ID: 1130032361

View in Genome Browser
Species Human (GRCh38)
Location 15:80327611-80327633
Sequence TATCAACAACAGGGCTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130032355_1130032361 10 Left 1130032355 15:80327578-80327600 CCAACCACTGGATCTTGTTCCTA No data
Right 1130032361 15:80327611-80327633 TATCAACAACAGGGCTGCCCTGG No data
1130032356_1130032361 6 Left 1130032356 15:80327582-80327604 CCACTGGATCTTGTTCCTACATG No data
Right 1130032361 15:80327611-80327633 TATCAACAACAGGGCTGCCCTGG No data
1130032357_1130032361 -9 Left 1130032357 15:80327597-80327619 CCTACATGTTTCCTTATCAACAA No data
Right 1130032361 15:80327611-80327633 TATCAACAACAGGGCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130032361 Original CRISPR TATCAACAACAGGGCTGCCC TGG Intergenic
No off target data available for this crispr