ID: 1130039827

View in Genome Browser
Species Human (GRCh38)
Location 15:80397250-80397272
Sequence AGCACATATCTCACTACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130039827_1130039831 -4 Left 1130039827 15:80397250-80397272 CCTTGTGTAGTGAGATATGTGCT 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1130039831 15:80397269-80397291 TGCTAGAACAAGGGGAAAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 203
1130039827_1130039833 16 Left 1130039827 15:80397250-80397272 CCTTGTGTAGTGAGATATGTGCT 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1130039833 15:80397289-80397311 AGGAATTTGGAAGTACATGTCGG 0: 1
1: 0
2: 3
3: 25
4: 246
1130039827_1130039832 3 Left 1130039827 15:80397250-80397272 CCTTGTGTAGTGAGATATGTGCT 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1130039832 15:80397276-80397298 ACAAGGGGAAAGCAGGAATTTGG 0: 1
1: 0
2: 1
3: 31
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130039827 Original CRISPR AGCACATATCTCACTACACA AGG (reversed) Intronic
905386912 1:37611438-37611460 AACACATATATAACTACAAAAGG - Intronic
906547950 1:46635357-46635379 AGCCCATATCTAACTACAGCAGG + Exonic
907415243 1:54309953-54309975 AGCACAAATCTCAAAACAAAAGG + Intronic
912413320 1:109492284-109492306 AGCACATAGCACACTACACCAGG - Intronic
915033808 1:152906080-152906102 AGCTCATATCCCATGACACATGG - Intergenic
917961429 1:180148638-180148660 TGCACATTTCTCAAAACACATGG + Intergenic
919476686 1:198038951-198038973 AGAGCTTTTCTCACTACACAAGG + Intergenic
920843674 1:209575930-209575952 AGCTGAGATCTCACTATACATGG + Intergenic
921518907 1:216134322-216134344 AGAATATATCCCAATACACATGG + Intronic
924762158 1:246998056-246998078 AACACATCTGTCACTTCACATGG - Intronic
1063010138 10:2013701-2013723 AGTTCATATCTCACTAAATAAGG + Intergenic
1064240959 10:13628102-13628124 AGCAAATACCTGATTACACAGGG + Intronic
1064795009 10:19001760-19001782 AGCACATATCCCATTGCACATGG + Intergenic
1065445058 10:25789591-25789613 AGCACGTAGCTCATTGCACATGG - Intergenic
1066230937 10:33432556-33432578 AGGAGATATTACACTACACAGGG + Intergenic
1078350048 11:10585702-10585724 GGCACATATCAGACTGCACAGGG - Intronic
1080967276 11:37227392-37227414 AACAAACATCTCACAACACATGG - Intergenic
1085834866 11:79942331-79942353 AGCACATGTCTCTGAACACATGG + Intergenic
1085893213 11:80605769-80605791 AGCACATATTTTAATACCCAAGG + Intergenic
1087798762 11:102481691-102481713 AGCACTTATCTCCCTTCAGATGG + Intronic
1088403452 11:109445971-109445993 ACCCCCTATCTCACCACACATGG - Intergenic
1090661019 11:128881476-128881498 AGCACATCTCTCCCTACAGGGGG - Intergenic
1092380660 12:7994207-7994229 AGCACATTTTTCTTTACACAGGG + Intergenic
1097227849 12:57489197-57489219 AGCCCATTTCTCATCACACAGGG - Intronic
1099437571 12:82661931-82661953 AGCACATATCTCACCTCAGGAGG - Intergenic
1102665605 12:114570037-114570059 AGCACATTGCTGAGTACACAGGG + Intergenic
1111210167 13:85067847-85067869 AGGACATATATAACAACACATGG - Intergenic
1114934165 14:27512941-27512963 GGCACATATATACCTACACATGG - Intergenic
1114934168 14:27512973-27512995 GGCACATATATACCTACACATGG - Intergenic
1114934174 14:27513037-27513059 GGCACATATATACCTACACATGG - Intergenic
1114934180 14:27513101-27513123 GGCACATATATACCTACACATGG - Intergenic
1115315189 14:32017636-32017658 AGCCCAAATCTTACTCCACAGGG - Intronic
1120662554 14:87267730-87267752 AGCTCATATTTCATTTCACAAGG - Intergenic
