ID: 1130039810

View in Genome Browser
Species Human (GRCh38)
Location 15:80396999-80397021
Sequence GCAAACGTGTTAGCTTTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130039804_1130039810 26 Left 1130039804 15:80396950-80396972 CCAGAGAAGAAGGGTTAACGATT 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1130039810 15:80396999-80397021 GCAAACGTGTTAGCTTTTGCAGG 0: 1
1: 0
2: 0
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130039810 Original CRISPR GCAAACGTGTTAGCTTTTGC AGG Intronic
912542793 1:110429778-110429800 GCACATCTGTTAGCTTTTCCAGG + Intergenic
913457991 1:119053329-119053351 GTAAACATGTTAGACTTTGCAGG - Intronic
915520692 1:156440851-156440873 GCAACCGTCTTATCCTTTGCAGG + Intergenic
922075748 1:222242554-222242576 GAAAACGTTTTAGGTTTTGTGGG - Intergenic
1064689244 10:17896945-17896967 GCAAATATTTTAGGTTTTGCAGG + Intronic
1066341036 10:34534031-34534053 GCCAACGGGTTAACTTTTGGAGG + Intronic
1069536847 10:69260026-69260048 GTAAATGTTTTAGGTTTTGCAGG + Intronic
1069974284 10:72199684-72199706 GCAGGCGTGTTAGCTCATGCCGG - Intronic
1085607428 11:77914611-77914633 GTAAATATGTTAGCTTTTACAGG + Intronic
1088437107 11:109826529-109826551 GCACACGTGTGTGGTTTTGCAGG + Intergenic
1089548993 11:119255708-119255730 GTAAAAGAGTTTGCTTTTGCAGG + Intronic
1093886333 12:24465860-24465882 GCAATAGTGTTAGATATTGCAGG - Intergenic
1095766011 12:45896522-45896544 GCAAACAAGAGAGCTTTTGCAGG - Intronic
1096386624 12:51198775-51198797 GAAATCTTGTTTGCTTTTGCAGG - Intronic
1097932862 12:65209014-65209036 GCAAAAGTGTTCAATTTTGCAGG - Intronic
1099771287 12:87061192-87061214 GTAAACGTGTCAACTTTTTCAGG - Intergenic
1105398315 13:20062583-20062605 GCATACCTATTAGCTTTTGAAGG + Intronic
1108513589 13:51176351-51176373 GCAAAATTATTAGCTTTTGAAGG - Intergenic
1110018911 13:70443685-70443707 ACAAATGTGTTAGCATTTGATGG - Intergenic
1114255437 14:20997746-20997768 GCCAACATGTTAGCTCTTTCTGG + Intergenic
1115389181 14:32835118-32835140 GTAAATGTTTTAGGTTTTGCAGG - Exonic
1118304750 14:64646394-64646416 GCAAATATTTTAGCTTTTGAGGG - Intergenic
1118913759 14:70083449-70083471 GCAAACGTCTTAAGTTTTGGAGG + Intronic
1120594773 14:86419974-86419996 GCAAATATTTTAGGTTTTGCTGG + Intergenic
1127395735 15:58542588-58542610 GCACACGTGTCAGGATTTGCCGG + Exonic
1130039810 15:80396999-80397021 GCAAACGTGTTAGCTTTTGCAGG + Intronic
1133480439 16:6165507-6165529 GCAAACGTGTTATCTTTATTAGG - Intronic
1133525903 16:6605317-6605339 CCCAACATGTTAGCTTTTACAGG + Intronic
1141384285 16:83605128-83605150 GAAAATGTGTGTGCTTTTGCTGG - Intronic
1148095548 17:45050683-45050705 TTAAACGTGTTTGTTTTTGCAGG - Intronic
1151127238 17:71858054-71858076 GCAAACAAGTTAGCGTTTTCTGG + Intergenic
1153141296 18:1975325-1975347 GCAAACATTTTAGGCTTTGCAGG + Intergenic
1153655809 18:7281120-7281142 GCAAACTTATTAGCTTTAGGTGG + Intergenic
1156295151 18:35782734-35782756 GCAACCGAGTCAGCTTTGGCTGG - Intergenic
1160053258 18:75456001-75456023 GGAAAAGTGTTTGCTTTTGTGGG + Intergenic
1161135849 19:2619373-2619395 GCAAATGTTTTAGCCTTTGCAGG - Intronic
1167223440 19:48219268-48219290 ACAAACGTCTTAGATTTTGAGGG + Intronic
931070753 2:58646592-58646614 GAAATCCTGTTTGCTTTTGCTGG + Intergenic
933719428 2:85388279-85388301 GCAAACAAGATAGTTTTTGCTGG - Intronic
936255526 2:110907465-110907487 GGAAACCTCTCAGCTTTTGCTGG - Intronic
937477339 2:122227333-122227355 GTAAACGTGGGAGCTATTGCGGG + Intergenic
943035530 2:182740933-182740955 GCAAAGTTGTCAGCTTTTTCAGG - Intronic
944223857 2:197329824-197329846 GCAAATATTTTAGATTTTGCAGG + Intergenic
946580617 2:221124739-221124761 GCAAAAGTTTTAGCATTTACCGG + Intergenic
947060677 2:226161522-226161544 GTAAACATGTTAGGCTTTGCAGG - Intergenic
