ID: 1130040239

View in Genome Browser
Species Human (GRCh38)
Location 15:80400375-80400397
Sequence ATAGAGAAGAAGGCAGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 879
Summary {0: 1, 1: 0, 2: 3, 3: 83, 4: 792}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130040230_1130040239 29 Left 1130040230 15:80400323-80400345 CCACATTTGATCTGTTATAAGTC 0: 1
1: 0
2: 0
3: 14
4: 161
Right 1130040239 15:80400375-80400397 ATAGAGAAGAAGGCAGGGGTGGG 0: 1
1: 0
2: 3
3: 83
4: 792
1130040233_1130040239 7 Left 1130040233 15:80400345-80400367 CCATGATTCTTGGTGTAAAGGAG 0: 1
1: 0
2: 1
3: 7
4: 110
Right 1130040239 15:80400375-80400397 ATAGAGAAGAAGGCAGGGGTGGG 0: 1
1: 0
2: 3
3: 83
4: 792

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130040239 Original CRISPR ATAGAGAAGAAGGCAGGGGT GGG Intronic
900323389 1:2095823-2095845 AAAGAGGAGAAGGGAGGGGAAGG - Intronic
900439369 1:2645705-2645727 ACAGAGAAGCAGGAAGGGGCAGG - Intronic
900625691 1:3607573-3607595 ATGGAGAAGGTGGCAGGGGAAGG + Intronic
900880439 1:5377652-5377674 TAAGAGAAGAGGGCACGGGTGGG - Intergenic
901078668 1:6571378-6571400 AAAGAGAGGAAGGCTGGGGCAGG - Intronic
901505267 1:9681156-9681178 AGAGAGAAGAGGGGAGGGGAGGG + Intronic
901637921 1:10679010-10679032 AGAGAGCGGAAGCCAGGGGTGGG - Intronic
901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG + Intergenic
902115230 1:14115704-14115726 ATTGAGTAACAGGCAGGGGTTGG + Intergenic
903018294 1:20376049-20376071 AAAGAGAAGAAAGCAAGGGAGGG - Intergenic
903562108 1:24236052-24236074 ATTGAGGAGAAGGGAGGAGTGGG - Intergenic
903676400 1:25067300-25067322 ATAGAGAAGCTGGCAAGAGTAGG + Intergenic
903704270 1:25273515-25273537 AGTGAGAAGAAAGCTGGGGTCGG - Intronic
903722969 1:25419802-25419824 AGTGAGAAGAAAGCTGGGGTCGG + Intronic
903802299 1:25978269-25978291 ATATAGAAAAAGACAGGGGTAGG - Intronic
904045101 1:27603959-27603981 AGAGAGCAGAAGGCAGGAGGAGG - Intronic
904076522 1:27846999-27847021 AAAGAGAAGAGGGCAGGGTTGGG - Intronic
904284941 1:29448025-29448047 ATATAGAAGAGGGCACGGGGTGG + Intergenic
904386918 1:30148920-30148942 TGAGAGATGCAGGCAGGGGTGGG - Intergenic
904477182 1:30772939-30772961 ACAGAGGAGAAAGCTGGGGTTGG + Intergenic
904771006 1:32881448-32881470 CTTGGGAAGAAGGCAGGTGTGGG + Intergenic
904890509 1:33776163-33776185 CTAGAGAAGAATGAAGGGGTGGG + Intronic
905281868 1:36854465-36854487 AGAGAGAGGAAGGCAGAGGTTGG + Intronic
905420735 1:37841737-37841759 AAAAAGAAGAAGGCAGGGTGCGG + Intronic
905535973 1:38722135-38722157 AAAGAGAAGAAGGGAGAGGAAGG + Intergenic
905867958 1:41386541-41386563 AGAGAGAAGACGGGAGGGGAAGG - Intergenic
905951011 1:41950567-41950589 ATAGAGGGGAAGGCATGGATGGG - Intronic
905985604 1:42278351-42278373 ATAGAGAGGCTGGCAGTGGTTGG - Exonic
906294094 1:44638385-44638407 AGAGAGAAGGAGGCAGAGGCAGG + Intronic
906351012 1:45059512-45059534 ATAGAGGACAAGGGAGGGATAGG + Intronic
906468988 1:46111380-46111402 AGAGGTAAGAAGGCAGCGGTGGG - Intronic
906741523 1:48189716-48189738 ACAGAGAGGAAGGCAAGGTTAGG - Intergenic
906945807 1:50293199-50293221 AAAGAAAAGAAGGCAGAGGAAGG + Intergenic
907690548 1:56660453-56660475 TTAGAGAGTAAGGCTGGGGTAGG - Intronic
907821467 1:57974033-57974055 AAGGACAAGGAGGCAGGGGTGGG - Intronic
908135287 1:61125924-61125946 AAAGTGAGGAAGGTAGGGGTGGG + Intronic
909433111 1:75612804-75612826 ATATTGGAAAAGGCAGGGGTGGG + Intergenic
911031737 1:93496237-93496259 AAAGAGGAGAAGGAAGGGGGAGG - Intronic
911095296 1:94049943-94049965 CCAGAGAGGAAGGCAGGGGCAGG + Intronic
911693481 1:100861884-100861906 ATAGAGAAGGAGAGAGGGCTGGG - Intergenic
911718690 1:101166202-101166224 ATAGAGAAGAGGCCAGAGGATGG - Intergenic
912511383 1:110192461-110192483 CCAGGTAAGAAGGCAGGGGTGGG - Intronic
912549736 1:110477605-110477627 TTAGGGAGGAAGGCAGGGATAGG - Intergenic
912788219 1:112624769-112624791 ATAGAGAAGTAGGGAGGAATTGG + Intronic
912795166 1:112688945-112688967 ATGGAGGAGAAGCCAGGGGCGGG - Exonic
912812210 1:112803011-112803033 ACAAAGAAGCAGGCAGGGGCAGG - Intergenic
912926813 1:113920324-113920346 ACAGAGAGGGAGGCAGGTGTTGG + Intergenic
914049042 1:144116127-144116149 ATAGAGTAGGAAGCAGGGGCGGG - Intergenic
914130142 1:144849318-144849340 ATAGAGTAGGAAGCAGGGGCGGG + Intergenic
914730300 1:150364095-150364117 GTTGAGAAGGAAGCAGGGGTAGG + Intronic
914874544 1:151502978-151503000 ATAAAGAAGGAGGCAGGAATGGG + Intergenic
915355954 1:155255273-155255295 CTAGAGAAGAGGGGAGGGGTCGG + Exonic
915515935 1:156412781-156412803 AGAAAGAAAGAGGCAGGGGTAGG - Intronic
915555741 1:156659834-156659856 CCAGAGAGGAAGGCAGAGGTTGG + Intergenic
915691944 1:157698643-157698665 AGAAAGATGAAGGCAGGGGAAGG + Intronic
915769336 1:158403249-158403271 TAAGAGATGAAGGCAGGGGTTGG + Intergenic
916500805 1:165385084-165385106 AGAGAAAAAAAGGGAGGGGTGGG - Intergenic
916908643 1:169318868-169318890 ATAGAGATGGAAGCAGCGGTGGG + Intronic
917390974 1:174536372-174536394 AGATAGAAGAAGGGAGGGTTGGG + Intronic
917967813 1:180189451-180189473 ATGCAGAAGAAGGCGGGGGGCGG - Intronic
918011432 1:180590561-180590583 ATAGAGAGGTAGGCAGGGGCTGG + Intergenic
918147965 1:181774546-181774568 ATGGAGCAGAAAGCAGGAGTAGG - Intronic
918561986 1:185880008-185880030 ATTGTGAAGCAGGCAGGAGTGGG + Intronic
918815959 1:189183536-189183558 ATAGACAAGAGGGGAGGGGTAGG - Intergenic
919753885 1:201054571-201054593 AAAGAGACGAAGGGAGGGGAAGG + Intronic
919883360 1:201915486-201915508 ATAGGGAATAGTGCAGGGGTCGG - Intronic
920214359 1:204351353-204351375 GTAGAGAAGGTGGGAGGGGTCGG - Intronic
920261499 1:204691158-204691180 ATAAAGCAGAAGGGAGGTGTGGG - Intergenic
920514895 1:206577655-206577677 ATAGAGGACAAGACAGGCGTGGG + Intronic
920570908 1:207016565-207016587 ATTGGGAAGGAGGCAGGTGTGGG + Intronic
920656736 1:207882165-207882187 AGAGAGAAGAAGGCAGAATTGGG + Intergenic
920743182 1:208600580-208600602 TTAGACAGGGAGGCAGGGGTAGG + Intergenic
921425023 1:214991574-214991596 ATAAAGAAGGAGGTATGGGTTGG - Intergenic
921687725 1:218109254-218109276 AAAGAGTTGAAGGCAGGGGATGG - Intergenic
922324951 1:224519260-224519282 ATAGAACAGAAGGCAGAGGAAGG + Intronic
922438426 1:225629283-225629305 AAAGAAAAGAAGGCAGGGAAAGG + Intronic
922982222 1:229836772-229836794 AGAGAGAAGATGGCAAGGATAGG + Intergenic
923110902 1:230889240-230889262 AAAGAGCAGAAGCCAGGGGAAGG + Intergenic
923274458 1:232384464-232384486 AGAGAGAAGAAGGGAGAGGGAGG - Intergenic
923458127 1:234183836-234183858 GGAGAGAGGAAGACAGGGGTAGG - Intronic
923557330 1:235011312-235011334 AGAGAGGAAAAGGCAGGGGCGGG - Intergenic
923779973 1:237013438-237013460 ATTGTGAAGAACTCAGGGGTAGG + Intergenic
924098936 1:240583890-240583912 ATAGAGATGAAGGCTGGGCGCGG - Intronic
924200117 1:241649882-241649904 ATAAAGAAGAAGGCAAGGTGAGG - Intronic
924453882 1:244202331-244202353 ATAGGGAAGAAGGGAAGGGAAGG + Intergenic
924466746 1:244305193-244305215 ACAGAGATGAAGGCAAGGTTAGG + Intergenic
1062777279 10:162946-162968 ACACAGAAGAAGGCAGGGAACGG - Intronic
1063057052 10:2517056-2517078 ATAAGGAAGGAGGCAGGGGCAGG - Intergenic
1063510703 10:6642737-6642759 ATACAGAGCAAGGCAGGGGCAGG - Intergenic
1063659277 10:8022465-8022487 ATGGAGAAAAGGCCAGGGGTAGG + Intergenic
1063719622 10:8566825-8566847 ATAATGATGAGGGCAGGGGTGGG + Intergenic
1064557926 10:16566380-16566402 AGAGAGAGAAAGGCGGGGGTGGG + Intergenic
1064941393 10:20739611-20739633 ATAAAGGAGAAGGCAGAGTTTGG - Intergenic
1065771281 10:29081161-29081183 ATAGAGAAGGAGAGAGGGCTGGG + Intergenic
1066588454 10:36964541-36964563 ATAGAAAGGAAGGGAGGGGAGGG + Intergenic
1067199501 10:44155221-44155243 ATAGAGAAGTCTGCAGGGCTTGG - Intergenic
1067794334 10:49309891-49309913 ACAGTGGAGATGGCAGGGGTTGG - Intronic