1124184366 15:27510451-27510473 AGCAAATGTCTCAGTACACAGGG - Intronic
1124913953 15:33950368-33950390 AACACACCTTTCACTACACATGG - Intronic
1125783840 15:42297132-42297154 AGAACATAGCTCCCTACACTCGG - Intronic
1125803560 15:42472580-42472602 AGCACATCTCTCATCCCACACGG + Intronic
1126455368 15:48855731-48855753 ATCTCATATCTCACTTCACTGGG - Intronic
1130039827 15:80397250-80397272 AGCACATATCTCACTACACAAGG - Intronic
1133095061 16:3438835-3438857 AGCAAATATATCAATACAAAAGG + Intronic
1133143623 16:3767198-3767220 CCCCCATGTCTCACTACACAGGG + Intronic
1137006785 16:35283492-35283514 AACACATATCACACTCCTCAGGG - Intergenic
1146926161 17:36747254-36747276 GGCACATACCTCACACCACATGG + Intergenic
1148621862 17:49040709-49040731 AGCACATATATTAGTACATATGG + Intronic
1150131193 17:62670143-62670165 AGCCCATATCTCTCTGCACGAGG + Intronic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1158796720 18:60855282-60855304 AGGACATTTCACACAACACATGG - Intergenic
1159303474 18:66608762-66608784 ACCACTTATTTGACTACACATGG + Intergenic
1160111031 18:76031294-76031316 ATCTCATATTTCAATACACAAGG + Intergenic
1165019411 19:32911364-32911386 AGCACATGTCTGGCCACACATGG + Intronic
1167202352 19:48074741-48074763 GACACTTATCACACTACACATGG + Intronic
926424825 2:12731277-12731299 AGCACAGCCCTCCCTACACACGG - Intronic
929406120 2:41643389-41643411 AGCAAATATCTCACGTCATAAGG + Intergenic
931082803 2:58794511-58794533 AGCACAAAATTGACTACACACGG - Intergenic
933375795 2:81478370-81478392 AGCACACATCTTTCTTCACATGG + Intergenic
941234641 2:162955599-162955621 AGCACATATCTCAAAATAGATGG - Intergenic
941496544 2:166211451-166211473 AGCACAAATCTCACTAGTAAAGG + Intronic
943570758 2:189571890-189571912 TGTACATATGTCACTAAACAAGG + Intronic
943596132 2:189859155-189859177 AACACAAATCTCACAACAAAGGG - Intronic
943944570 2:194043292-194043314 ATCTCATTTCTCAATACACAGGG - Intergenic
944652206 2:201842326-201842348 AGCATTTATTTCAGTACACAAGG + Intronic
946489718 2:220136126-220136148 AACACATGACTCACCACACAAGG - Intergenic
946871435 2:224089133-224089155 AGAAGTTTTCTCACTACACAAGG - Intergenic
1169959305 20:11141245-11141267 AGTATAAATTTCACTACACAAGG - Intergenic
1170425423 20:16230542-16230564 AGCACATAGTACATTACACAGGG - Intergenic
1172404577 20:34678125-34678147 AGCACATTTTTCAGCACACAAGG - Intergenic
1173114225 20:40224908-40224930 AGCACATAGCAGACTACACTTGG + Intergenic
1174567767 20:51479197-51479219 AGCAAATAACTAACTAAACAAGG - Intronic
1174906902 20:54561352-54561374 GGAACATATCTCTCTGCACAGGG - Intronic
1175318168 20:58066543-58066565 AGCACGGAGCTCATTACACATGG + Intergenic
1178551659 21:33544552-33544574 ATCACATATCACACAATACATGG - Intronic
1179382241 21:40910594-40910616 ACCACATGTGTCCCTACACACGG - Intergenic
952421183 3:33132578-33132600 AGCAGATAGCTGACTGCACAGGG - Exonic
957403827 3:79751188-79751210 ATCCTATATCTCAATACACAAGG + Intronic
967119813 3:186372991-186373013 TGGACATATCTCCCCACACAAGG - Intergenic
968293137 3:197554615-197554637 AGCACATATTTCACTATGGAGGG - Exonic
969102863 4:4782836-4782858 AGCACATATCTCCTAGCACAAGG - Intergenic
970290668 4:14568316-14568338 AGCACATATCTCTGTTCATAAGG + Intergenic
970559882 4:17272246-17272268 AGCACATGCCACACTACACGTGG - Intergenic
971139503 4:23908813-23908835 ATCACAAAGCTCTCTACACATGG + Intergenic
