ID: 1130013593

View in Genome Browser
Species Human (GRCh38)
Location 15:80170970-80170992
Sequence AGATAGGGGTTAGAGGCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130013593 Original CRISPR AGATAGGGGTTAGAGGCCGT GGG Intronic
911540770 1:99155587-99155609 AGATAGGGGATAGAGGTGGAAGG - Intergenic
912500044 1:110115610-110115632 AGGTAGGGGAGAGATGCCGTGGG - Intergenic
913264472 1:117031067-117031089 AGATATGGGTGAGAGGCAGATGG + Intronic
914663307 1:149811596-149811618 AGATACAGGTTAAAGGCCGAAGG + Intronic
918169730 1:181985302-181985324 AGATAGAGGTTAAAGGGTGTCGG - Intergenic
1064159231 10:12929538-12929560 AGATATGGGTTAGAGTCCACAGG + Intronic
1069717278 10:70529361-70529383 AGATAGGGGTGGGAGGCAGCAGG - Intronic
1070689693 10:78515418-78515440 ACATAGGGCTTGGAGGCCCTGGG - Intergenic
1073488154 10:103834842-103834864 ACATAGTGGTTACAGGCCGCAGG - Intronic
1075213718 10:120513543-120513565 AGATAGGAGTTGGAGGCCAAGGG + Intronic
1075883280 10:125873380-125873402 AGTGAGGGATTAGAGGCCTTTGG - Intronic
1076039147 10:127228025-127228047 AGCTAGGGTTTAGAGGCAATGGG - Intronic
1086817713 11:91393834-91393856 AGATAGGTGGTAGAGACAGTGGG + Intergenic
1091321313 11:134654369-134654391 AGGCAGTGGTGAGAGGCCGTTGG + Intergenic
1096818452 12:54216287-54216309 AGTTAAGGGTTAGATGCAGTAGG - Intergenic
1099861343 12:88228762-88228784 AGATAGGGGTTTAAGGTGGTGGG - Intergenic
1102208696 12:111108622-111108644 AGATAGTGGGTAGAGACAGTGGG - Intronic
1106814061 13:33387770-33387792 ATACAGGGGATAGAGGCCCTTGG - Intergenic
1109604085 13:64669126-64669148 AGATAGGGGATGGAGGTTGTAGG - Intergenic
1114261057 14:21036662-21036684 AGATAGGGCATAGAGGAGGTGGG - Intronic
1121624363 14:95373549-95373571 AGAGAGTGGGCAGAGGCCGTTGG - Intergenic
1122786169 14:104164225-104164247 AGATAGACGTGAGAGGCCGAGGG + Intronic
1127849400 15:62899835-62899857 AGATAGGAGCTCGAGGCAGTTGG - Intergenic
1130013593 15:80170970-80170992 AGATAGGGGTTAGAGGCCGTGGG + Intronic
1132798606 16:1740425-1740447 AGACAGGTGTTAGAGGGTGTGGG - Intronic
1132798617 16:1740522-1740544 AGACAGGTGTTAGAGGGCGTGGG - Intronic
1132798630 16:1740611-1740633 AGACAGGCGTTAGAAGGCGTGGG - Intronic
1133301094 16:4783447-4783469 AGTTACGGGTGAGAGGCTGTGGG - Exonic
1133406960 16:5532221-5532243 AGATAATGGATAGAGGCCCTGGG - Intergenic
1138137648 16:54537293-54537315 AGATAGGGGGTTGAGGGCTTCGG + Intergenic
1142002088 16:87669918-87669940 ACATGGGGCTCAGAGGCCGTGGG + Intronic
1145979869 17:29005198-29005220 AGATAGGGGGTCCAGGCCCTTGG + Intronic
1159665354 18:71152250-71152272 AGATAGGTGTTAAAGTCCTTTGG + Intergenic
1161851083 19:6738444-6738466 GGATAGGGGATAGAGGCCAGAGG - Intronic
1162303404 19:9857066-9857088 AGTGAGGGGTTAGAGGCCAAGGG + Intronic
1163636540 19:18439524-18439546 AGAAAGGGGCTAGAGGCAGGAGG - Intergenic
1165472165 19:36009957-36009979 AGGCAGAGGTTAGAGGCAGTGGG + Intronic
1167244130 19:48363711-48363733 AGACAGGGGTCAGAGGTCTTAGG + Intronic