1067983535 10:51115547-51115569 ATAAAGAAGAAGGCTGGGTGTGG + Intronic
1069551441 10:69367159-69367181 ACAGAGAAGGAGCCAGAGGTGGG + Intronic
1069914225 10:71777544-71777566 AAGGAGAAGAAAGCAGGGGGTGG - Intronic
1069933018 10:71896111-71896133 ATAGAGATGAGGGCTGGGCTCGG + Intergenic
1070897347 10:79996111-79996133 GGAGATAAGAGGGCAGGGGTGGG + Intergenic
1070902931 10:80046718-80046740 ATGTAGAAGAAGGAAGGGGAAGG + Intergenic
1071533595 10:86408561-86408583 GTAGAGAGGGAGGCAGGGGTTGG + Intergenic
1071849804 10:89557312-89557334 ATAGAAAAAAAGGCTGAGGTGGG + Intergenic
1073767608 10:106700317-106700339 ATAAAGAAGAAAGCAGGCCTTGG - Intronic
1074225426 10:111479809-111479831 ATAAAGCAGGAGGCAGGGTTGGG - Intergenic
1074263872 10:111881738-111881760 ATAGAGAAGTGGGCTGGGGACGG + Intergenic
1074364365 10:112846019-112846041 AAAGAAAAGAAGACAGAGGTGGG + Intergenic
1074607633 10:114989448-114989470 ATAGAACAAAAGGCAGGGGAAGG + Intergenic
1075085607 10:119412518-119412540 AAAGGAAAGAAGGCAGGGTTTGG - Intronic
1075968588 10:126633555-126633577 ATAAAGAAAAAGCCAGGCGTGGG + Intronic
1076369809 10:129945083-129945105 AGAGAGGAGAAGGGAGGGGAGGG + Intronic
1076549468 10:131268523-131268545 ATAGAGGAGAAGTCAGTGATGGG - Intronic
1077695550 11:4389701-4389723 ACTGAGAAGAAAGCAGGAGTTGG - Exonic
1077775926 11:5271475-5271497 ATGGAGACGGAGGCAGAGGTGGG - Intronic
1077874670 11:6294098-6294120 CAAGAGAAGGAGGCAGGGGCAGG + Intergenic
1077890246 11:6413147-6413169 AGAGAGAAGTGGGCAGTGGTTGG - Intronic
1078381101 11:10841577-10841599 GGGGAGTAGAAGGCAGGGGTGGG - Intronic
1078734370 11:14006625-14006647 AGAGAGGAGAGGGCAGTGGTGGG - Intronic
1079375553 11:19888665-19888687 CTAGAGAAGAAAGCAGGGCAGGG - Intronic
1079523004 11:21351103-21351125 ATAAAGATGAAGGCAGAGATTGG + Intronic
1080111490 11:28572987-28573009 ATAAAGAAGGAGGTGGGGGTGGG + Intergenic
1080321389 11:31014234-31014256 AAAGAGAGGAAGGGAGGGGAGGG - Intronic
1081601959 11:44501460-44501482 ATGGACATGAAGGCTGGGGTAGG - Intergenic
1081718838 11:45271502-45271524 CTGGAGAGGAAGGCTGGGGTTGG + Intronic
1081737833 11:45416707-45416729 AGAGGGAGGAAGGCAGTGGTGGG - Intergenic
1082114571 11:48314418-48314440 GTAGAGAAGGAGACAGGGGTAGG - Intergenic
1082223911 11:49677728-49677750 AAAGAGAAGAGGGGAGGGGAGGG - Intergenic
1082557127 11:54575914-54575936 AAACAAAAAAAGGCAGGGGTGGG + Intergenic
1083273798 11:61585841-61585863 ACAGAGAAACAGGCAGAGGTAGG - Intergenic
1083904048 11:65658693-65658715 ATACATCAGGAGGCAGGGGTGGG - Intronic
1084005522 11:66321409-66321431 AAGGAGAGGAAGGGAGGGGTGGG + Intergenic
1084762492 11:71282956-71282978 GTGGAGAAGACAGCAGGGGTGGG + Intergenic
1084993631 11:72954081-72954103 ATAGACATAAAGGTAGGGGTGGG + Intronic
1085270425 11:75266840-75266862 AGACAGAAGAAGGCTGGGGTAGG + Intronic
1085401974 11:76240905-76240927 TTAGTGGAGAGGGCAGGGGTCGG + Intergenic
1085449556 11:76623707-76623729 AGAGACAAGCAGGCAGGGCTGGG + Intergenic
1085527794 11:77174156-77174178 AAAGAGTAGAAGGCAGGTGCTGG - Intronic
1086431450 11:86740611-86740633 TAAGAGAAGAAGGAAGGTGTGGG + Intergenic
1086660206 11:89406914-89406936 ACAGAGAAGAAGGCAGCTGAAGG + Intronic
1086927890 11:92660400-92660422 AAAGTGATGAAGGCTGGGGTAGG + Intronic
1087323177 11:96687385-96687407 ATAGATAAAGAGGCAGGGGAGGG - Intergenic
1087508115 11:99054442-99054464 ATAGAGAAGAGGGCAGACATAGG - Intronic
1087929587 11:103961476-103961498 ATAGGGAAGCAGGCAGGTGAAGG + Intronic
1088262443 11:107956890-107956912 ATATGGAAGAAGGCAAAGGTAGG + Intronic
1088275616 11:108082255-108082277 AGAGAGAAGAAGGAAGGGGAAGG - Intronic
1088278828 11:108116732-108116754 ACAGGGGAGAAGACAGGGGTTGG + Intergenic
1088380842 11:109191180-109191202 AAACAAAAAAAGGCAGGGGTTGG - Intergenic
1088423611 11:109675832-109675854 ATGGAGAAGAAGTCTGGGGAGGG + Intergenic
1088691895 11:112335514-112335536 AGAGAGAAGCAGACAGGAGTGGG - Intergenic
1088942456 11:114473946-114473968 ATGGAAGAGAAGGCTGGGGTGGG + Intergenic
1089532358 11:119138669-119138691 AGAGAGAAGAAGGTAGGAATGGG + Intergenic
1089944020 11:122448547-122448569 ATGGGGTAGAAGGCAGGGGGAGG + Intergenic
1090124084 11:124067637-124067659 ATAGAGAAGAAGGCAAAGCCAGG - Intergenic
1090818629 11:130320188-130320210 AGAGAGAAGAAGGCAGTGGCTGG - Intergenic
1091018080 11:132072329-132072351 GTAGGGAAGTAGGGAGGGGTAGG + Intronic
1091218778 11:133918815-133918837 AGAGAGAAGAGGGCGGGGGACGG + Intronic
1091543293 12:1482315-1482337 ACAGAAAGGAAGGCAGGGTTGGG - Intronic
1091838486 12:3602613-3602635 AAAGAGTAGAAGGATGGGGTGGG - Intergenic
1092027399 12:5253683-5253705 ATAGTGAAGAAGGCCGGGCGCGG - Intergenic
1092084449 12:5744174-5744196 ATAGAGAAGAAGACGGTGGCAGG + Exonic
1092547648 12:9466072-9466094 ACAGAGAAGAAGGCAGTGCAGGG - Intergenic
1092769490 12:11883942-11883964 AAAGATGAGAAGGCTGGGGTAGG - Intronic
1093063401 12:14630990-14631012 AATGAGGAGAAGGCAGGGCTAGG + Intronic
1093621923 12:21302045-21302067 TTAGAGAAGATAGAAGGGGTTGG - Intronic
1094252944 12:28387311-28387333 TTAGGCAAGAAGGCAGGTGTCGG - Intronic
1094322040 12:29194806-29194828 AAAGAGAAGATGGAAGGGTTAGG + Intronic
1094351926 12:29536320-29536342 ATAGATAATAATGAAGGGGTGGG + Intronic
1094505335 12:31056290-31056312 ACAGAGAAGAAGGCAGTGCAGGG + Intergenic
1094682399 12:32678236-32678258 ATAAATAAAAAAGCAGGGGTCGG - Intergenic
1095446726 12:42289399-42289421 ATAGAGAAGAAGGGGAGGGGAGG - Intronic
1095492051 12:42745142-42745164 CTAGAGACGAAGACAGGGCTGGG - Intergenic
1095631659 12:44384036-44384058 ATAGACAAGAACACAGGGGTTGG + Intronic
1095646105 12:44549371-44549393 ATAGGGAAGAGGGGAAGGGTGGG + Intronic
1096065858 12:48739659-48739681 AAAGAGAAGAGAGAAGGGGTGGG + Intergenic
1096866227 12:54565214-54565236 ATGAAGCAGAAGGCTGGGGTGGG + Intronic
1097041474 12:56158469-56158491 GGCGAGGAGAAGGCAGGGGTAGG + Intronic
1097044057 12:56173951-56173973 ACAGAGGAAAAGGCCGGGGTTGG - Intronic
1097096946 12:56557030-56557052 AGAGAGATGAAGGCTAGGGTAGG - Intronic
1097156369 12:57015138-57015160 AAAGAGAAGAAGGAAGGGGTTGG + Intronic
1097178572 12:57157854-57157876 GCAGAGAAGGAGGCAGGGGTTGG + Intronic
1097756044 12:63407710-63407732 AAGGAGCAGAAGGAAGGGGTTGG + Intergenic
1098140233 12:67443535-67443557 GTAGAGAAGAAGGCTGGGAATGG + Intergenic
1098558956 12:71851173-71851195 ATAGAGCAGGAGGAAGGGGGAGG + Intronic
1098907843 12:76180102-76180124 ATAGACAGAAAGGCTGGGGTGGG + Intergenic
1099201364 12:79681116-79681138 AAGGAGAAGAAGGGAGGGGAGGG + Intronic
1100307471 12:93364114-93364136 ATAGTGAAGGATGAAGGGGTGGG + Intergenic
1100368614 12:93944190-93944212 ATAGAGAAGCATGTAGGGCTGGG - Intergenic
1100473620 12:94915787-94915809 ATAGAGAGGAAGGGATGGATTGG - Intronic
1100878638 12:98992035-98992057 GTAGAGAATGGGGCAGGGGTAGG + Intronic
1101001379 12:100361509-100361531 ACAGAGAAGAGGGCAGGAGGAGG - Intronic
1101351687 12:103935641-103935663 TTAGTGACGAAGGCAGGGGAAGG - Intronic
1101774372 12:107780158-107780180 AAAGAGAAGAAAGCAGGGACAGG + Intergenic
1101885789 12:108660549-108660571 ATAGGGAAGAAGGCAGAGGAAGG - Intronic
1102071722 12:110025935-110025957 AGAGAGAAGAAGTTAGGGTTAGG - Intronic
1102239771 12:111317561-111317583 TGGGAGAGGAAGGCAGGGGTGGG - Intronic
1102613137 12:114130170-114130192 AGAGAGAAGGAAGCAGGGTTGGG - Intergenic
1102692778 12:114774431-114774453 GTAGAGAAGAAGGCAGGCTGTGG + Intergenic
1102693799 12:114782296-114782318 AAAGAAAAGAAAGCAGGGATTGG + Intergenic
1102901116 12:116637967-116637989 ATAGAGAATAGGGAAGAGGTGGG + Intergenic
1102913422 12:116736267-116736289 ATAGAGAGGAAGGCAGAGGACGG + Intronic
1103172800 12:118836082-118836104 ATGGACAAGAAGGCAGGCCTGGG - Intergenic
1103940905 12:124500700-124500722 CTGGAGAGGAATGCAGGGGTGGG - Intronic
