ID: 1130011709

View in Genome Browser
Species Human (GRCh38)
Location 15:80157534-80157556
Sequence TCGGGTTGTAAGGGAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130011709_1130011716 27 Left 1130011709 15:80157534-80157556 CCTGCAGCTCCCTTACAACCCGA 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1130011716 15:80157584-80157606 GCTCATTAATCCAAGCCACCTGG 0: 1
1: 0
2: 1
3: 9
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130011709 Original CRISPR TCGGGTTGTAAGGGAGCTGC AGG (reversed) Intronic
901232591 1:7649500-7649522 CCAGGTTGGAAGGGGGCTGCAGG - Intronic
903732003 1:25503566-25503588 TCGGGTTGAGAGGGAGGTGCAGG + Intergenic
904003418 1:27351020-27351042 GCGGGGTGTGAGGGGGCTGCGGG - Intronic
906534550 1:46544286-46544308 CCGGGTTGAAGGGGAGCTGTGGG - Intergenic
919389735 1:196967955-196967977 TCTTGTTGTAATGGAGTTGCAGG - Intergenic
922606186 1:226891333-226891355 CCGGGTCGTAGGGGAGCTGGAGG - Exonic
1063242796 10:4188528-4188550 TCCAGTTGTATGTGAGCTGCAGG + Intergenic
1064915727 10:20455648-20455670 TTGCTTTGTAAGGCAGCTGCGGG - Intergenic
1067173118 10:43923702-43923724 TAGGGTTGGAAGGGAGGGGCTGG - Intergenic
1071238784 10:83680739-83680761 TCGGGTGGTGAGAAAGCTGCAGG + Intergenic
1073012728 10:100373802-100373824 TCGGGTTATGAGGGAGGGGCTGG - Intergenic
1073047609 10:100649917-100649939 TCGGGCTCTAAGGGAGGTGAGGG + Intergenic
1075897398 10:126008943-126008965 TGGGGTTGCAGGGGGGCTGCTGG + Intronic
1078759555 11:14241513-14241535 TCGGGGGTGAAGGGAGCTGCTGG + Intronic
1081773532 11:45663822-45663844 CCGGGTCTTTAGGGAGCTGCTGG - Intronic
1101482077 12:105107855-105107877 TCGCAGAGTAAGGGAGCTGCAGG + Exonic
1102988395 12:117297248-117297270 TGGGGTTGGAATGCAGCTGCAGG + Intronic
1103046850 12:117743110-117743132 TTGGATTGTATGGGAGCAGCAGG - Intronic
1122470251 14:101961477-101961499 TGGGGCTGTCAGGGTGCTGCTGG - Intergenic
1123774516 15:23565792-23565814 TGGGCTTCTGAGGGAGCTGCAGG - Exonic
1128086176 15:64888321-64888343 TAGTGTAGTAAGGGGGCTGCAGG + Intronic
1128791359 15:70436724-70436746 TGGTGATGTAAGGTAGCTGCTGG - Intergenic
1129515209 15:76153089-76153111 TCAGGTGGTTAGGAAGCTGCAGG - Intronic
1130011709 15:80157534-80157556 TCGGGTTGTAAGGGAGCTGCAGG - Intronic
1132206035 15:99986874-99986896 CCGGGTGGGAAGGCAGCTGCAGG + Intronic
1133014378 16:2932595-2932617 TGGGGTGGGAAGGGAGGTGCAGG + Intronic
1134609509 16:15597343-15597365 TCTGGGTGTCAGGGAGCTCCTGG + Intronic
1145397250 17:22505888-22505910 TCAGGTAGTATGGGGGCTGCTGG + Intergenic
1150466943 17:65401980-65402002 TCGTGTTGGAAAGGAGGTGCTGG - Intergenic
1157801245 18:50623118-50623140 TCAGGCTGTAAGAGAGCTGTAGG + Intronic
1159965179 18:74588016-74588038 GGGGGTTGTAAGGGTGTTGCTGG - Intergenic
1160860854 19:1236805-1236827 GCGGGTTGCCAGGGAGCGGCGGG + Intronic
1162033873 19:7928854-7928876 TCGCTTTGCCAGGGAGCTGCTGG - Intronic
1164937289 19:32224365-32224387 TCGGGGTGTCAGGGTGCTCCTGG - Intergenic
