ID: 1130019439

View in Genome Browser
Species Human (GRCh38)
Location 15:80215611-80215633
Sequence AATCTAAAAAGCTGTGACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130019439_1130019442 5 Left 1130019439 15:80215611-80215633 CCAATGTCACAGCTTTTTAGATT No data
Right 1130019442 15:80215639-80215661 TCTCATATAGGGCACATTCCTGG No data
1130019439_1130019445 17 Left 1130019439 15:80215611-80215633 CCAATGTCACAGCTTTTTAGATT No data
Right 1130019445 15:80215651-80215673 CACATTCCTGGGGCATTATCTGG No data
1130019439_1130019447 25 Left 1130019439 15:80215611-80215633 CCAATGTCACAGCTTTTTAGATT No data
Right 1130019447 15:80215659-80215681 TGGGGCATTATCTGGCCTCCAGG No data
1130019439_1130019441 -6 Left 1130019439 15:80215611-80215633 CCAATGTCACAGCTTTTTAGATT No data
Right 1130019441 15:80215628-80215650 TAGATTTGTTGTCTCATATAGGG No data
1130019439_1130019448 29 Left 1130019439 15:80215611-80215633 CCAATGTCACAGCTTTTTAGATT No data
Right 1130019448 15:80215663-80215685 GCATTATCTGGCCTCCAGGATGG No data
1130019439_1130019444 7 Left 1130019439 15:80215611-80215633 CCAATGTCACAGCTTTTTAGATT No data
Right 1130019444 15:80215641-80215663 TCATATAGGGCACATTCCTGGGG No data
1130019439_1130019440 -7 Left 1130019439 15:80215611-80215633 CCAATGTCACAGCTTTTTAGATT No data
Right 1130019440 15:80215627-80215649 TTAGATTTGTTGTCTCATATAGG No data
1130019439_1130019443 6 Left 1130019439 15:80215611-80215633 CCAATGTCACAGCTTTTTAGATT No data
Right 1130019443 15:80215640-80215662 CTCATATAGGGCACATTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130019439 Original CRISPR AATCTAAAAAGCTGTGACAT TGG (reversed) Intergenic
No off target data available for this crispr