1104197479 12:126554771-126554793 AAAGAGACCAAGGCAGGAGTAGG - Intergenic
1104426875 12:128685115-128685137 ATTGAGAAGAAAGCAGGGATTGG - Intronic
1105324578 13:19358808-19358830 ATAGAATAAAAGGCAGGGGCCGG + Intergenic
1105484296 13:20811733-20811755 ACAGAAAACAAGGCAGTGGTGGG + Intronic
1105572944 13:21621179-21621201 AGAGAGAAGAAGCAAGTGGTAGG - Intergenic
1106238193 13:27883765-27883787 ACAGAAAAGAAGTCAGTGGTAGG + Intergenic
1106257398 13:28033808-28033830 AAAGAGAAGAAGGCATGGGTGGG + Intronic
1106289449 13:28347176-28347198 GCAGAGATGAAGGCAGGGGAGGG + Intronic
1106544795 13:30721107-30721129 AGAGAGAAGAAGCGTGGGGTGGG - Intronic
1107792371 13:44015386-44015408 GGAGAGAAGAAAGCAGGGCTTGG - Intergenic
1108749401 13:53432144-53432166 ATAGAGAAGAAAGCAGACGATGG + Intergenic
1108758662 13:53534821-53534843 ATATAAAAGAAGGGAGGGGCCGG - Intergenic
1109889060 13:68583116-68583138 ACAGAGGAGGTGGCAGGGGTGGG - Intergenic
1111293888 13:86255589-86255611 AGAGAGAGGAAGGAAGGGATTGG - Intergenic
1111958562 13:94784139-94784161 AGAGGGAAGAAGGCAGAGGTGGG + Intergenic
1111990789 13:95114847-95114869 ATTGAGAAAAAAGCAGGGGTAGG + Intronic
1112108447 13:96267791-96267813 ACAGGGAAGTAGGCAGGGGAAGG + Intronic
1112194407 13:97210987-97211009 AGGGAGAGGAAGGCAGGGGTTGG + Intergenic
1112378403 13:98865438-98865460 AAGGAGGTGAAGGCAGGGGTGGG + Intronic
1112716814 13:102196335-102196357 TGACAGAAGTAGGCAGGGGTAGG + Intronic
1113102248 13:106733344-106733366 AGAAAGAAGAAGGCGGGGATAGG - Intergenic
1113535701 13:111064733-111064755 AAAGAGAACAAGACAGGGATGGG + Intergenic
1114467936 14:22937830-22937852 ATAGAGAAGGAGGGAGGCCTTGG - Intergenic
1114690590 14:24576286-24576308 TGAGAGAGGAAGGAAGGGGTGGG + Intergenic
1114891926 14:26935815-26935837 AGAGAGACGAAGGCAAGGGAGGG - Intergenic
1115029541 14:28778224-28778246 AAAAAGACGAAGGGAGGGGTGGG - Intronic
1115084160 14:29493214-29493236 AAAGAGAAGAGGGAAGGGGGAGG + Intergenic
1115163721 14:30424599-30424621 AGAGAAAATGAGGCAGGGGTGGG + Intergenic
1116613080 14:47102987-47103009 AGAAAGAACAAGGAAGGGGTAGG + Intronic
1116788101 14:49309949-49309971 ATGAAGAACAAGGCAGGGTTTGG + Intergenic
1117295146 14:54372206-54372228 ATAGGAAAGGAGGCAGGGATTGG - Intergenic
1117325435 14:54664602-54664624 AGAGAGAAGAAGAGAGGGGGTGG - Intronic
1117627414 14:57653996-57654018 GTGAAGATGAAGGCAGGGGTGGG - Intronic
1117950058 14:61073859-61073881 GCTGAGAAGAAGGCAGGGGAGGG - Intronic
1118007106 14:61573274-61573296 ATAAAGAGGTAGGCAGGGGCTGG + Intronic
1118116938 14:62789104-62789126 ATAGAGAATAAAACAGTGGTGGG - Intronic
1118277752 14:64400770-64400792 CTAGAGAAAAAGGAAAGGGTGGG - Intronic
1118885576 14:69863166-69863188 CTAGAGAAGGAGGCTGCGGTTGG + Intronic
1118980172 14:70709962-70709984 AGAGGGCAGAATGCAGGGGTGGG + Intergenic
1119669073 14:76505187-76505209 GTAGAGAACAATGGAGGGGTTGG - Intergenic
1120047707 14:79827231-79827253 ACAGGTAACAAGGCAGGGGTGGG + Intronic
1120411497 14:84162810-84162832 ATAAAGAGGAAAGCAGGGGGTGG + Intergenic
1120632704 14:86910432-86910454 TTTTAGAAGAAGGCAGGGGTCGG - Intronic
1121046142 14:90789430-90789452 AAGGAAAAGAAGGCAGGGCTCGG + Intronic
1121090901 14:91181938-91181960 ATAAAGAAGAAAGCAAGGCTGGG - Intronic
1121204053 14:92146731-92146753 AAAGAGAAGAAGGAAGGCTTTGG - Intronic
1121586230 14:95064810-95064832 AGAGAGAAGAAGGGAGGGGAGGG + Intergenic
1121721980 14:96115699-96115721 ACAGAGATGAAGGCAAGGTTGGG - Intergenic
1121729719 14:96178061-96178083 ACAGAGAAACAGGCAGGGGAGGG + Intergenic
1121777017 14:96597955-96597977 AAAGAGAAGGAGGCAGAGGTGGG - Intergenic
1122930424 14:104930922-104930944 ACTGAGAAGTAGGCAGTGGTGGG - Exonic
1202888467 14_KI270722v1_random:131778-131800 AAAGAGAGGATGGCAGGGATTGG - Intergenic
1123418979 15:20115700-20115722 ATAGAGCAGGAAGCAGGGGCGGG - Intergenic
1123446885 15:20337807-20337829 ATAGAGCAGGAAGCAGGGGCGGG + Intergenic
1123528200 15:21122243-21122265 ATAGAGCAGGAAGCAGGGGCGGG - Intergenic
1124614491 15:31231592-31231614 GGACAGCAGAAGGCAGGGGTGGG + Intergenic
1124991040 15:34674015-34674037 ATAAAGCAGAAGACAGGGCTTGG - Intergenic
1125492346 15:40157719-40157741 TTAGAGAAGAAGGCAGAGATGGG + Intergenic
1125718659 15:41834712-41834734 AGAAAGAAGAAGACAGGGGATGG - Intronic
1126782727 15:52152258-52152280 ACTGAGCACAAGGCAGGGGTTGG + Intronic
1126930852 15:53649338-53649360 ATTTAGAATAAGCCAGGGGTTGG - Intronic
1126955996 15:53934390-53934412 TGAGAGAAAAAGGCGGGGGTTGG - Intergenic
1127071479 15:55291218-55291240 AGAGAGAAAAAGGCCGGGTTAGG + Intronic
1127427941 15:58874337-58874359 ATAGAGAATTAGGCAGGGCGTGG - Intronic
1127472659 15:59304339-59304361 ATAAAGCAAAAGGCAGGGCTGGG + Intronic
1127811614 15:62570009-62570031 ATAGAGAAGAAGGAAGAGAGAGG - Intronic
1128391127 15:67183399-67183421 TAAGAGCAGAAGGCAGAGGTGGG - Intronic
1128688553 15:69705850-69705872 ACAGAGAAGAAGGCCGGGCATGG + Intergenic
1128691380 15:69726984-69727006 CTAGAGCAGAGGGCAGGGGAGGG + Intergenic
1128749812 15:70140800-70140822 CTGGAGAAGAAGGCAGGGCAGGG + Intergenic
1128897978 15:71393214-71393236 CGAGAGAAAAAGGCAGGGGCGGG - Intronic
1128997416 15:72307047-72307069 AAAGAGTAGAAGCCTGGGGTGGG + Intronic
1129146173 15:73649380-73649402 ATAGAAATGAAGGGAAGGGTAGG - Intergenic
1129332531 15:74835103-74835125 ATTGAGAAGATGGGAGGGGCTGG - Intergenic
1129760320 15:78125423-78125445 AGAGAGAAGAGGGGAGGGGAAGG - Intronic
1129887002 15:79045553-79045575 AGAGAGAAGCAGGCAGGAGGAGG - Intronic
1130040239 15:80400375-80400397 ATAGAGAAGAAGGCAGGGGTGGG + Intronic
1130054121 15:80507642-80507664 GAAGAGAAGAAGGCTGAGGTTGG + Intronic
1130139933 15:81216465-81216487 AAAAAGAAAAAGCCAGGGGTGGG - Intronic
1130234495 15:82121625-82121647 ATAGTGAAGAAGCCACAGGTTGG + Intergenic
1130561414 15:84962413-84962435 AAAGAGAAGAAAGAAAGGGTGGG + Intergenic
1131066348 15:89437073-89437095 ATAGAGAGGAAGGGAGAGGAAGG - Intergenic
1131372454 15:91894225-91894247 TTGGAGAGGAGGGCAGGGGTGGG + Intronic
1131403834 15:92147340-92147362 CAAGAGAAGAAGGCAGGGCATGG + Intronic
1131641898 15:94301988-94302010 ATGAAGAAGAAGGAAGGAGTTGG + Intronic
1131772707 15:95757608-95757630 AAAGAGAAGAAGGGGTGGGTAGG + Intergenic
1131785392 15:95906555-95906577 AGGGAGCAGAAGGGAGGGGTGGG + Intergenic
1131988354 15:98067334-98067356 ACATAGAAATAGGCAGGGGTGGG + Intergenic
1132169127 15:99629656-99629678 AAAGGGAAAAAGGCCGGGGTGGG + Intronic
1132294328 15:100724439-100724461 TGACAGAAGAAAGCAGGGGTTGG + Intergenic
1132333441 15:101027925-101027947 AGAGGGAAGAAGGAAGGGGAGGG - Intronic
1132818467 16:1847592-1847614 AAAGAGAAGAGGGGAGGGGAGGG + Intronic
1133096220 16:3448103-3448125 ACAGAGAAGAAAGGATGGGTTGG + Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133748619 16:8707021-8707043 AAAGAGATGCAGGCAGAGGTGGG + Intronic
1134013770 16:10874328-10874350 ACAGAGAGGAAGCCTGGGGTGGG + Intergenic
1134015287 16:10883771-10883793 AAAGGGAAGAAAGCAGGGTTGGG + Intronic
1134110985 16:11515562-11515584 AAAGAGGAGAAGGGAGGGGAAGG + Intronic
1134325985 16:13208332-13208354 ATAGAAAGGAAGGCAGGTTTGGG - Intronic
1134856043 16:17520118-17520140 ATGGAGAAGGAGGCAGGGGAAGG + Intergenic
1135105171 16:19643368-19643390 ACAGACCAGAAGGTAGGGGTAGG + Intronic
1135124857 16:19800144-19800166 AGAGAGAGGAAGGAAGGGATTGG + Intronic
1135152059 16:20016944-20016966 ATAGGTAAGAAGGCACAGGTAGG + Intergenic
1137433809 16:48439250-48439272 AAAAAAAAAAAGGCAGGGGTTGG + Intronic
1138172539 16:54866489-54866511 TTAAAAAAGTAGGCAGGGGTCGG - Intergenic
1138172592 16:54866836-54866858 TTAAAAAAGTAGGCAGGGGTGGG + Intergenic
1138206966 16:55132510-55132532 GTAAAGAACAAGGCTGGGGTAGG - Intergenic