925058470 2:873215-873237 TCAGGTGGGAAGGAAGCTGCCGG - Intergenic
928904536 2:36355984-36356006 TTGGGTTGAACCGGAGCTGCCGG + Exonic
932349417 2:71020409-71020431 TTGGGCCGTAAAGGAGCTGCCGG - Intergenic
933223380 2:79716656-79716678 TCTGGTGGTCAGGGAGCTCCAGG + Intronic
937095250 2:119231090-119231112 TCAGGTGGTGAGGGAGCTGGTGG - Intronic
938026483 2:127953496-127953518 TGGGGTTGGCAGGGAGCTGTTGG - Intronic
938262046 2:129903317-129903339 TCGGGTTGCCAGGGAGCAGGTGG - Intergenic
940104600 2:150084088-150084110 TGGGGTTGTAAGGTGGCAGCAGG + Intergenic
1171392914 20:24812461-24812483 TGGGGTGGCATGGGAGCTGCTGG - Intergenic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1172384860 20:34526933-34526955 TTGGGGTGGAGGGGAGCTGCAGG - Intronic
1173047815 20:39529390-39529412 TCAGGGTGAGAGGGAGCTGCTGG + Intergenic
1175978651 20:62726108-62726130 TCGGGCTGGAATGGAGCTGCCGG - Intronic
1180613248 22:17111010-17111032 TGAGCTTGTCAGGGAGCTGCTGG + Exonic
1181807393 22:25383402-25383424 TTGGGAGGTGAGGGAGCTGCAGG + Intronic
1182924715 22:34111464-34111486 TCTGGTTGAAAGGGACCTGGAGG + Intergenic
1185348166 22:50319647-50319669 GCGGGTGGTGAGGGAGCTGGAGG - Intronic
951052854 3:18113997-18114019 ACGTGCTGAAAGGGAGCTGCAGG - Intronic
951152561 3:19308899-19308921 TCTGTTTTTAAGGGAGCAGCAGG + Intronic
954486746 3:50860157-50860179 GGGGGTTGTATGGGACCTGCAGG + Intronic
968258268 3:197298237-197298259 TCGGGTTGGAAGGGGGAGGCGGG + Intronic
968699257 4:2047027-2047049 GCGGGGTGGAACGGAGCTGCGGG - Intergenic
972001047 4:34033854-34033876 TTGGCTTGTAAGGGAGCTGTGGG - Intergenic
979318926 4:119300542-119300564 TAGGGTTGTTACGAAGCTGCAGG - Exonic
993184659 5:84601766-84601788 GCAGGTTGTAAGGGATCTGCTGG + Intergenic
1001177165 5:169481066-169481088 TTGGATTGTATGGGAGCTGGAGG - Intergenic
1004381581 6:15137368-15137390 TTGTGTTGTAAAGAAGCTGCTGG + Intergenic
1005186906 6:23172651-23172673 TCAGGTTGTTGGGGAGTTGCTGG + Intergenic
1006258711 6:32851250-32851272 TGGGGTTCTAAGGAGGCTGCAGG + Intronic
1008379228 6:50823547-50823569 TCTGGTGGTAGGGGAGCGGCTGG - Exonic
1013663734 6:112325701-112325723 TCAGCTTGTCAGGGCGCTGCTGG - Intergenic
1019873236 7:3786861-3786883 TGGGGGTGTGGGGGAGCTGCAGG - Intronic
1022822952 7:33979348-33979370 TCAGGTTCTCAGGGAGTTGCAGG - Intronic
1031592335 7:123609150-123609172 TGGGGTTCTGAGGGAGATGCAGG - Intronic
1035678318 8:1470349-1470371 TCAGGTTGTAAGGAACCAGCGGG - Intergenic
1038767570 8:30443126-30443148 TCGGGTTGTGGAGAAGCTGCAGG - Intronic
1048793087 8:138122406-138122428 TAGGGATCTAAGGAAGCTGCAGG + Intergenic
1052809484 9:33044506-33044528 TCTGGCTGTAAGGGCGCTGGAGG + Exonic
1057915803 9:99054155-99054177 TGGGGTTGTAAGGGAACAGGAGG - Intronic
1061975265 9:134065122-134065144 TCGTGATATAAGGGACCTGCTGG + Intronic
1187219218 X:17307879-17307901 TCGGTTTGCATGGGAGCAGCTGG - Intergenic
1200266964 X:154651893-154651915 TCGGGTTGTAGGGGAGGCTCTGG - Intergenic