ID: 1130038795

View in Genome Browser
Species Human (GRCh38)
Location 15:80386350-80386372
Sequence AATCCAGTGCTTTAACAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130038795_1130038800 -7 Left 1130038795 15:80386350-80386372 CCCCATTGTTAAAGCACTGGATT 0: 1
1: 0
2: 1
3: 12
4: 144
Right 1130038800 15:80386366-80386388 CTGGATTGGGACTGTTCATAAGG 0: 1
1: 0
2: 0
3: 4
4: 86
1130038795_1130038803 24 Left 1130038795 15:80386350-80386372 CCCCATTGTTAAAGCACTGGATT 0: 1
1: 0
2: 1
3: 12
4: 144
Right 1130038803 15:80386397-80386419 CCAAGTTGCACACATAGCTATGG 0: 1
1: 0
2: 0
3: 12
4: 247
1130038795_1130038804 30 Left 1130038795 15:80386350-80386372 CCCCATTGTTAAAGCACTGGATT 0: 1
1: 0
2: 1
3: 12
4: 144
Right 1130038804 15:80386403-80386425 TGCACACATAGCTATGGAAATGG 0: 1
1: 0
2: 0
3: 15
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130038795 Original CRISPR AATCCAGTGCTTTAACAATG GGG (reversed) Intronic
902649983 1:17830770-17830792 AATGCTGTGCTTTCACATTGTGG - Intergenic
904511406 1:31012119-31012141 AAGCCAGTTCTTTAAGAAGGTGG - Intronic
908017305 1:59856857-59856879 TATCCAGTGCTGAGACAATGCGG + Intronic
908784926 1:67725467-67725489 AAACAAGTACTTTAACCATGAGG - Intronic
910727125 1:90350886-90350908 CATGCAGTGATTTAGCAATGAGG + Intergenic
910960354 1:92755645-92755667 CTGCCAGTCCTTTAACAATGGGG + Intronic
912207639 1:107525881-107525903 ATACCACTGCTGTAACAATGAGG + Intergenic
923951597 1:238962027-238962049 AAACCAGTGCCTTAAGAATCAGG - Intergenic
1067903964 10:50271692-50271714 AATCTTGTGCATTAACAATTTGG + Intergenic
1068950650 10:62773674-62773696 ACTCCAGTCATTTAACAAAGAGG + Intergenic
1069060324 10:63888131-63888153 AATCTAATTCTCTAACAATGAGG - Intergenic
1078007172 11:7540663-7540685 TATCCAGTGCTTACAGAATGGGG + Intronic
1078798598 11:14619748-14619770 AATCCAGTGTTTAAACTTTGAGG - Intronic
1080269391 11:30434894-30434916 AATCGAGTGATTAAACACTGTGG - Intronic
1080940766 11:36915009-36915031 AATCCAGAGCTTTCACATTGTGG + Intergenic
1084309248 11:68306973-68306995 AATGCAGTGCTTTAAAATTAAGG + Intergenic
1087010767 11:93511798-93511820 AATGCAGGACATTAACAATGTGG + Intronic
1087258774 11:95986797-95986819 AAACCTGTGCTTTTAGAATGGGG - Intronic
1087943653 11:104131618-104131640 AATCCGGTGCTTTACCATTCAGG + Intronic
1089171385 11:116513972-116513994 TTTCCAGTGCTATAACACTGGGG + Intergenic
1090477607 11:127037673-127037695 AATCCAGCTCTCTAGCAATGGGG + Intergenic
1095921310 12:47533886-47533908 AGTCCAGTGCTTTATTATTGGGG - Intergenic
1096381016 12:51158261-51158283 ATACCAGTGCTTTAGGAATGGGG - Intronic
1098975324 12:76896235-76896257 AATCCAGGGCTTTAGAAATCTGG - Intergenic
1102454211 12:113061437-113061459 TTTCCAGTGCGTTACCAATGAGG - Intronic
1102966647 12:117132808-117132830 AATCCTTTGCTTTAACAGGGAGG - Intergenic
1107933096 13:45322491-45322513 AATACAGTGGGTTAACAAGGTGG + Intergenic
1108122042 13:47199105-47199127 AATCCAGTGCTTTCAGAATAAGG + Intergenic
1108302110 13:49089275-49089297 AAGCCAGAGCTTAAATAATGTGG + Intronic
