ID: 1130032636

View in Genome Browser
Species Human (GRCh38)
Location 15:80329363-80329385
Sequence AGGCTGCATCAGTGGACCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130032636_1130032641 -2 Left 1130032636 15:80329363-80329385 CCACGGGTCCACTGATGCAGCCT No data
Right 1130032641 15:80329384-80329406 CTCTTACAACCCTGTGAGGTGGG No data
1130032636_1130032650 30 Left 1130032636 15:80329363-80329385 CCACGGGTCCACTGATGCAGCCT No data
Right 1130032650 15:80329416-80329438 CCCCATTGTATGATGTGGGGAGG No data
1130032636_1130032642 1 Left 1130032636 15:80329363-80329385 CCACGGGTCCACTGATGCAGCCT No data
Right 1130032642 15:80329387-80329409 TTACAACCCTGTGAGGTGGGTGG No data
1130032636_1130032648 27 Left 1130032636 15:80329363-80329385 CCACGGGTCCACTGATGCAGCCT No data
Right 1130032648 15:80329413-80329435 CCTCCCCATTGTATGATGTGGGG No data
1130032636_1130032638 -6 Left 1130032636 15:80329363-80329385 CCACGGGTCCACTGATGCAGCCT No data
Right 1130032638 15:80329380-80329402 CAGCCTCTTACAACCCTGTGAGG No data
1130032636_1130032646 26 Left 1130032636 15:80329363-80329385 CCACGGGTCCACTGATGCAGCCT No data
Right 1130032646 15:80329412-80329434 TCCTCCCCATTGTATGATGTGGG No data
1130032636_1130032645 25 Left 1130032636 15:80329363-80329385 CCACGGGTCCACTGATGCAGCCT No data
Right 1130032645 15:80329411-80329433 GTCCTCCCCATTGTATGATGTGG No data
1130032636_1130032640 -3 Left 1130032636 15:80329363-80329385 CCACGGGTCCACTGATGCAGCCT No data
Right 1130032640 15:80329383-80329405 CCTCTTACAACCCTGTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130032636 Original CRISPR AGGCTGCATCAGTGGACCCG TGG (reversed) Intergenic
No off target data available for this crispr