1138389664 16:56661293-56661315 AGAGGGAGGAAGGGAGGGGTTGG - Intronic
1138835414 16:60428876-60428898 AAAGAGAAGGAGGATGGGGTGGG + Intergenic
1139100472 16:63760634-63760656 TTAGGGAAGATGGGAGGGGTAGG - Intergenic
1139632439 16:68238722-68238744 TTAAAGAAGAATGCAAGGGTTGG - Intergenic
1140230276 16:73112214-73112236 ACAGAGAAGAAGAGAGGGGTGGG + Intergenic
1140315587 16:73893593-73893615 AAAAAAAATAAGGCAGGGGTGGG - Intergenic
1141326768 16:83067812-83067834 AGAGAGAAGAAGAGAGGGGCAGG - Intronic
1203138141 16_KI270728v1_random:1743047-1743069 ATAGATCAGGAAGCAGGGGTGGG + Intergenic
1143332632 17:6148891-6148913 TTAGAGAAGGAGGCTGGGGGTGG - Intergenic
1143864259 17:9912439-9912461 ATGGACAAGAAGGCTGGGGCTGG - Intronic
1144200118 17:12933487-12933509 GTAGGGAGGAAGGCAGGGTTTGG - Intronic
1144379852 17:14683903-14683925 AGAGAAAAGAAGGCAGTCGTGGG + Intergenic
1144458718 17:15440197-15440219 AGAAAGAAGAAGGTAGGGTTGGG - Exonic
1144766483 17:17735762-17735784 AAAGAGAGGAAGGCACAGGTTGG - Intronic
1144854417 17:18260176-18260198 ACAGAGCAGGTGGCAGGGGTAGG + Intergenic
1145204550 17:20975956-20975978 AGATAGGAGCAGGCAGGGGTGGG + Intergenic
1145901383 17:28492589-28492611 CTGGAGAAGTAGGCAGGGGAAGG + Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1147055409 17:37830551-37830573 AAAGAGTAGCAGGCAGGGGCAGG + Intergenic
1147127178 17:38379186-38379208 AAAAAAAACAAGGCAGGGGTTGG + Intronic
1147606218 17:41775240-41775262 AGACAGAAGAAGGCTGGGGGTGG + Intronic
1147618954 17:41850745-41850767 ATTGAGAAAAAGGTAGTGGTGGG + Intergenic
1147855301 17:43475338-43475360 ATAAAGGTGATGGCAGGGGTGGG + Intergenic
1148787809 17:50153984-50154006 ATAGTGATGAAGGCAGGGAGAGG + Intergenic
1149000877 17:51756412-51756434 AAAGAGAAGAAGTCAGAAGTTGG + Intronic
1149121166 17:53167273-53167295 CTAGAGAACATGGCAGTGGTTGG - Intergenic
1149194211 17:54100735-54100757 ATAGAGAAGATGGGAGGCCTTGG - Intergenic
1149202193 17:54199856-54199878 ATGCACAAGATGGCAGGGGTTGG - Intergenic
1149270836 17:54975722-54975744 TTAGAGAAGTAGGCAGGGTCTGG - Intronic
1149354764 17:55828421-55828443 ATTAAGATGAAGGCAGAGGTTGG - Intronic
1149528971 17:57379871-57379893 AAAGAGAAGTTGGGAGGGGTGGG - Intronic
1149540083 17:57462152-57462174 ATAAAGATGAAGGCAGAGATTGG - Intronic
1149862233 17:60128498-60128520 AGTGAGAGGAAGGCAGGGGGAGG - Intergenic
1150176997 17:63067767-63067789 ATAGAGAGAAAAGCAGGGGATGG + Intronic
1150319845 17:64203562-64203584 TTTGAGAATATGGCAGGGGTGGG + Intronic
1150513573 17:65782822-65782844 AGGGAGAAGAGGGTAGGGGTGGG + Intronic
1150947748 17:69765778-69765800 AGAGAGTAGAAGGGAGGGGAGGG - Intergenic
1151356647 17:73562568-73562590 GGGGAGAAGAAGGCAGGCGTGGG + Intronic
1151536570 17:74742228-74742250 AAAGAGAAAAAGGCAGAGGATGG - Intronic
1151737818 17:75955958-75955980 AAAGAGAACAAGGGAGGGGTGGG + Intronic
1151852458 17:76699014-76699036 ATAGAAAGGAAGTCAGGGCTGGG - Intronic
1152596909 17:81242229-81242251 AGAAGGAGGAAGGCAGGGGTGGG - Intergenic
1152612249 17:81321618-81321640 AGAGTGAAGAAAGCTGGGGTGGG - Intronic
1153349094 18:4059033-4059055 ACAGAGATGCAGGCAGGGTTAGG + Intronic
1153786159 18:8537282-8537304 AGAAAGAAGAAGGCAGCGGAAGG - Intergenic
1154073141 18:11173509-11173531 ATAGAGAAAAAGGCTGGGCACGG + Intergenic
1154143655 18:11848240-11848262 AGAAAGAAGAGGGCAGGGCTGGG + Intronic
1154205802 18:12335696-12335718 ATAGAGCTGAAGGAAGGGGAAGG - Intronic
1156052646 18:32955424-32955446 ACAAAGAAAAAGGCAGAGGTGGG - Intronic
1156685059 18:39634422-39634444 TTAGAGAAGAATGAAGAGGTAGG - Intergenic
1157621592 18:49020380-49020402 GTGGAGAAGAAGGCCGGGGGTGG - Intergenic
1157816777 18:50735179-50735201 ATAGGGAAGAAGGGAGGGCCAGG - Intergenic
1158452938 18:57582919-57582941 AAAAAGAAGAAGGAAGCGGTGGG + Intronic
1159116405 18:64117894-64117916 AAAGAAAAGCAGGCAGAGGTAGG - Intergenic
1159487732 18:69086659-69086681 AAAGGGAGGAAGGCAGGGGAGGG + Intergenic
1160008991 18:75089516-75089538 ATAGTGAAGGAAGCAGGGATGGG - Intergenic
1160573243 18:79832581-79832603 GTGGAGAAGAAGGGAGGAGTGGG - Intergenic
1161495425 19:4583647-4583669 ACAGCCAAGAAGGCAGGGGAGGG - Intergenic
1161527100 19:4763105-4763127 AAAGGGAAGAAGACAGAGGTTGG - Intergenic
1161973851 19:7598080-7598102 GTAGAGGAGACGGCAGGGGATGG + Intronic
1162410040 19:10500097-10500119 ACAGGGCAGAGGGCAGGGGTTGG + Intronic
1162637474 19:11981317-11981339 AGGGAGGATAAGGCAGGGGTTGG - Intergenic
1162891633 19:13737489-13737511 ATAGAAAAGCAGGTAGGGCTGGG + Intronic
1163204905 19:15795213-15795235 GCAGAGAAGAAGGAAGGGGGAGG - Intergenic
1163529606 19:17841958-17841980 AGAGAGAAGGAGGCGGGGATTGG - Intronic
1163717356 19:18879929-18879951 ATACAGAGCAAGCCAGGGGTGGG - Intronic
1163767742 19:19172652-19172674 ATGGAGGAGAAGGCTAGGGTGGG + Intronic
1164901506 19:31930091-31930113 ATAGATAAGAAGGGTGAGGTAGG + Intergenic
1165087220 19:33359021-33359043 ATAGTGAGGAAGCCAGGGGCAGG - Intergenic
1165673983 19:37705825-37705847 AGAGAGAAGGGAGCAGGGGTGGG - Intronic
1166160252 19:40947490-40947512 ACAGAGAAAAAGACAGGAGTAGG + Intergenic
1166169138 19:41015124-41015146 ACAGAGAAAAAGACAGGAGTAGG + Intronic
1166977145 19:46611303-46611325 GAAGAGAGGAAGGCAGGGGCAGG + Intergenic
1167331184 19:48857363-48857385 ATAGAGAAGAAAGGAAGGGAGGG + Intronic
1167619221 19:50551864-50551886 AGAAAGAAGGAGGGAGGGGTGGG - Intronic
1167639601 19:50673380-50673402 ACAGAGGAGAAGGAAGAGGTGGG - Intronic
1167685704 19:50954759-50954781 ACAGGGAAGGAGGAAGGGGTGGG - Intergenic
1167987151 19:53328154-53328176 ATAGGGAATAAGGCAGGGGAGGG + Intergenic
1202663867 1_KI270708v1_random:98570-98592 AAAGAGAGGATGGCAGGGATTGG - Intergenic
1202688493 1_KI270712v1_random:69021-69043 ATAGAGTAGGAAGCAGGGGCGGG - Intergenic
925204178 2:1992445-1992467 ATAGACAGGAAAGCAGGGGAGGG - Intronic
925476363 2:4221106-4221128 ATATAGAGGAAGGCAGGAGAGGG - Intergenic
925894561 2:8461352-8461374 ACAGAGATGGAGGCAGTGGTAGG + Intergenic
926527703 2:14002826-14002848 ATAGAGTAGAAGGCAGAGGGCGG + Intergenic
927659514 2:24981045-24981067 AGAGAGAAGAAGGAGGGGGAGGG + Intergenic
927693178 2:25222662-25222684 AGAGACAGGAAGGGAGGGGTGGG + Intergenic
927841932 2:26450272-26450294 GTAGAGGAAGAGGCAGGGGTGGG - Intronic
928413486 2:31072027-31072049 AAAGAGAAGAGGGCATGGGGAGG + Intronic
928982664 2:37152943-37152965 ATAGATTAGAAGGCAGGGAGAGG - Intronic
930010704 2:46936308-46936330 TTAGAGAAGAAGATAGGTGTAGG + Intronic
930021650 2:47005219-47005241 ACAGAGAGGAAGGGAGGGGGGGG + Intronic
930113857 2:47701982-47702004 CCAGAAAAGAAGGCAGGGTTTGG + Intronic
930639490 2:53840537-53840559 AGAGAGAAGAGGGGAGGGGAGGG + Intergenic
930775447 2:55165873-55165895 GAAGAGAAGAAAGCAGGGTTGGG - Intergenic
931058114 2:58495438-58495460 ATAAAGGAGAAGTCAGGGGTAGG + Intergenic
932398006 2:71461377-71461399 AAAGAGAAGAAGGCAGCTGGAGG + Intronic
932433274 2:71687901-71687923 AGGGAGAGGAAGGAAGGGGTGGG + Intergenic
932447536 2:71790196-71790218 AGAGGGATGCAGGCAGGGGTGGG + Intergenic
932468740 2:71940198-71940220 AGAGAGGAGGAGGCAGGGGCTGG - Intergenic
932743876 2:74314992-74315014 AAGGAGGAGAAGGCTGGGGTAGG - Exonic
932924317 2:75954305-75954327 GTAGAGAAGAGGGAAGGGGAGGG - Intergenic
933009848 2:77046706-77046728 ATAGAGAAAAAGGCAGAAGGAGG + Intronic
933068799 2:77833023-77833045 ACAGAGATGAAGGCAAGGTTAGG + Intergenic
933270114 2:80224255-80224277 AAAGAGAAGAGGGTAAGGGTGGG - Intronic
933764395 2:85697109-85697131 ATAGAGAAGACTGGTGGGGTGGG - Intronic
933957927 2:87386907-87386929 ATAGAGTAGGAAGCAGGGGCGGG + Intergenic
934104333 2:88682032-88682054 ACAGAGATGAAGGCAAGGTTAGG + Intergenic
934242049 2:90278825-90278847 ATAGAGTAGGAAGCAGGGGCGGG + Intergenic
