ID: 1130025844

View in Genome Browser
Species Human (GRCh38)
Location 15:80269750-80269772
Sequence CAGCAGAGGGAGAGCTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130025844_1130025855 27 Left 1130025844 15:80269750-80269772 CCATCCCAGCTCTCCCTCTGCTG No data
Right 1130025855 15:80269800-80269822 ACTTCCTTCTCCACTACGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130025844 Original CRISPR CAGCAGAGGGAGAGCTGGGA TGG (reversed) Intergenic
No off target data available for this crispr