGGTCTAGG + Intronic
919095163 1:193025352-193025374 GGTTGGTATTTAAAAAGGCTGGG + Intronic
923393634 1:233538457-233538479 GAATGGTATTTTGAAGTGATAGG + Intergenic
924656993 1:245981577-245981599 CATTTGTATTTATAAATGTTTGG - Intronic
1064529600 10:16294540-16294562 GATTTGTCTTTTTAAGTGTTTGG + Intergenic
1065416105 10:25488124-25488146 TAATGGTATTTCAAAGTGCTAGG + Intronic
1066222517 10:33349275-33349297 GGTTGGAATTTAGAAGAGCTGGG + Intergenic
1072224207 10:93352940-93352962 TATTGGTAAATATTAGTGCTTGG + Intronic
1073879413 10:107962655-107962677 GAATGGTATTTATAAGAGGCTGG + Intergenic
1074925139 10:118061098-118061120 GCTTAGCATTTCTAAGTGCTGGG - Intergenic
1075601086 10:123769865-123769887 GCCTGGCATTTATCAGTGCTGGG + Intronic
1082209510 11:49481260-49481282 GATTGGTAATTATTAGTGACTGG - Intergenic
1082212835 11:49526283-49526305 GAATGTTATTTATAAGAGCTGGG - Intergenic
1083518919 11:63288403-63288425 GAATGGTGTTTACAAGGGCTGGG + Intronic
1084594423 11:70108584-70108606 CATTTGTGTTTAAAAGTGCTGGG - Intronic
1085958734 11:81434042-81434064 AATGGGTAATTAAAAGTGCTTGG - Intergenic
1086039483 11:82458563-82458585 GATAGGTAATAATAATTGCTAGG + Intergenic
1086603759 11:88668519-88668541 CATTGATATTTATAAGAGTTTGG - Intronic
1086636761 11:89098226-89098248 GAATGTTATTTATAAGAGCTGGG + Intergenic
1087819671 11:102697752-102697774 GCTTGGTCTTTCGAAGTGCTGGG + Intronic
1087841262 11:102923157-102923179 GTTAGGTATTTTTGAGTGCTGGG - Intergenic
1094782838 12:33812796-33812818 GATTTTTATTTTTAAGTTCTGGG + Intergenic
1095399276 12:41795936-41795958 GGCTGGTATTGATAAGTGTTTGG - Intergenic
1097307215 12:58082800-58082822 CCTTGCTAATTATAAGTGCTTGG + Intergenic
1105728056 13:23185491-23185513 AATTGGAATTTAAAAGTGATCGG - Intronic
1106699127 13:32210219-32210241 AGTTGGTATTTAAAAGTGATAGG + Intronic
1107011301 13:35673684-35673706 TATTGGTTTTTCAAAGTGCTGGG - Intergenic
1111452830 13:88441334-88441356 GATCCTTATTTATAAGTGGTTGG - Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1120354730 14:83416751-83416773 GAATGGTCTTTACAAGAGCTGGG - Intergenic
1130006885 15:80108097-80108119 GATTGGTATTTATAAGTGCTTGG + Intronic
1131523711 15:93136279-93136301 GCTTGGTATTTATGAGTGTAAGG - Intergenic
1137646926 16:50083538-50083560 GTTTGGTGTTTCTAAGTGCCTGG + Intronic
1138426556 16:56937560-56937582 GATTGTTATTTATTAGGCCTGGG - Intronic
1151098205 17:71523552-71523574 GTTTTGTCTTTTTAAGTGCTTGG - Intergenic
1153163404 18:2235093-2235115 GATTGGAATTTGTATTTGCTTGG - Intergenic
1156662833 18:39367453-39367475 GAATGGTGTTTACAAGTGTTAGG - Intergenic
1159513837 18:69432190-69432212 CATTGGTCTTTTAAAGTGCTGGG - Intronic
1164844434 19:31419895-31419917 GATTGGGAGTTAAAAGTGCTGGG - Intergenic