934271124 2:91537863-91537885 ATAGAGTAGGAAGCAGGGGCGGG - Intergenic
934745178 2:96754757-96754779 GTAGAGAAGAAGGCAGACGGTGG + Intergenic
934962707 2:98691095-98691117 ATAGAGAAAGAGGGTGGGGTGGG + Intronic
934982283 2:98852937-98852959 AGAGAGAAGAAGGAAGGAGAGGG + Intronic
935368839 2:102323575-102323597 GGAGAGAAGAAGCAAGGGGTGGG + Intronic
935637206 2:105258438-105258460 ATAGAACAGAAGGCAGAGGAAGG + Intergenic
935921361 2:108019106-108019128 TTAGGGAAAAGGGCAGGGGTAGG - Intergenic
935950531 2:108324531-108324553 ACAGAGAAGAAGCCAGAAGTGGG + Intergenic
936491047 2:112972491-112972513 TTAGAGAAAAAGGCAGGGATAGG - Intergenic
936747659 2:115598367-115598389 ATTAAGAAGAAGGCAGGGAAGGG - Intronic
936810319 2:116391703-116391725 ATATAGAAGATGGCAGAGGTGGG - Intergenic
936944103 2:117915097-117915119 TTTTAAAAGAAGGCAGGGGTGGG + Intergenic
937132759 2:119525325-119525347 AGAGAGAAGAAGGAAGGGAGTGG - Intergenic
937426430 2:121803287-121803309 ATAGAGAAGAACGCATTGTTGGG - Intergenic
937703899 2:124895796-124895818 ATAGAGAATAAGACAGTGGGAGG + Intronic
937859952 2:126699859-126699881 TTAGAGAAGAAGGGAGGCTTGGG + Intergenic
938383496 2:130849295-130849317 AGAGAGATGCAGGCAGGGCTGGG + Intronic
941536752 2:166732199-166732221 ATAGTCAAGCAGGCAGGGGGTGG - Intergenic
942052005 2:172148538-172148560 AATCAGAAGAAAGCAGGGGTTGG + Intergenic
942164024 2:173223856-173223878 GTAGAGCAGAAGGGAGGGCTTGG + Intronic
942349379 2:175037326-175037348 ATAGAGAAAAAGGAAGGCTTTGG - Intergenic
942897128 2:181070591-181070613 ATAGAGAAGTAGGGAGTAGTTGG + Intronic
943699456 2:190973950-190973972 AAAGAGAGGAAGGCAGGGAGGGG - Intronic
944118465 2:196213980-196214002 ATTGGAAAGAGGGCAGGGGTAGG - Intronic
944631594 2:201631597-201631619 ATAAAGAATCAGGCAGGGGTGGG + Intronic
945965749 2:216184875-216184897 ATACAGAAGAAGGGAGGGTGAGG - Intronic
946040730 2:216781123-216781145 ACAGAGAGGAAGGGAGGGGAAGG - Intergenic
946313623 2:218896308-218896330 ACAGATTAGAAGGCAGTGGTGGG + Intronic
946316600 2:218919436-218919458 AAAGAAAAGAAGGAAGGGGAGGG - Intergenic
946391060 2:219417433-219417455 ATAGAGGAGAACGCATGGCTGGG - Intergenic
947981991 2:234418525-234418547 AGAAAGAAGCAGGCAGGGGTGGG - Intergenic
948295139 2:236855176-236855198 ATAGAGCAGGAGGTGGGGGTGGG - Intergenic
948575674 2:238947945-238947967 ACAGAGCAGAAGGCAGAGATTGG + Intergenic
948760013 2:240184512-240184534 CTAGGGAAGAAGGTAGGGGATGG - Intergenic
1169535410 20:6533717-6533739 AAAAAGAAGCAGGCAGGGGTGGG - Intergenic
1169798554 20:9492492-9492514 GTAGAGAAGAGGGGAGGGATGGG + Intergenic
1170014578 20:11766325-11766347 AATGAGAGGAAGGCAGGGGTAGG - Intergenic
1170143400 20:13147561-13147583 ATAGAGAAGCAGGGAGGGGCAGG + Intronic
1170378410 20:15728838-15728860 ATAGAAAAGAATCCAGGAGTTGG - Intronic
1170728863 20:18955010-18955032 ATAGAGAAGCAGGGAAGGGCAGG - Intergenic
1170874065 20:20234438-20234460 ATGGAGAAGAAGCAAGGGTTAGG + Intronic
1170919776 20:20666894-20666916 GAAGAGGAGGAGGCAGGGGTGGG + Intronic
1170935372 20:20805029-20805051 GTAGAGAAGAAGGGAGAGGCTGG + Intergenic
1171223004 20:23418324-23418346 ATAGCTAAGAAGGCAGGGGCAGG + Intronic
1171389676 20:24793275-24793297 GAAGAGAGGAAGGCAGGGGCAGG + Intergenic
1171508803 20:25662471-25662493 AGAGAGAAGTAGGGTGGGGTGGG + Intergenic
1171853400 20:30324131-30324153 AATGAGAAGAGGGCAGGGGGTGG + Intergenic
1172328371 20:34055435-34055457 ATAAGGAAGGAAGCAGGGGTGGG + Intronic
1172426741 20:34860626-34860648 AAAAAAAAAAAGGCAGGGGTTGG - Intronic
1172573656 20:35989884-35989906 AGAGAGAAGAGGGGAGGGGAGGG + Intronic
1172598019 20:36163844-36163866 ATAAAGAAGAAGGCACTGGCAGG - Intronic
1172777147 20:37414447-37414469 AAAGGGAGGAAGGCAGAGGTGGG - Intergenic
1172943904 20:38673710-38673732 ATACAGAATAACGGAGGGGTGGG + Intergenic
1173076581 20:39825018-39825040 ATAGACAACAAGGCAGGGATTGG - Intergenic
1173333778 20:42097057-42097079 ATGAAGCAGTAGGCAGGGGTTGG - Intronic
1174050054 20:47761258-47761280 AGACAGAAGATGGCAGGGATGGG + Intronic
1174085410 20:48004552-48004574 CAAGGGAAGAAGGCAGGGGTTGG + Intergenic
1174130812 20:48342178-48342200 CGAGGGAAGAAGGCAGGGGTTGG - Intergenic
1174205603 20:48836098-48836120 ATGGGAAAGATGGCAGGGGTCGG + Intergenic
1174289565 20:49498281-49498303 GTAAAGAAGATGGCTGGGGTTGG - Intergenic
1174584586 20:51598188-51598210 AGAGACAAAAAGGAAGGGGTGGG + Exonic
1174818622 20:53708734-53708756 AAAGAAAAGAAGACAGGGGAGGG - Intergenic
1174942092 20:54940222-54940244 ATAGGGAAGAGGGAAGGGATAGG + Intergenic
1175417354 20:58810747-58810769 ATAGAAATGGAGGCAGGGTTTGG - Intergenic
1175474473 20:59261316-59261338 AAAAAAAAGAAGGAAGGGGTTGG - Intergenic
1175515935 20:59569796-59569818 TGTGAGAAGAAGGCAGGGGTTGG - Intergenic
1175779063 20:61670816-61670838 ATAGAAAGGAAGGAAGGGGCTGG + Intronic
1175791721 20:61744247-61744269 ACAGAGAGGAAGGCAGGTGCAGG + Intronic
1176107366 20:63395738-63395760 AGAGGGAAGAAGGCAGGTATGGG + Intergenic
1176425786 21:6547531-6547553 GGAGAGGAGAAGGCAGGTGTGGG - Intergenic
1176943531 21:14952517-14952539 GTAGAGATGAAGGTAGGGATGGG + Intergenic
1177296342 21:19181157-19181179 TTAGGGAAGATGGGAGGGGTAGG + Intergenic
1177393669 21:20507475-20507497 AAAGGGAAGGAGGCAGGTGTCGG + Intergenic
1177951852 21:27548097-27548119 GGAAAGAAGAAGGCAGAGGTGGG + Intergenic
1178165696 21:29973603-29973625 ATTGAGAAGGAGGAAGGGGAGGG - Intergenic
1178486250 21:33021509-33021531 ATTGAGGTCAAGGCAGGGGTGGG - Intergenic
1178634721 21:34292112-34292134 ATAGAGCAAAAGGAAGGGGAAGG + Intergenic
1178782618 21:35619256-35619278 ATTGAGAAGAAGAAAGGGTTTGG - Intronic
1178887676 21:36496656-36496678 ATGGAGAAGAAAGCAGAGGAAGG + Intronic
1178924323 21:36762337-36762359 GCAGAGAAGAGAGCAGGGGTAGG + Intronic
1179353542 21:40636397-40636419 AGAGGGAAGAAGGAAGGGGGTGG + Intronic
1179701277 21:43155848-43155870 GGAGAGGAGAAGGCAGGTGTGGG - Intergenic
1179979076 21:44887144-44887166 ACAGAGAAGAAGGCAGGGCCAGG + Intronic
1180330591 22:11475454-11475476 AAAGAGAGGATGGCAGGGATTGG - Intergenic
1180552995 22:16555993-16556015 ATAGAGCAGGAAGCAGGGGCGGG + Intergenic
1180638059 22:17276416-17276438 AAAGAGAAGAGGGGAGGGGAGGG + Intergenic
1180704455 22:17800600-17800622 ACAGAGCACAGGGCAGGGGTAGG + Intronic
1181085770 22:20438676-20438698 ACAGAGCAGAAGGAAGGTGTGGG + Intronic
1181351096 22:22258446-22258468 ATAGAGCAGGAAGCAGGGGCGGG - Intergenic
1181360628 22:22331272-22331294 ATAGTGGAGAAGGTATGGGTGGG + Intergenic
1182841764 22:33396498-33396520 ATAGGGAAGGAGGGAGGGGTGGG + Intronic
1182901818 22:33904583-33904605 ATACAGAAGAAGGCAGAGCCAGG + Intronic
1183187341 22:36299647-36299669 TTAGAGGAGAAGGCAGGAGAAGG - Intronic
1183232440 22:36591381-36591403 AGAGGGAAGAAGGGAGGGGCTGG + Intronic
1183474506 22:38028639-38028661 ATAGAGAAGAAAGCAGAAATTGG + Intronic
1183589297 22:38770473-38770495 ATTGAGGAGAAGACAGGGCTGGG + Intronic
1184062711 22:42093833-42093855 ATAAAAAAGATGGCAGGGGCTGG + Intergenic
1184808413 22:46811759-46811781 TTTCAGAAGAAGGCAGTGGTAGG + Intronic
1184818840 22:46893433-46893455 ATGGGGATGATGGCAGGGGTTGG + Intronic
1184909019 22:47513618-47513640 ATGGAGATGAAGGCAGAGGCTGG - Intergenic
1185071162 22:48657143-48657165 ATAGAGAAGAAGGAAAGTGAAGG + Intronic
1185400532 22:50613310-50613332 ACACAGATGAATGCAGGGGTCGG - Intronic
949159585 3:864404-864426 ACAGAGTAGAAGGGTGGGGTTGG - Intergenic
949386156 3:3504565-3504587 ATACAAAAGAAAGGAGGGGTCGG - Intergenic
949644230 3:6074928-6074950 AATGACAAGAAGACAGGGGTTGG + Intergenic
949845229 3:8362951-8362973 ATAGAGCAGAGGTTAGGGGTAGG - Intergenic
949898128 3:8785585-8785607 ATAGATAAGAAGTCAGAGGCTGG + Intronic
950502806 3:13375277-13375299 ATTGAGAATAAGGCAGGGTGCGG - Intronic