1110688712 13:78405751-78405773 AATAGAGTGGTCTAACAATGAGG + Intergenic
1113261004 13:108562886-108562908 AACACAGTCCGTTAACAATGAGG - Intergenic
1115998847 14:39221173-39221195 AATGCTCTGATTTAACAATGTGG - Intergenic
1116636786 14:47406767-47406789 GATGCAGTGCTTTAATATTGAGG - Intronic
1116749479 14:48865285-48865307 AATGTAGTACTTTAAAAATGAGG - Intergenic
1121253571 14:92516214-92516236 AATCCCCTAATTTAACAATGAGG + Intronic
1122147400 14:99699867-99699889 AATTCAGTGCCTTCACAATGTGG + Intronic
1124012745 15:25851773-25851795 AATTCAGTGTCTTAGCAATGTGG + Intronic
1126459868 15:48903599-48903621 TATCCAGTGATTTTAAAATGAGG - Intronic
1128631326 15:69271126-69271148 AATATCGTGCCTTAACAATGTGG + Exonic
1129701951 15:77773309-77773331 ATTCCAGCGTTATAACAATGTGG + Intronic
1129794413 15:78365165-78365187 AACCAAGAGCTTTAACAAAGAGG - Intergenic
1130038795 15:80386350-80386372 AATCCAGTGCTTTAACAATGGGG - Intronic
1132099169 15:99010940-99010962 AATCCAGTATTTAAACAATAGGG - Intergenic
1132394357 15:101461074-101461096 AATGCAGTTCTTTAAAAATCTGG + Intronic
1133627650 16:7586650-7586672 AATCTATTTGTTTAACAATGTGG + Intronic
1134172982 16:11983553-11983575 AATCCAGTGCCTTCACAAGGGGG - Intronic
1135127402 16:19822700-19822722 AATTCACTGCTTAAAGAATGTGG + Intronic
1135723220 16:24834409-24834431 AATCCAGTGCTTGGTCAGTGGGG - Intergenic
1137026514 16:35481466-35481488 GATCCGGTGGTTTAAAAATGAGG - Intergenic
1141740985 16:85892840-85892862 AGTCCAGTGTTTTTAAAATGTGG + Intergenic
1143141515 17:4744158-4744180 AAACCAGCGCTTTAAGGATGTGG - Intronic
1144430330 17:15185409-15185431 AAGCCAGTGCTATGACACTGGGG - Intergenic
1145014072 17:19385553-19385575 AACCCAGTCCTTTAACAAACTGG - Intronic
1147964403 17:44186472-44186494 CATCCAGTGCTTGAAGAGTGCGG - Intergenic
1148671319 17:49412616-49412638 AATCCATTGCTTGACCAATGAGG + Intronic
1149643398 17:58219888-58219910 AAGCCAGTGCAGTAACAAAGTGG - Intronic
1150372020 17:64647373-64647395 ATTCCAGTTCTTTAGAAATGAGG - Intronic
1153878725 18:9401880-9401902 AACCTAGTGCTTTAAAAATCTGG - Exonic
1158329257 18:56343750-56343772 AGTCAAGTTCTTTAAAAATGAGG - Intergenic
1159039203 18:63307255-63307277 AAACCAGTGCTTTTAAAATATGG - Intronic
1159303701 18:66612308-66612330 TATCCAGTATTTTAAAAATGCGG - Intergenic
1162134292 19:8545679-8545701 AATCCAGTACTTCAACAACAAGG - Exonic
1167022379 19:46887649-46887671 AACTCAGTGCTCTAACCATGTGG + Intergenic
929629827 2:43448034-43448056 AATCCATTGCTTTAAAGATTTGG - Intronic
932124633 2:69132705-69132727 ATTCCAGTGCTTTATGCATGTGG + Intronic
933634400 2:84691843-84691865 AATCCTGCCCCTTAACAATGTGG - Intronic
939523929 2:143268031-143268053 AATCTAGAGCATTAAAAATGAGG - Intronic
940393611 2:153162359-153162381 AATCCTTTGCTTTTAAAATGAGG + Intergenic
942262166 2:174178032-174178054 AATTCAGTGTTTTAAAAATAGGG - Intronic
943570868 2:189573544-189573566 ACTCCAGTGCTTTATCTATATGG - Intronic
944877683 2:203978886-203978908 AATTCAATGCTTTAAATATGAGG - Intergenic
946502393 2:220263432-220263454 AATCCAGTTCTTAAGAAATGTGG + Intergenic