972325080 4:38007654-38007676 AGCACATAAATGACTAAACAGGG - Intronic
976232073 4:82854889-82854911 AGCACATCTCTTACCACAAAGGG + Exonic
976967935 4:91067804-91067826 AGCAGATAACTCATTACAAAAGG - Intronic
978859995 4:113437476-113437498 AGCACATTTCAGACTAAACATGG - Intergenic
981642570 4:146962261-146962283 AGCTCAAATATCACTTCACATGG - Intergenic
988292703 5:29310149-29310171 AGCACAAATATCACAACACAGGG - Intergenic
990184096 5:53194396-53194418 AGCACATATGTCAGGGCACAAGG + Intergenic
992248327 5:74851855-74851877 ACCACGTATCTGACTATACAGGG + Intronic
993191212 5:84684282-84684304 AGGACATATATCCATACACATGG + Intergenic
995936188 5:117518241-117518263 ACCACATATTTCTTTACACAAGG - Intergenic
997713198 5:136023331-136023353 AGCACAGTGCTCACTACACGGGG + Intergenic
1000139017 5:158383132-158383154 AGCACATATAACAGTACTCAGGG + Intergenic
1002480082 5:179495030-179495052 ACCACCTACCACACTACACAAGG - Intergenic
1003359658 6:5412522-5412544 AGGACATCACTCACAACACAGGG - Intronic
1003421559 6:5963029-5963051 AGTACATTTCTCACACCACAAGG + Intergenic
1003556516 6:7144559-7144581 AGCACCTATATAATTACACAGGG - Intronic
1009628304 6:66164417-66164439 AGCCCATATATCACTTCATAAGG + Intergenic
1010666319 6:78634248-78634270 AACACATTTCTCAGTACACATGG + Intergenic
1012188992 6:96257977-96257999 AGGACATAATTCACTACACATGG + Intergenic
1014279780 6:119428946-119428968 AGAACATAGCTCACTGCAAAAGG - Intergenic
1016676299 6:146773068-146773090 TGCACATAGCTCACTATTCAAGG + Intronic
1016851309 6:148621929-148621951 AGAACATGGCTCACTACTCAGGG - Intergenic
1017865195 6:158436971-158436993 AGCACACAACAGACTACACAGGG - Intronic
1020715006 7:11662798-11662820 AGCACACATCTAAACACACATGG + Intronic
1021902524 7:25300764-25300786 AGCACGCTTCTCACTACACATGG - Intergenic
1023248800 7:38235521-38235543 ATCTCAGAGCTCACTACACACGG - Intergenic
1030402666 7:109071524-109071546 AACACTTATCTCTCTACACTTGG - Intergenic
1031072035 7:117172447-117172469 AGCATATATCTTGTTACACAGGG - Intronic
1034460019 7:151192993-151193015 TGCACATATCTCACACCTCAGGG + Intronic
1038110667 8:24493469-24493491 AGCAGATATCTAATTAGACATGG + Intronic
1038847798 8:31245849-31245871 AGTACATATGTCATTAGACAGGG - Intergenic
1044220768 8:89666815-89666837 AGCACATATTTCATTTCACTAGG - Intergenic
1044457806 8:92408968-92408990 AGCAGAAATCACACTAGACAAGG - Intergenic
1049646916 8:143739658-143739680 AGCACATACTCCACTGCACAGGG - Intergenic
1050273207 9:3968332-3968354 AGCACTTGTCTCAATACTCATGG + Intronic
1050290565 9:4149914-4149936 TGCATATATCTTACTACAAAAGG + Intronic
1050728778 9:8683622-8683644 TGCACATATCTCACGCCATAAGG + Intronic
1051051575 9:12939074-12939096 ACCTCATTTTTCACTACACAGGG - Intergenic
1052091098 9:24328894-24328916 AGCATATATCTTAATACAGAAGG + Intergenic
1052172413 9:25416552-25416574 AACACATATCACACAACTCATGG + Intergenic
1056771651 9:89481908-89481930 TGCAAATATCTCACTGCAGAAGG + Intronic
1059920447 9:119154556-119154578 AACACATATCTCTCTCCACCTGG + Intronic
1186120586 X:6357014-6357036 TGGACATATTTCACTATACAGGG - Intergenic
1186941698 X:14515814-14515836 AACACAAATCTCAAGACACATGG - Intergenic
1188670433 X:32875453-32875475 AAAACATATCTCCCTACAGAAGG - Intronic
1196648446 X:118144011-118144033 AGCACTTATCTCACTATAGTGGG - Intergenic
1197294429 X:124700769-124700791 TGCAAATACCTCACTATACAGGG - Intronic
1199268216 X:145851959-145851981 AGCCCAAATCCCACAACACAAGG + Intergenic