950760484 3:15219829-15219851 CTAGAGAGGAAAGCAGGGGCTGG - Intronic
950885398 3:16358054-16358076 AAAAAGAAAAAGGCGGGGGTGGG + Intronic
950924930 3:16731110-16731132 CTAGAGAAAAAGGGAGTGGTGGG - Intergenic
951182935 3:19680490-19680512 AAACAAAAGAAAGCAGGGGTTGG - Intergenic
951259004 3:20483947-20483969 AAACAGACAAAGGCAGGGGTTGG + Intergenic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951523430 3:23630525-23630547 AAGGAGAGGAAGGGAGGGGTAGG + Intergenic
952767676 3:36969083-36969105 AAAGAGATGGAGGCAAGGGTAGG + Intergenic
953419957 3:42746849-42746871 GCAGAGAAGAAGGCAGGTGTTGG + Intronic
953546480 3:43867329-43867351 ATAAAGAAGAAGGAATGGGGAGG - Intergenic
953733106 3:45466701-45466723 ATAAAAAAGAAGGCAGGACTGGG - Intronic
953798076 3:46000806-46000828 ACAGAGATGAAGGCAAGGTTAGG + Intergenic
953938172 3:47065176-47065198 ATAAAAAAGAAGGCAGGACTGGG - Intronic
954144749 3:48628977-48628999 ACAGAACACAAGGCAGGGGTTGG - Intronic
954990312 3:54835245-54835267 AAAGAGAAGCTGGCAGGTGTTGG - Intronic
955772087 3:62395229-62395251 CTGGAGAAGTAGGCAAGGGTTGG + Intergenic
956542690 3:70360130-70360152 TTAGAGAAGAAGGGAGGGAGGGG + Intergenic
956594842 3:70955754-70955776 ATAGCCAGGAAGGCAGTGGTAGG + Intronic
956693113 3:71895842-71895864 AGAGAGAAGATGGGTGGGGTAGG + Intergenic
956916431 3:73876615-73876637 AGAGACAGGAAGGCAGGGGAAGG + Intergenic
957036931 3:75302117-75302139 ATAGAGCTGAAGGCTGGGCTAGG + Intergenic
957058923 3:75465830-75465852 AAAGAGAAAAAGGAAGGGATTGG - Intergenic
957111076 3:75958627-75958649 ATAGAGAGCAAGGAAGTGGTGGG + Intronic
957412364 3:79858435-79858457 ATAGAGCAAAAGGCATAGGTTGG + Intergenic
957546518 3:81644983-81645005 TTAGAGAAGATGGCAGGGGGAGG + Intronic
958801714 3:98763789-98763811 AAAGAGAAGAATGCAGACGTTGG + Intronic
959223267 3:103549392-103549414 GTAAAGATGAAGGCAGGGTTTGG + Intergenic
959454400 3:106541043-106541065 AAAGAGAAGGAAGCAGGTGTTGG - Intergenic
959925420 3:111915845-111915867 ATAGGGAAGAAAGTAGGGGCAGG + Intronic
960507313 3:118509462-118509484 CTAGAGGAAAAGGCAGGGATAGG - Intergenic
961080717 3:124024915-124024937 ATAGAGCTGAAGGCTGGGCTAGG + Intergenic
961207115 3:125093383-125093405 GTAGTGAAGAAGGAAGGGCTGGG - Intronic
962072143 3:132044561-132044583 AAAGAGAGGAAGGGAGGGGAAGG + Intronic
962386692 3:134937755-134937777 TTGTAGAACAAGGCAGGGGTGGG - Intronic
962740095 3:138357164-138357186 ATAGGAAAGACGGCAGGGCTGGG + Intronic
963057712 3:141200973-141200995 AGAGAGAAGAAGGCAGGAGCAGG + Intergenic
963617606 3:147561833-147561855 AGAGAAAAGAAGGCAGGGCACGG - Intergenic
963919363 3:150891106-150891128 ATAATGCAGAAGGCAGGAGTAGG + Intronic
963994007 3:151685414-151685436 ATACAGATGAAGGCAGGTGTAGG - Intergenic
964685894 3:159396138-159396160 AAACAAAAAAAGGCAGGGGTTGG - Intronic
965597621 3:170423773-170423795 ATAAAGAAGGAGGCCGAGGTGGG + Intronic
966473345 3:180317287-180317309 ATGGAAAAGAAGGCAGGTATGGG - Intergenic
966554230 3:181241106-181241128 ATAGAGAAGCTGGAAGGGGTGGG + Intergenic
966647436 3:182262349-182262371 ATAGTGAGGAAGGAAGAGGTGGG - Intergenic
967252724 3:187559538-187559560 AAAGGGAAGAAGGCAGGGAGGGG - Intergenic
967356486 3:188577818-188577840 AGAAAGAAGAAGGAAGGGGAGGG - Intronic
967517963 3:190392800-190392822 AGAGAAAAGAATACAGGGGTTGG + Intronic
968286676 3:197513049-197513071 ACAGAGCAGCAGGCAGGGGCAGG + Intronic
968804857 4:2765837-2765859 ATAGAGATGGCGGCGGGGGTGGG + Intergenic
968873844 4:3254985-3255007 GGAGAGATGAAGGCAGGGGTGGG - Intronic
969002840 4:3996054-3996076 AAAGAGAAAAAGGAAGGGATTGG - Intergenic
971094678 4:23387355-23387377 ATGGAGAGGATGGCAGAGGTAGG - Intergenic
971116243 4:23648813-23648835 ATAGAGAAGAAAACAGTGGTGGG - Intergenic
971311570 4:25529923-25529945 GGAGAGAAGAAGGGAGGGGAAGG + Intergenic
971327366 4:25655479-25655501 CTTGAGGAGAAGGCAGGGGCGGG + Intronic
971713288 4:30144790-30144812 ATAGAGAAGAGGGCCGGGCATGG + Intergenic
971781248 4:31037198-31037220 ATAGAGAACAAGGCAGAGATGGG - Intronic
971918032 4:32899547-32899569 ATAGAGAAAGAGGCAGGAGATGG - Intergenic
972506295 4:39723343-39723365 AAAGAGAAGACAGCAGGGCTGGG - Intronic
972770180 4:42190374-42190396 AGAGAAATGAAGGAAGGGGTGGG - Intergenic
973004184 4:44988901-44988923 ACAGAGATGAAGGCAAGGTTAGG + Intergenic
973076923 4:45940576-45940598 TCAGAGAATAAGGCAGTGGTAGG + Intergenic
973783115 4:54308918-54308940 ATAGAGAAGAAAACTGTGGTAGG + Intergenic
973872616 4:55181493-55181515 ATAGAGAAAAAGGCCTGGGTTGG - Intergenic
974959598 4:68681320-68681342 AAACAAAAAAAGGCAGGGGTTGG - Intergenic
975070274 4:70127666-70127688 ATGCAAATGAAGGCAGGGGTGGG + Intergenic
975834204 4:78404553-78404575 ATACAGAAGGAGGAGGGGGTTGG - Intronic
976967914 4:91067638-91067660 TTAAAGAAGAAGGATGGGGTGGG - Intronic
977337862 4:95720853-95720875 ATAAAGAAGAAGACAGAGATTGG + Intergenic
977478196 4:97539366-97539388 AAACAAAAAAAGGCAGGGGTTGG + Intronic
979093462 4:116516782-116516804 ATAGAGATGAAGGCAAGACTAGG - Intergenic
979562148 4:122112277-122112299 AAACAAAAAAAGGCAGGGGTTGG + Intergenic
979993162 4:127399827-127399849 AAAGAGAAAAAGGAAGAGGTTGG + Intergenic
980453297 4:133005558-133005580 ATAAGGAAGCAGGGAGGGGTGGG + Intergenic
981222201 4:142250156-142250178 AGAGAGAATAAGGAAGAGGTGGG - Intronic
981624750 4:146742715-146742737 AGAGAGCAGAAGGGAGGGGAGGG - Intronic
981909470 4:149962083-149962105 ATAGAGAAGAAGGCCAGGCATGG - Intergenic
982080334 4:151783485-151783507 ATGAAGAAGTAGGCAGAGGTGGG - Intergenic
983605192 4:169575036-169575058 ATAGAAAACTATGCAGGGGTGGG + Intronic
983654202 4:170065029-170065051 TGAGGGAAGAAGGGAGGGGTAGG + Intronic
983727636 4:170948560-170948582 AAAGAGGAGAAGCCAGTGGTGGG - Intergenic
983765935 4:171483797-171483819 AGAGACAAGAAGGCAGGAGAAGG + Intergenic
983880935 4:172931709-172931731 AAAGAGAAGAAGGCAGAGTTTGG - Intronic
983952526 4:173659396-173659418 ATGGAAAAGAAGTGAGGGGTGGG + Intergenic
984458303 4:179999782-179999804 ACATAGGAGAAGGCAGGGTTTGG - Intergenic
985799486 5:1995001-1995023 ATAGACAAGAAGGCGGGATTAGG + Intergenic
985813702 5:2110986-2111008 TTAGAGGAGAAGGCATGGGTGGG + Intergenic
986039089 5:3969482-3969504 AGACAGTAGGAGGCAGGGGTGGG + Intergenic
986557572 5:9026718-9026740 ATTGAGTAAAAGGCAGAGGTTGG + Intergenic
987022415 5:13888242-13888264 GTAGAGAGGAAGAAAGGGGTAGG - Intronic
987063311 5:14262956-14262978 GAAGAGAAGAAAGCAGGGGTGGG - Intronic
987339051 5:16923050-16923072 AAAGAGAAGAGGGGAGGGGAGGG + Intronic
987368406 5:17170928-17170950 ATAGACAAGACGGCAGAGGTGGG - Intronic
988042947 5:25911609-25911631 CTGAAGAAGAAGGCAGTGGTAGG - Intergenic
989122895 5:38021760-38021782 ATAGAGGAGAAGGAAGGGGAAGG - Intergenic
989452040 5:41597797-41597819 ATAGAGTAAAAGGCAGAGGAAGG - Intergenic
989800719 5:45535305-45535327 ATAGAGAAGCAGGCTGGGCATGG + Intronic
990182750 5:53180706-53180728 CTAGAGCAGGAGGAAGGGGTGGG - Intergenic
992249453 5:74863029-74863051 AAAAAAAAAAAGGCAGGGGTGGG + Intronic
993053474 5:82952711-82952733 TTAGAGAAACAGGCAGGGGCTGG - Intergenic
994722204 5:103393188-103393210 ATAGATAAAAAGGTGGGGGTGGG + Intergenic
995198152 5:109396766-109396788 AAAAAAAAAAAGGCAGGGGTGGG + Intronic
995640622 5:114252677-114252699 ACAGAGAAAATGGCAGAGGTTGG - Intergenic
995690647 5:114822986-114823008 ACAGAAAAAAAGGCAGGGGCAGG + Intergenic
996519736 5:124413561-124413583 ATGGAGAAGAAGGCAGGGAGAGG + Intergenic
996925924 5:128826555-128826577 ATAGTTAAGAAGACAGGGGAAGG + Intronic
997020955 5:130001172-130001194 ATAAAAAAGAAGGCAGGGCCAGG - Intronic
997653919 5:135541725-135541747 TAAGAGAAGAAGGGTGGGGTTGG + Intergenic
998253139 5:140565988-140566010 ATAAAGCCTAAGGCAGGGGTGGG - Intronic