928171605 2:29007915-29007937 GGAAAGGGGTGAGAGGCTGTTGG - Intronic
929010251 2:37434975-37434997 GGACAGGGGTTAGAGGCAGAAGG - Intergenic
939258409 2:139775219-139775241 AGAAAGGGGTGAGAGTACGTAGG + Intergenic
946690769 2:222306781-222306803 AGATTGCGGTTAGAGGGGGTGGG + Intergenic
947722727 2:232379413-232379435 AGTAAGGAGTTAGAGGCAGTTGG + Intronic
947826369 2:233108276-233108298 AGAAAGGGGTTGGAGGTGGTGGG - Intronic
948765608 2:240217190-240217212 AGATGGAGGTTAGAGGCCTGGGG + Intergenic
1175281322 20:57806073-57806095 AGATAGAGGTTTGGGGCTGTTGG - Intergenic
1184135842 22:42549411-42549433 ACATAGGGGTGAGAGGCAGGTGG + Intergenic
951792790 3:26504686-26504708 AGAAAGAAGTTAGAGGCCCTGGG - Intergenic
953799261 3:46009356-46009378 AGATAGGGGTGAGAAGTGGTTGG + Intergenic
956904903 3:73755784-73755806 AGGTAGGGGTTAGAGGGTTTGGG - Intergenic
957038888 3:75320938-75320960 AGACAGGAGTTAGAGGCCACAGG - Intergenic
958020056 3:87983665-87983687 AGATTGGGGTCAGAGGCCAAGGG - Intergenic
958031337 3:88114652-88114674 AGATAGGAGTTAGAGGCTCAAGG - Intronic
961087046 3:124077101-124077123 AGACAGGAGTTAGAGGCCACAGG - Intergenic
970124645 4:12795567-12795589 AGATAGAGGTTAGTGGCAATAGG + Intergenic
970955752 4:21809337-21809359 AGGTAGGGGTTAGCGGCACTGGG - Intronic
982493124 4:156054608-156054630 AGACTGGGGTTAGAGGGCATGGG + Intergenic
986866138 5:11990083-11990105 GGATAGGGATTAGAGGACCTGGG + Intergenic
987933078 5:24427625-24427647 AGAAAGGGGTTGGAGGGGGTGGG - Intergenic
990943370 5:61226366-61226388 AGATAGGGGTTACAGGAACTTGG - Intergenic
1001892973 5:175354696-175354718 AGAAAGGGGAGAAAGGCCGTGGG + Intergenic
1005468890 6:26142493-26142515 ACATAGGGATTTGAGGCCTTTGG - Intergenic
1008544565 6:52574021-52574043 AGAAAGGGGTGAGAGGACATAGG - Intronic
1011759770 6:90549666-90549688 AGAGAGAGTTTAGAGGACGTGGG + Intronic
1018723915 6:166596150-166596172 AGACAGGGGTCACAGGCCATGGG + Intronic
1023878477 7:44305720-44305742 AGACAGGGGCGAGAGGCCTTGGG + Intronic
1024044351 7:45576685-45576707 AGATGGGGGGTGGAGGCAGTAGG - Intronic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1040514067 8:48120220-48120242 TGAGAGGGGTCAGAGCCCGTGGG + Intergenic
1041511516 8:58659385-58659407 AGGTCGGGGTGAGAGGCCGGGGG - Exonic
1041810644 8:61904978-61905000 AGTTAGGAGTTAGAGGCTGTAGG + Intergenic
1057564697 9:96157331-96157353 AGATAGGGGTTTGAGACCATAGG - Intergenic
1058104588 9:100955807-100955829 AGATAGGGGAGAGAGTCCCTAGG + Intergenic
1062482624 9:136759467-136759489 AGGCAGGGGTGAGAGGCCCTGGG - Intergenic
1186600027 X:11026932-11026954 AGATATGGGACTGAGGCCGTTGG + Intergenic
1192170825 X:68853414-68853436 AGATTGGAGTGAGAGGCTGTGGG - Intergenic
1192999122 X:76544519-76544541 AGATAGGGGGCAGAGGCGATTGG + Intergenic
1194526582 X:94984207-94984229 AGATAGTGGTTATAGGCCTTGGG + Intergenic
1197849572 X:130843285-130843307 AGATAGGAGGTAGAGTCCGTAGG - Intronic