ID: 1130024865

View in Genome Browser
Species Human (GRCh38)
Location 15:80262238-80262260
Sequence CACGGCAAGAAGGGGGACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130024857_1130024865 8 Left 1130024857 15:80262207-80262229 CCTGAGGGAGGTTTGGGAGCTGA No data
Right 1130024865 15:80262238-80262260 CACGGCAAGAAGGGGGACTTTGG No data
1130024849_1130024865 28 Left 1130024849 15:80262187-80262209 CCTGTTCCAGGGCAGGTGGCCCT No data
Right 1130024865 15:80262238-80262260 CACGGCAAGAAGGGGGACTTTGG No data
1130024856_1130024865 9 Left 1130024856 15:80262206-80262228 CCCTGAGGGAGGTTTGGGAGCTG No data
Right 1130024865 15:80262238-80262260 CACGGCAAGAAGGGGGACTTTGG No data
1130024852_1130024865 22 Left 1130024852 15:80262193-80262215 CCAGGGCAGGTGGCCCTGAGGGA No data
Right 1130024865 15:80262238-80262260 CACGGCAAGAAGGGGGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130024865 Original CRISPR CACGGCAAGAAGGGGGACTT TGG Intergenic
No off target data available for this crispr