ID: 1130018171

View in Genome Browser
Species Human (GRCh38)
Location 15:80203150-80203172
Sequence CAGGGACAGCTTTAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130018165_1130018171 -8 Left 1130018165 15:80203135-80203157 CCCAAGTTCAGCTGCCAGGGACA No data
Right 1130018171 15:80203150-80203172 CAGGGACAGCTTTAGGAGGAGGG No data
1130018166_1130018171 -9 Left 1130018166 15:80203136-80203158 CCAAGTTCAGCTGCCAGGGACAG No data
Right 1130018171 15:80203150-80203172 CAGGGACAGCTTTAGGAGGAGGG No data
1130018164_1130018171 -7 Left 1130018164 15:80203134-80203156 CCCCAAGTTCAGCTGCCAGGGAC No data
Right 1130018171 15:80203150-80203172 CAGGGACAGCTTTAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130018171 Original CRISPR CAGGGACAGCTTTAGGAGGA GGG Intergenic
No off target data available for this crispr