998532559 5:142899452-142899474 ATAGAGAAGGAGGCACAGGGAGG + Intronic
999382191 5:151129178-151129200 CTACAGAAGGAGGCAGGGGCTGG - Intronic
999561008 5:152802984-152803006 ATAGAGTAGAAGGCCAGGGCAGG - Intergenic
999636553 5:153629060-153629082 ACAGAGAGACAGGCAGGGGTGGG + Intronic
999674045 5:153981367-153981389 AAAGAGAAGAAGACAGGGTCTGG - Intergenic
999874654 5:155789790-155789812 ATAGATAAGAATTCAGAGGTTGG + Intergenic
1000098539 5:157992703-157992725 ATAGAGATGGCGGCAGGGGGGGG + Intergenic
1000192505 5:158924977-158924999 GTAGAGGAGTAGGCAGGAGTGGG - Intronic
1000861989 5:166466966-166466988 ATAGAAAAGAGGGCTGGGGACGG - Intergenic
1001266436 5:170277846-170277868 AAAGAGAAGGAGGAAGGGGAGGG + Intronic
1001343045 5:170864612-170864634 ATTGAGAAGAAGTAAGAGGTAGG + Intronic
1001469541 5:172001099-172001121 ATAGAGAAGAAAGATGGGGAGGG - Intronic
1001826018 5:174745664-174745686 AAAGAGAAGAGAGCAGGGGAGGG - Intergenic
1001937455 5:175715472-175715494 CTAGAGGAGAAGGTAGGGGTGGG + Intergenic
1002304565 5:178275512-178275534 TTAGGGAAGAAGGGAGGGGGAGG + Intronic
1002454569 5:179338824-179338846 CAAGAGCAGAAAGCAGGGGTTGG + Intronic
1002702136 5:181131577-181131599 ATAGAGGAGAAGGCCGGTGTGGG - Intergenic
1002850905 6:995635-995657 AGAGGGAAGGAGGCAGGGGCTGG - Intergenic
1002886078 6:1295499-1295521 AGGGAGAGGAAGGCAGGGGAGGG - Intergenic
1003277889 6:4667837-4667859 AGAGAGAAGAAGGCTAGGGGTGG - Intergenic
1003351287 6:5319804-5319826 GGAGACAAGAAGGTAGGGGTGGG + Intronic
1003357645 6:5389312-5389334 AGAGAGAAGATGGCAAGGGAGGG - Intronic
1003595393 6:7469931-7469953 ATAGACCACAAGGCAGGGATGGG - Intergenic
1003596344 6:7477534-7477556 ATAGACCACAAGGCAGGGATAGG + Intergenic
1004154965 6:13159268-13159290 TAAGAGAAGAAGGCAGTGGAGGG + Intronic
1004681104 6:17895546-17895568 ATTGAGATGCAGCCAGGGGTAGG - Intronic
1005195639 6:23280681-23280703 TTAGAGAAGTAGGGAGGGATGGG + Intergenic
1005843500 6:29759962-29759984 ACAGGAAAGAAGGCAGAGGTGGG - Intergenic
1006289815 6:33126096-33126118 ATAAAGAAAAACACAGGGGTAGG + Intergenic
1006449528 6:34098214-34098236 TTAGAGAGAAAGGCAGGGCTAGG + Intronic
1006629214 6:35419182-35419204 TTAGAGAAGAGTGCAGAGGTTGG + Intronic
1007446484 6:41910334-41910356 AAACAAAAGAAGGCAGGGCTGGG + Intronic
1007568664 6:42873182-42873204 ATAGACAAGAAAGCTGGGGTAGG - Intergenic
1007665717 6:43511894-43511916 ATAAAGAGGAAGGAAGGGGTAGG + Exonic
1008082055 6:47204923-47204945 ATGGAGAATGAGGCAGGGCTGGG - Intergenic
1008448756 6:51624582-51624604 TTTTAGAAGAAGGCAGGGGCGGG + Intronic
1008623061 6:53290858-53290880 GTAAAGAAGAAGGTAGAGGTGGG - Intronic
1010290011 6:74124598-74124620 AAAGAGAAAAAGGCAGGATTGGG - Intergenic
1010991205 6:82482310-82482332 AGAGAGAAGGAGGAAGGGGCTGG - Intergenic
1011243740 6:85300050-85300072 ATATATAAGAAGGCAGCTGTAGG + Intergenic
1011441221 6:87389587-87389609 ATACAGAAACAGGCAGGGGCTGG + Intronic
1011522073 6:88218774-88218796 ATAGAGATGAAGCCCTGGGTAGG + Intergenic
1011587762 6:88945082-88945104 CCTGAGAAGGAGGCAGGGGTTGG - Intronic
1012496608 6:99840473-99840495 ATAGATAGCAAGGCATGGGTAGG + Intergenic
1012649276 6:101733366-101733388 ATAGAAAAGAATAAAGGGGTGGG + Intronic
1012926435 6:105272870-105272892 ACTGAGAAGCAGGCAGGGGGAGG - Intergenic
1012963673 6:105649339-105649361 ACAGAAAAGAAGGGAGGGATGGG - Intergenic
1013269631 6:108533998-108534020 AGAGAGAGGAAGGAAGGGGAAGG + Intergenic
1013269643 6:108534054-108534076 AGAGAGAGGAAGGAAGGGGAAGG + Intergenic
1013491156 6:110647089-110647111 ATAGAGGGGAGTGCAGGGGTCGG - Intronic
1013541917 6:111118973-111118995 ATGCTGAAGAAGGCAGGGATGGG + Intronic
1013691431 6:112649274-112649296 AAAATAAAGAAGGCAGGGGTTGG + Intergenic
1013993000 6:116276477-116276499 AAAGAGAAGAAAGCAGGGCACGG - Intronic
1014251285 6:119117868-119117890 TGAGAGAAACAGGCAGGGGTGGG + Intronic
1014271243 6:119338989-119339011 ATAGAGAAGATGGCAGAGCTTGG - Intronic
1014363055 6:120505092-120505114 ATTGGGAAGAAGGCAAGAGTTGG - Intergenic
1014948009 6:127519019-127519041 AAAGAGAAGAAGGCGGGGAGGGG + Exonic
1015031619 6:128602246-128602268 AGAGAGAAGCAAGCAAGGGTAGG - Intergenic
1016205860 6:141467388-141467410 AAACAAAACAAGGCAGGGGTAGG + Intergenic
1016518048 6:144918790-144918812 ATAGACAGGGAGGCAGGGGATGG - Intergenic
1016554111 6:145316057-145316079 AAAGAAAAGAAGTCAGGGGCAGG + Intergenic
1016725346 6:147358833-147358855 AAAGAGAAAGAGGGAGGGGTTGG + Intronic
1017509385 6:155100267-155100289 ATAGAGCAGGAGGCAGGAGCAGG + Intronic
1017863563 6:158422583-158422605 ATAGACAAGAAGGAAGCGGAAGG + Intronic
1018402607 6:163440135-163440157 ATAGAGAAGAAGGAAAAGATGGG - Intronic
1018766384 6:166936571-166936593 CCAGAGAGGAAGCCAGGGGTTGG + Intronic
1018987258 6:168647297-168647319 AGTGAGAAGAAGGCCGGGGGCGG + Intronic
1019304786 7:328142-328164 ACAGAGAACCAGGCAGGTGTGGG - Intergenic
1019812823 7:3176968-3176990 GTAGAGAAGGAGGCAGAGATTGG + Intergenic
1019883741 7:3885571-3885593 AGAGGGAGGAAGGCAGGGCTGGG - Intronic
1019931965 7:4229936-4229958 ACAAAGAGGAATGCAGGGGTTGG + Intronic
1019983421 7:4638443-4638465 GTAAAGAAGAAGGCAGAGGCTGG - Intergenic
1020321785 7:6944175-6944197 AAAGAGAAAAAGGAAGGGATTGG - Intergenic
1021797056 7:24266364-24266386 ACAAAGAAGAAGGCAGGGGCTGG + Intergenic
1022341756 7:29475088-29475110 ATAGACAAGGAGGAAAGGGTGGG - Intronic
1022478124 7:30725207-30725229 ATGGAGACGCAGGCAGAGGTTGG + Intronic
1022511948 7:30941481-30941503 AAAGAAAAGAAGGCAGAGGAGGG - Intronic
1023143162 7:37122460-37122482 AAACAAAAAAAGGCAGGGGTTGG + Intronic
1023147539 7:37167156-37167178 AAACAAAAAAAGGCAGGGGTTGG - Intronic
1023153995 7:37229476-37229498 ATAGAGAAGGAGACAGAGGCTGG + Intronic
1023473276 7:40548860-40548882 ATAGATAAGAAGACATGGATTGG - Intronic
1024235485 7:47394367-47394389 AGACACAAGAAGGCAGGAGTTGG + Intronic
1026062932 7:67042544-67042566 ATAGAGAAGGAAGATGGGGTAGG + Intronic
1026179757 7:68028637-68028659 ACAGAGAAGAAGGCATGTTTGGG - Intergenic
1026529553 7:71185148-71185170 ACAGAGAGGAAGGAAGGGGAGGG - Intronic
1026715417 7:72784946-72784968 ATAGAGAAGGAAGATGGGGTAGG - Intronic
1026882384 7:73915768-73915790 TTAGAAGAGAAGGCAGGGGCTGG - Intergenic
1027189349 7:75988609-75988631 ATGGAGGAGAAGGCCGGGTTGGG + Intronic
1027453958 7:78364032-78364054 ATAGAGAAGAAGGAGGAGGGAGG - Intronic
1028381077 7:90199062-90199084 GTAAAGAAAAAGGCATGGGTGGG + Intronic
1028733509 7:94180080-94180102 ATACACAAGTGGGCAGGGGTAGG + Intergenic
1028742536 7:94292166-94292188 TTAGAGAAAAAGGCAGAAGTTGG + Intergenic
1029065486 7:97843879-97843901 ATACAGGAGAAAGCAAGGGTTGG - Intergenic
1029304898 7:99611868-99611890 ATAGAGATGAAGCCAGTGGAGGG - Intergenic
1029489209 7:100861288-100861310 AGAGAGAAGAAGGGAGGACTCGG + Intronic
1029522016 7:101068859-101068881 ATGAAGACGAAGGCAGGGATTGG - Intergenic
1029646605 7:101860788-101860810 AGAGAGAAGAAGAGAGGGGAAGG - Intronic
1030164747 7:106542854-106542876 ATAAAGAAAAATGCTGGGGTTGG + Intergenic
1030185741 7:106759964-106759986 ATAGACAAGAGGGCAGGGAGAGG + Intergenic
1030230433 7:107203129-107203151 TTAGTGAAGAAGGCAGGGTTGGG + Exonic
1030385277 7:108860719-108860741 AGAGAGAAAATGACAGGGGTAGG - Intergenic
1030653752 7:112143756-112143778 CTAGAGGAGATGGCTGGGGTTGG - Intronic
1030778717 7:113570137-113570159 ATAGAAGAGAAGGCAGGATTTGG + Intergenic
1030779938 7:113587865-113587887 ATAGTGGGGAAGGCTGGGGTAGG - Intergenic
1030964876 7:115979312-115979334 ATAGAAAAGAAGGCAGATGGTGG - Intronic
1031318476 7:120289000-120289022 GGAGAGAGGAAGGCAGAGGTGGG + Intronic
1031414017 7:121474081-121474103 AGAGAAGAGAAGGCAGGGCTAGG - Intergenic
1031827008 7:126577922-126577944 ATAGAGAAAGAAGCATGGGTTGG - Intronic
