ID: 1130032359

View in Genome Browser
Species Human (GRCh38)
Location 15:80327602-80327624
Sequence ATGTTTCCTTATCAACAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130032355_1130032359 1 Left 1130032355 15:80327578-80327600 CCAACCACTGGATCTTGTTCCTA No data
Right 1130032359 15:80327602-80327624 ATGTTTCCTTATCAACAACAGGG No data
1130032356_1130032359 -3 Left 1130032356 15:80327582-80327604 CCACTGGATCTTGTTCCTACATG No data
Right 1130032359 15:80327602-80327624 ATGTTTCCTTATCAACAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130032359 Original CRISPR ATGTTTCCTTATCAACAACA GGG Intergenic
No off target data available for this crispr