947538763 2:230959644-230959666 AATGCAGTGCTTTAGGAATGTGG - Intronic
1169880983 20:10346301-10346323 ATTCAAGTGATTTAAAAATGTGG + Intergenic
1170528702 20:17267456-17267478 AATCCTCTGCTTTCAGAATGTGG + Intronic
1171033070 20:21694148-21694170 AATGCAGCGATTTAAGAATGTGG - Intergenic
1173291175 20:41716572-41716594 AATCCAGTGCTCTATGAATGTGG - Intergenic
1173998903 20:47360179-47360201 AAACCAGTGGTTCAACCATGGGG + Intergenic
1175478784 20:59296708-59296730 AATCCCTTGCTTTACAAATGAGG - Intergenic
1177813436 21:25949766-25949788 TACCCAGTGCTTTCACATTGAGG + Intronic
1179922789 21:44516212-44516234 ATTCCAGGGCTTTCAGAATGAGG + Intronic
1184725844 22:46345699-46345721 AATGCACTGCCGTAACAATGGGG - Intronic
951887125 3:27535129-27535151 AAACCAGTGATTTGACAATTTGG + Intergenic
954479733 3:50787826-50787848 ACTCCTGTTCTTAAACAATGAGG - Intronic
954542546 3:51403781-51403803 AATGCAATGCTTTAACAAAATGG + Intronic
956072153 3:65464723-65464745 AATACAGCACTTTAACGATGGGG - Intronic
960161634 3:114356391-114356413 AATCCAGTTCTTTCTCAATCAGG + Intronic
961163330 3:124747844-124747866 AATCCTGTACTTTAACACAGTGG + Intergenic
962695640 3:137944704-137944726 CATCCAGTGATTTAACAAGGTGG - Intergenic
966461834 3:180184844-180184866 GATCCAGTGCCATAAAAATGTGG + Intergenic
967298816 3:187991929-187991951 AATCCATTTCTTTAACAACCAGG + Intergenic
972279129 4:37585753-37585775 AATCCTGGGCTTTAGAAATGGGG + Intronic
973174418 4:47187080-47187102 ATTCCAGTGCTTTTACATTTAGG + Intronic
974768852 4:66384389-66384411 AATCCTATTCTTTAAGAATGTGG - Intergenic
975493860 4:75016644-75016666 GAGCCAGTGCTTTAACGATGAGG - Intronic
980460632 4:133106843-133106865 GATCCAGTGGTTTAAAAGTGTGG + Intergenic
981125282 4:141098798-141098820 AACCCAGTCCTTGTACAATGAGG - Intronic
981637427 4:146897155-146897177 AGTCCTGTCCTTTAAGAATGAGG - Intronic
982108020 4:152028316-152028338 ACTCTAATGCTTTTACAATGGGG - Intergenic
982447274 4:155507575-155507597 TATTCAGTTCTTTAAGAATGAGG - Intergenic
982822224 4:159955498-159955520 AATGCTGTGCTTTAAAAAAGTGG - Intergenic
983317820 4:166154663-166154685 AGTGAAGTGCTTTAACAAAGAGG + Intergenic
983500213 4:168490904-168490926 AATCCAGTTTTTTAATAATGAGG + Intronic
984206689 4:176793697-176793719 ACCCCAGTGCTTTTCCAATGGGG - Intergenic
986649744 5:9951181-9951203 AGTCCAGAGTTTTAACAATTTGG - Intergenic
986883085 5:12199566-12199588 AATACAGAGCTTAAACAATTTGG - Intergenic
987055574 5:14187779-14187801 AATACATTACTTTAATAATGAGG - Intronic
987887222 5:23828369-23828391 GATCCAGTGCTTTTATAAAGGGG - Intergenic
988393970 5:30673474-30673496 ATTCAAGTACTTTTACAATGTGG - Intergenic
991210117 5:64094613-64094635 TATCCAGTGCTTTAACCAGCTGG + Intergenic
995669089 5:114580000-114580022 AATTCAGTGTTATCACAATGGGG - Intergenic
997607999 5:135190632-135190654 AATCAAATGATTTTACAATGTGG - Intronic
997909793 5:137859756-137859778 ATTTCAGTTATTTAACAATGAGG - Intergenic
1001510730 5:172319617-172319639 AATCCAGTGATTTTAAAGTGTGG + Intergenic
1001796799 5:174509035-174509057 AATCCAGTGCTAAGACAATAGGG - Intergenic
