ID: 1130032356

View in Genome Browser
Species Human (GRCh38)
Location 15:80327582-80327604
Sequence CATGTAGGAACAAGATCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130032356_1130032361 6 Left 1130032356 15:80327582-80327604 CCACTGGATCTTGTTCCTACATG No data
Right 1130032361 15:80327611-80327633 TATCAACAACAGGGCTGCCCTGG No data
1130032356_1130032358 -4 Left 1130032356 15:80327582-80327604 CCACTGGATCTTGTTCCTACATG No data
Right 1130032358 15:80327601-80327623 CATGTTTCCTTATCAACAACAGG No data
1130032356_1130032359 -3 Left 1130032356 15:80327582-80327604 CCACTGGATCTTGTTCCTACATG No data
Right 1130032359 15:80327602-80327624 ATGTTTCCTTATCAACAACAGGG No data
1130032356_1130032362 7 Left 1130032356 15:80327582-80327604 CCACTGGATCTTGTTCCTACATG No data
Right 1130032362 15:80327612-80327634 ATCAACAACAGGGCTGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130032356 Original CRISPR CATGTAGGAACAAGATCCAG TGG (reversed) Intergenic
No off target data available for this crispr