928234583 2:29528672-29528694 CATTGGCACTAATAAGTGCTAGG - Intronic
928724157 2:34151472-34151494 GATTGGGTTTTTTAAGTTCTGGG - Intergenic
930386659 2:50704759-50704781 CATTGGTATTTATTTGTGCCAGG - Intronic
931240871 2:60451392-60451414 GTTTGGTATTTTTTACTGCTTGG - Intronic
931834193 2:66081859-66081881 GTTTGGTATTTATATGTTTTTGG + Intergenic
935033815 2:99348377-99348399 GATTTGTGGTTATAAGTGGTGGG + Intronic
942964877 2:181879953-181879975 GAGTGGTATTTCTGAATGCTTGG + Intergenic
943135824 2:183911515-183911537 GTTAGCTATTTATGAGTGCTAGG + Intergenic
944544436 2:200784996-200785018 GACTGTGAATTATAAGTGCTTGG + Intergenic
945960260 2:216126277-216126299 GATTGTTAATCATAAGTTCTAGG + Intronic
1174527474 20:51185169-51185191 GAAGGGTATTTTGAAGTGCTTGG + Intergenic
1177049584 21:16215554-16215576 GATTGCTACTTTTAAGTGTTAGG + Intergenic
1183261116 22:36796641-36796663 GAGTGGTTTTAATAAGAGCTGGG - Intergenic
949178357 3:1094967-1094989 GATTGTTATTTACAGGTGATGGG - Intronic
949761838 3:7479359-7479381 TATTGTTAGGTATAAGTGCTGGG - Intronic
951017941 3:17749708-17749730 GAATGATATATATATGTGCTGGG - Intronic
951975303 3:28500485-28500507 TATTGGCATTAATAAGTGTTAGG - Intronic
953111353 3:39942824-39942846 GATTGGTAATTACCAGAGCTGGG - Intronic
958431023 3:94041464-94041486 GATAAGTCTTTATATGTGCTTGG + Intronic
959861267 3:111217500-111217522 GATTTATATTTTTAAATGCTTGG - Intronic
960067515 3:113389920-113389942 GATTGGTATTCTTAAATGTTTGG - Intronic
960213273 3:114997720-114997742 GATTAGTCTTTTTAAGTGGTAGG + Intronic
960998843 3:123358783-123358805 GATTGGGTTTCAGAAGTGCTGGG - Intronic
962879385 3:139561850-139561872 GATTGTTATATAAAAGTGCCAGG - Intronic
963258252 3:143168156-143168178 TATAGGTATATATAAGTTCTAGG - Intergenic
963506165 3:146187473-146187495 GATTGGTACTGATAAATTCTTGG + Intergenic
967525387 3:190486790-190486812 GATTTGAATTTACAAATGCTGGG - Intergenic
970582065 4:17482634-17482656 GATTTGGATTTACAAGTGGTTGG - Intronic
971250979 4:24973214-24973236 GCTTGGTTTTTATATGTGTTAGG - Intronic
971459351 4:26878157-26878179 GATTCTTTTTTATATGTGCTAGG + Intronic
973740506 4:53915332-53915354 CATTGGTATTAAAAAGAGCTTGG + Intronic
975058708 4:69969878-69969900 GATTGCTATTCATAAGTGTTTGG + Intergenic
975105164 4:70559714-70559736 GATTGGTATGTATTTATGCTGGG + Intergenic
976281639 4:83332671-83332693 GATTGGAATTTCTACGTGTTAGG + Intronic
976899179 4:90152846-90152868 GATTTGTATTTGTCAGTGCTAGG + Intronic
981561936 4:146057603-146057625 CATTGGTAATGATAAGTTCTAGG - Intergenic
986901117 5:12434825-12434847 AAATGTTATTTATAATTGCTAGG + Intergenic
987793369 5:22596606-22596628 GACTGGTATTTAAAAGTCCAGGG + Intronic
988443312 5:31256963-31256985 TAGTGGTATTTAGAAGAGCTGGG - Intronic