1168924471 20:1567774-1567796 ACTAAGGTGTTAGCTGTTGCTGG + Intronic
1169792302 20:9424477-9424499 GCAAACATGTTAACTTTTTATGG + Intronic
1173289020 20:41698184-41698206 CCAAATGTGTAAGCCTTTGCTGG - Intergenic
1174712745 20:52724697-52724719 GCAAATGTTTTAGATTTTGTGGG + Intergenic
1175117160 20:56690766-56690788 GCAAACGTGTGAGCTTATGTGGG - Intergenic
1175706058 20:61177781-61177803 GTAAATGTGTTAGGTTTTGTTGG + Intergenic
1181868546 22:25879245-25879267 GTAAATGTTTTAGCTTTCGCAGG - Intronic
1183017488 22:35001200-35001222 GTAAACATTTTAGGTTTTGCAGG - Intergenic
1185145380 22:49132168-49132190 GCACATGTGTTTGCTCTTGCTGG + Intergenic
951992436 3:28690348-28690370 GCAAATATGTTAGGTTTTGCTGG - Intergenic
959491459 3:106994135-106994157 ACAAACTTTTTAGCTTTTCCTGG - Intergenic
966455818 3:180114849-180114871 GCAATCGTGTCAGCTACTGCAGG - Intergenic
974034746 4:56808054-56808076 GCAAATGTGTTTGCCTTTGTGGG + Intergenic
975786439 4:77893770-77893792 GCAAAAGTTTCAGCTTTTGTAGG + Intronic
979631940 4:122912779-122912801 GCAGAAGTGTTAGATTTTTCTGG + Intronic
982136773 4:152279837-152279859 TCAGACGTGTCAGCTTTTACTGG + Intergenic
982252565 4:153421843-153421865 GCAAACATTTTAGGCTTTGCAGG - Intergenic
982611719 4:157582620-157582642 TCAAACGAGTTATATTTTGCTGG - Intergenic
985186145 4:187318027-187318049 GCACACGTGTTAGCTTCTGGGGG - Intergenic
987088633 5:14491351-14491373 CCAAAGGTGCTAGCTTCTGCTGG - Intronic
988988734 5:36648394-36648416 GCAAAAATGGTAGATTTTGCAGG - Intronic
998774562 5:145584782-145584804 GCAAACTTGATAGCATCTGCTGG - Intronic
999587743 5:153109660-153109682 GCAATCGTTTTAGTTTTTACAGG - Intergenic
1001164711 5:169353309-169353331 GCAAACAGGCTTGCTTTTGCAGG + Intergenic
1004553989 6:16677616-16677638 ACAAATGTGTCAGCTTTTTCTGG - Intronic
1004989219 6:21117889-21117911 ACACACGTGTTAGCCTTTGATGG - Intronic
1007479268 6:42139439-42139461 GTAAATATGTTAGCCTTTGCAGG + Intronic
1017644531 6:156526826-156526848 GCAAATGTGTTAGCTTCTTAAGG + Intergenic
1018717497 6:166544757-166544779 GCAAATGTGTCTGCTTTTGCTGG + Intronic
1028713243 7:93935171-93935193 GCAAACATTTTAGCCTTTGCAGG + Intergenic
1031669464 7:124525138-124525160 GCACACGTGTTTGCTGTGGCAGG + Intergenic
1032447573 7:131997761-131997783 GCAAATATTTTAGCTTTTGTGGG + Intergenic
1034338052 7:150336014-150336036 GCAAAAGAGCTAGCTTTGGCGGG + Intronic
1040064713 8:43136440-43136462 GCAAACTTTTTGACTTTTGCTGG + Intergenic
1041259730 8:56010592-56010614 TCCAACCTGTTAGATTTTGCAGG + Intronic
1041437124 8:57854499-57854521 CCAAACGTTTTTGCTTTTGTGGG + Intergenic
1042384322 8:68155095-68155117 GCAATTGTGTTTTCTTTTGCAGG + Intronic
1042433099 8:68731232-68731254 GCAAATGTGTAAGCTTCTGTAGG - Intronic
1042970546 8:74403556-74403578 CTTAACGTTTTAGCTTTTGCTGG + Intronic
1044741909 8:95336236-95336258 GCAAAGGTCTTAACTGTTGCAGG + Intergenic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1050842337 9:10168102-10168124 GGAAACATATTTGCTTTTGCAGG + Intronic
1055312972 9:75003508-75003530 GTAAATGTGTTAGGCTTTGCCGG - Intronic
1055817366 9:80222399-80222421 GTAAACATTTTAGATTTTGCGGG - Intergenic
1057206115 9:93173607-93173629 GCAGATGTGTTGGCTTTTGCAGG - Intergenic
1057314985 9:93962154-93962176 GCAAATGTTTTAGACTTTGCAGG + Intergenic
1058630836 9:106984835-106984857 GCAAATATTTTAGCCTTTGCAGG + Intronic
1059136082 9:111807824-111807846 GCAAATATTTTAGGTTTTGCAGG - Intergenic
1186680532 X:11868915-11868937 GCAAATGTTTTAGGTTTTGTGGG - Intergenic
1187100565 X:16187128-16187150 GTAAACATCTTAGCCTTTGCAGG + Intergenic
1189914174 X:45840307-45840329 CCAAAAGAGTTAGCTTTGGCTGG - Intergenic
1192987497 X:76415644-76415666 GCAGACGTGTTGGAGTTTGCCGG - Intergenic
1198225885 X:134645582-134645604 GCAAAACTGTAAGCTTTTGGAGG + Intronic