ID: 1130032357

View in Genome Browser
Species Human (GRCh38)
Location 15:80327597-80327619
Sequence TTGTTGATAAGGAAACATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130032357_1130032366 24 Left 1130032357 15:80327597-80327619 CCTACATGTTTCCTTATCAACAA No data
Right 1130032366 15:80327644-80327666 CCAAGTTTGAAGAGCAGCAGAGG No data
1130032357_1130032361 -9 Left 1130032357 15:80327597-80327619 CCTACATGTTTCCTTATCAACAA No data
Right 1130032361 15:80327611-80327633 TATCAACAACAGGGCTGCCCTGG No data
1130032357_1130032362 -8 Left 1130032357 15:80327597-80327619 CCTACATGTTTCCTTATCAACAA No data
Right 1130032362 15:80327612-80327634 ATCAACAACAGGGCTGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130032357 Original CRISPR TTGTTGATAAGGAAACATGT AGG (reversed) Intergenic
No off target data available for this crispr