1004014743 6:11721773-11721795 GATGCAGTACTTAAACAATGAGG + Intronic
1005673971 6:28135524-28135546 AATCCAGTGCTTTCAACACGTGG - Intergenic
1007291375 6:40789704-40789726 AATCCAGTCCTTTACCAAGAGGG + Intergenic
1008764948 6:54900697-54900719 AATCCAGTGCTTGACCTAGGAGG + Intronic
1008917354 6:56802827-56802849 TATCCAGTGCTTTATGAATGGGG - Intronic
1009745507 6:67808481-67808503 AATCCAGTTATTAAACACTGTGG - Intergenic
1010097609 6:72064564-72064586 AATGCAATGCTGTGACAATGTGG + Intronic
1011369211 6:86614676-86614698 AGCCCAGTGCTTTACCAAAGCGG + Intergenic
1015059833 6:128949690-128949712 CATTCAGTGATTTAAAAATGGGG + Intronic
1016735578 6:147475843-147475865 AAGCCAGTGCTTTGATGATGTGG - Intergenic
1017045002 6:150338679-150338701 AATCTAGTGCTTTTACCAAGGGG + Intergenic
1018471132 6:164099386-164099408 TATTCAGAGCTTTAAAAATGGGG - Intergenic
1022583157 7:31577499-31577521 AATCCAGTGCTATCAACATGAGG - Intronic
1023136901 7:37061642-37061664 AATCAAGTCATTTAGCAATGGGG + Intronic
1029985413 7:104918327-104918349 AATCCAGTGCTTAAATAATGTGG - Intergenic
1030582198 7:111371664-111371686 AATGCAATGCCTTAACATTGTGG - Intronic
1031269556 7:119630507-119630529 GATCTAATGCTTTAAAAATGTGG + Intergenic
1032519749 7:132534961-132534983 AATCCAGTGTTTTAAAAACTAGG + Intronic
1035611802 8:971529-971551 AATCCAGCACTTTGACAATGTGG - Intergenic
1037929173 8:22867463-22867485 AATCTAGTGCTTTAATAAGCTGG - Intronic
1039864479 8:41489631-41489653 AATCCACTGCTTTAAATGTGTGG + Intergenic
1042008367 8:64209139-64209161 AATCCTGTTCTTTACCAAAGGGG + Intergenic
1047431483 8:124797120-124797142 AAGCCAGGTCTTAAACAATGAGG - Intergenic
1047998052 8:130355653-130355675 AATTCAGTTCTTTAAAAATATGG - Intronic
1048398787 8:134043255-134043277 AACCCCCTGCTTTAATAATGTGG + Intergenic
1050900268 9:10939244-10939266 AATACATTGCATTAAAAATGAGG - Intergenic
1051521655 9:17996008-17996030 AAGCAAGTGCTTTATAAATGTGG + Intergenic
1055719656 9:79157612-79157634 AATCCATTACTTTAAAAATTAGG + Intergenic
1058772783 9:108253698-108253720 AATCCAGTGAATTATCAATAAGG + Intergenic
1059395459 9:114031616-114031638 AATCTAATGTTTTAAAAATGGGG + Intronic
1059816682 9:117924314-117924336 ATTACAGTGCTTTAAAAGTGTGG - Intergenic
1059927412 9:119224508-119224530 AATCCAGTGTTTTAATATTAGGG + Intronic
1060577266 9:124708096-124708118 TAGCCAGGGCTTTAACAAGGAGG - Intronic
1061133916 9:128722795-128722817 GATCCATTTCTTTAGCAATGAGG - Intronic
1188603335 X:31996576-31996598 AATTCAGTGCTAAAAAAATGTGG - Intronic
1189131632 X:38504343-38504365 AATCCAGTCCTTCAGTAATGAGG + Intronic
1191690468 X:63933468-63933490 TATCAAATTCTTTAACAATGTGG - Intergenic
1194912244 X:99660561-99660583 AGTCCACTGCTTAAACAAGGTGG - Intergenic
1197107822 X:122736686-122736708 TATTCAGTGCTTTAATAAGGTGG - Intergenic
1197660395 X:129164855-129164877 AATGCAGTGTTTCAAAAATGTGG - Intergenic
1197739654 X:129880085-129880107 AATCCAGTTCTTCAACAGAGTGG - Intergenic
1199138211 X:144278465-144278487 AATCCAGTGATTTAACTGAGAGG + Intergenic
1201546431 Y:15168558-15168580 AAACCTGTGGTTTAACAATTTGG + Intergenic