989483143 5:41956133-41956155 GATTGGTTTTTATTATTGATAGG - Intergenic
993354662 5:86891165-86891187 GATTGGTAGGTTTAAGAGCTGGG - Intergenic
994656277 5:102597166-102597188 GATTGCTCTTAATAGGTGCTAGG - Intergenic
996660047 5:125991515-125991537 GTTTTGTGTTTATAGGTGCTGGG - Intergenic
997114755 5:131113956-131113978 GATTAGTATTGCTTAGTGCTAGG + Intergenic
1003310660 6:4967132-4967154 GATTGTTAATACTAAGTGCTGGG + Intergenic
1003679498 6:8237819-8237841 CATTGCTATTTATATGAGCTGGG + Intergenic
1004188039 6:13438795-13438817 TACTGGCATTTATTAGTGCTAGG - Intronic
1004861876 6:19812490-19812512 GATTGGTATGTATGATTGATTGG + Intergenic
1004933744 6:20487487-20487509 GAATAGTATTCTTAAGTGCTAGG - Intronic
1007050461 6:38823141-38823163 GCTTGGTATTTATAGATTCTTGG - Intronic
1008076133 6:47148157-47148179 GAATGGTGTTGAAAAGTGCTGGG - Intergenic
1008768931 6:54954816-54954838 GATTTGCATTTCTAAGTCCTTGG + Intergenic
1009528754 6:64782117-64782139 GGTTGGTATTCATAAGTTATTGG + Intronic
1009564295 6:65292340-65292362 AATTGGTGATTATAAGGGCTAGG + Intronic
1009602326 6:65817994-65818016 GATTTGCTTTTATAAATGCTGGG + Intergenic
1010081188 6:71865479-71865501 GAATGTTATTTAAACGTGCTTGG - Intergenic
1011121067 6:83953516-83953538 GATTGGTATTTCAGAGTACTTGG - Intronic
1012455019 6:99394124-99394146 GGTTGGTTTTTAAGAGTGCTGGG - Exonic
1013345841 6:109259860-109259882 GATTCTCATTTTTAAGTGCTTGG + Intergenic
1014117069 6:117677564-117677586 GATTGGTAAATTTAAGTGCAGGG + Intronic
1020623766 7:10551547-10551569 GATAGGGTTTTATGAGTGCTGGG - Intergenic
1024703745 7:51934591-51934613 GATTGGTATTTTTAAATGTTTGG + Intergenic
1030334440 7:108309373-108309395 TCTTGGTTTTTATAAGTTCTAGG + Intronic
1031114144 7:117649167-117649189 GATCGTTCTTTATAATTGCTTGG - Intronic
1034633278 7:152547494-152547516 GAGTGCTATTTATAAGACCTTGG + Intergenic
1036150865 8:6296978-6297000 GATTTTTTTTTACAAGTGCTTGG - Intergenic
1038917609 8:32041854-32041876 AAGTGGTATTTATTAGTGCCTGG + Intronic
1040524821 8:48211990-48212012 AATTGGTATCTTTAAGTTCTAGG - Intergenic
1041338665 8:56817339-56817361 AAATTGTATTTATATGTGCTAGG + Intergenic
1055677287 9:78677375-78677397 TATTGGTATTGATATTTGCTGGG - Intergenic
1056807769 9:89742088-89742110 GATTGGTAGTTGTAAGCGGTTGG + Intergenic
1188401013 X:29744520-29744542 GATTCATATTTATATTTGCTGGG + Intronic
1190788597 X:53678453-53678475 GGTTGATATTCATAAGTACTTGG - Intronic
1190961975 X:55260653-55260675 GTTTTTTATTTTTAAGTGCTAGG - Exonic
1193927315 X:87503543-87503565 GCTAAGTATTTGTAAGTGCTTGG - Intergenic
1196847015 X:119904495-119904517 TCTTGGTATTTCAAAGTGCTGGG - Intronic
1197576953 X:128225749-128225771 GAATTGTATTTATAACTTCTGGG + Intergenic
1198302806 X:135348006-135348028 GATTTGTACATATATGTGCTTGG + Intronic