1032199299 7:129808127-129808149 ATAGAGAAGAGGGAAGGGGAGGG - Intergenic
1032902713 7:136328700-136328722 AGAGAGAAGAGGGAAGGGGCAGG + Intergenic
1033732236 7:144191284-144191306 CTAGAGAAGAAGGCAGAGCCAGG - Intronic
1033743087 7:144289869-144289891 CTAGAGAAGAAGGCAGAGCCAGG - Intergenic
1033750811 7:144359730-144359752 CTAGAGAAGAAGGCAGAGCCAGG + Intronic
1034386575 7:150745500-150745522 AAAGAGAAGAAGGCAGACATGGG - Intronic
1034621662 7:152461849-152461871 AGAGAGAAGAGGGAAGGGGAGGG + Intergenic
1034721964 7:153301630-153301652 ATAGAGAAGAAGGCTGAATTGGG + Intergenic
1034836763 7:154359436-154359458 ACACAGCAGAAGGCAGGGGCTGG - Intronic
1034859875 7:154585946-154585968 AAGGAGAGGAAGGCAGGGGAAGG + Intronic
1035831115 8:2695304-2695326 CTGAAGAAGAAGGCAGAGGTTGG - Intergenic
1035850637 8:2915829-2915851 AGAGAGAAGAAGGCACGTGGAGG + Intergenic
1035907681 8:3531511-3531533 ATAAAGAAGAAGGCAGTGAGAGG + Intronic
1036164782 8:6422561-6422583 ATAGAGAATGAGTCAGGGGCTGG - Intronic
1036226773 8:6965731-6965753 ATAAAGAATAAGTCAGAGGTGGG - Intergenic
1036408536 8:8477500-8477522 AAGGAGAAGAAGGCAGGGCCAGG + Intergenic
1036441918 8:8789251-8789273 ATAGGGAAGAAAGCAGAGGAAGG + Intronic
1036716937 8:11134174-11134196 ATAGAGGAGAAGGTAAGGGTGGG - Intronic
1036743795 8:11389968-11389990 AGAGAGAAGCAGGGATGGGTGGG + Intergenic
1036916640 8:12810716-12810738 AGGGAGAAGAAGGAAGGGGAGGG - Intergenic
1036988567 8:13566177-13566199 AAAGAGTTTAAGGCAGGGGTGGG + Intergenic
1037384069 8:18318673-18318695 GTAAAGAAGAAGACAGGAGTGGG - Intergenic
1037512775 8:19600368-19600390 ATAGAGAAGTAGGCTGGGTGCGG - Intronic
1037661932 8:20935257-20935279 ACAGAGAGGAAGGCAGGGGTGGG - Intergenic
1038476376 8:27871373-27871395 ATAGAGGAGAAGCCAGCTGTAGG - Exonic
1038535967 8:28352940-28352962 ACAGGAAAGAAGGCAGGGATTGG + Intronic
1038712542 8:29961236-29961258 ATAGAGAAGAAAGGAAGGCTTGG - Intergenic
1038734226 8:30154925-30154947 AGAGAGAAGTAGGCAGGGGCTGG + Intronic
1038740258 8:30211069-30211091 ATAGAAAGAAAGGCAGGGGTGGG - Intergenic
1039341664 8:36657490-36657512 ATAGAAATGAAGGCAGTGGCAGG - Intergenic
1039459193 8:37729172-37729194 AAAGAAAAGAAGGAAGGGGCAGG + Intergenic
1040351452 8:46572741-46572763 ATACAGGAGAAAGCAAGGGTTGG - Intergenic
1040365221 8:46708697-46708719 ATACAGGAGAAAGCAAGGGTTGG + Intergenic
1040884754 8:52249411-52249433 ATGTAGAATAAAGCAGGGGTGGG + Intronic
1041242915 8:55863645-55863667 AAAGAGAAGAGGGAAGGGGAGGG + Intergenic
1041541736 8:58992505-58992527 ATACAGAAGAAAGAAGGAGTTGG - Intronic
1041740494 8:61152006-61152028 ATAGAAAAGAAAGCTGGGGGCGG - Intronic
1041907911 8:63053817-63053839 ATAGAGAAGAAAGAAATGGTAGG + Intronic
1042130477 8:65582724-65582746 AAGGAGAAGGAGGCAGGGGAAGG + Intergenic
1042194484 8:66220816-66220838 AGAGAGAAAAGGGCAGGGATGGG + Intergenic
1042343502 8:67704566-67704588 ACAGAGATGAAGGCAAGGTTAGG + Intronic
1042579158 8:70257540-70257562 TTAGAGAAGAGGGCAGGAGGTGG + Intronic
1042778675 8:72465890-72465912 ATACAGAAGAGAGCAGGGGAAGG - Intergenic
1043059523 8:75482358-75482380 ATGGAGCAGAAGGGAGGGGAGGG - Intronic
1043491077 8:80749719-80749741 ATAGAGAAAAACCCAGGGCTTGG + Intronic
1043515194 8:80989609-80989631 ATGAGGAAGAAGGCAGGGGATGG + Intronic
1043817722 8:84823630-84823652 TAAGAGAAGAAGGCAGAGGTGGG - Intronic
1043927107 8:86049622-86049644 AGAGAGAAGAGGGGAGGGGAAGG + Intronic
1043956070 8:86360999-86361021 AAAGAGGAGAAGGAAGAGGTGGG + Intronic
1043998221 8:86844929-86844951 ATAGAGAAAGAGATAGGGGTAGG + Intergenic
1044751091 8:95416030-95416052 AAAGAGAAGAAAGAAGGGGGTGG - Intergenic
1045154031 8:99445861-99445883 ATATAGAATAAGGCAGAGGTTGG + Intronic
1045939245 8:107718640-107718662 ATAGAGAAGAAGGAACTGGAAGG + Intergenic
1047153505 8:122292132-122292154 ATAGATAACAAGGCCAGGGTTGG - Intergenic
1047629539 8:126692105-126692127 AGAGAGAAGAAGGGAAGGGAAGG - Intergenic
1047716184 8:127597311-127597333 ATAAAGATGAAGGCAGAGGTTGG + Intergenic
1048118609 8:131553802-131553824 ATGAAGAAGAAGGCAGTGGCTGG + Intergenic
1048382773 8:133882675-133882697 ACAGGGAAGAAGGCAGGAGACGG - Intergenic
1048812907 8:138304578-138304600 AGAAAGAAAAAGGAAGGGGTAGG + Intronic
1049384078 8:142332044-142332066 GGAGAGACGAAGGCAGGGGGTGG + Intronic
1050148023 9:2591048-2591070 AGAGGGAATAAGGCAGGGGCAGG + Intergenic
1050495382 9:6235337-6235359 ATAAAGAATAAGTCAGGGCTGGG - Intronic
1050556089 9:6790744-6790766 ATTTAGAAGAAGGTTGGGGTGGG + Intronic
1051008680 9:12382208-12382230 ATATAGAAGAAGTTGGGGGTCGG - Intergenic
1051430201 9:16973672-16973694 TTAGTGAAGAAGACAGTGGTGGG + Intergenic
1051829196 9:21256862-21256884 ACAGAGATGAAGGCAAGGTTAGG + Intergenic
1051872029 9:21749142-21749164 AAAGAAAAGAAGGCAGGATTGGG + Intergenic
1052780511 9:32777881-32777903 ATAGAGTAGAAGGGAGATGTTGG - Intergenic
1053148219 9:35726386-35726408 AATGAAAAGAAGGCAGGAGTAGG - Intronic
1053149414 9:35733075-35733097 ATGGTGGACAAGGCAGGGGTTGG - Exonic
1053240673 9:36492325-36492347 ATGAAGAAAAAGGTAGGGGTGGG - Intergenic
1053432575 9:38052794-38052816 ATGGAGGAGAAGCCAGGTGTGGG - Intronic
1053791202 9:41687430-41687452 AATGAGAAGAGGGCAGGGGGTGG + Intergenic
1054153951 9:61627342-61627364 AATGAGAAGAGGGCAGGGGGTGG - Intergenic
1054179550 9:61899124-61899146 AATGAGAAGAGGGCAGGGGGTGG + Intergenic
1054657988 9:67681697-67681719 AATGAGAAGAGGGCAGGGGGTGG - Intergenic
1055132395 9:72791209-72791231 CAAGAGAATAATGCAGGGGTGGG - Intronic
1055330548 9:75178566-75178588 AAAGGGAAAAAGGCAGGGGGGGG + Intergenic
1055856523 9:80694534-80694556 AAAGAGAAGGAGACAGGAGTAGG + Intergenic
1056266485 9:84901760-84901782 ATGGAGAAGAAGCCAGGGGAGGG - Intronic
1056887538 9:90457709-90457731 CTGGAGAAGAAGGCATGGGCTGG - Intergenic
1056939912 9:90946182-90946204 ATTGAGAAGAGGGCAGGGGAAGG + Intergenic
1056951237 9:91042415-91042437 ATAGAGAAAAACTCAGTGGTGGG - Intergenic
1057307890 9:93922759-93922781 ACAGAGAAGAAGGAAGAGGGAGG + Intergenic
1057469513 9:95344976-95344998 AGAAAGACCAAGGCAGGGGTAGG - Intergenic
1057721270 9:97534012-97534034 ATAGAGAAAAAGGGATGGGGAGG + Intronic
1057810486 9:98253444-98253466 ATAGAGAAGAAACTAGGGGAAGG - Intronic
1057977535 9:99622205-99622227 CTTCAGCAGAAGGCAGGGGTAGG - Intergenic
1058447873 9:105069756-105069778 ATAGAGGTGAAGGGAGGAGTTGG - Intergenic
1058824927 9:108766806-108766828 GCAGAGAGGAAGGCAGAGGTGGG + Intergenic
1059639798 9:116205329-116205351 AGAGAGAAAAAGGGTGGGGTAGG - Intronic
1060122891 9:121011947-121011969 ATAGAGTAGAAGGCTGGGAAGGG + Intronic
1060294163 9:122332073-122332095 ATAGAGACGGAGGGAGGGGTGGG - Intergenic
1061026850 9:128055349-128055371 AGGGAGAAGAAGGGAGGGGAAGG + Intergenic
1061237174 9:129350018-129350040 ATACAGAAGGATGCAGGGGTAGG + Intergenic
1061905734 9:133695975-133695997 GTAGAGAGGAAGGCAGAGGTAGG + Intronic
1203485660 Un_GL000224v1:51700-51722 AAAGAGAGGATGGCAGGGATTGG - Intergenic
1185533101 X:837737-837759 ATAGAGCAGGAAGCAGGGGCAGG + Intergenic
1185543999 X:926938-926960 ATAGAGATGAAGGCAGAGACTGG - Intergenic
1185780325 X:2838448-2838470 AGAGAGAGGAAGGGAGGGGAGGG - Intronic
1186643752 X:11484270-11484292 AAAGAGAGGAGGGCAGGGGAGGG + Intronic
1186829642 X:13377938-13377960 ATAAAGAAGAATAAAGGGGTGGG - Intergenic
1186943629 X:14540540-14540562 ATAGAAGAGAAGAGAGGGGTTGG + Intronic
1186959825 X:14723718-14723740 AAAGAGGTGAAGGCAGGGTTTGG - Intronic
1187201031 X:17133949-17133971 AGAGATAAGAAGCCCGGGGTGGG - Intronic
1187397380 X:18930482-18930504 AGAGAGGAGAAAGCAGGGGAGGG + Intronic
1187549537 X:20288139-20288161 ATAGAGAACAATGGAGGGGAAGG - Intergenic
1187896927 X:23990769-23990791 AGAGAGGAGAAGGAAGGGGGGGG - Intronic
1188883041 X:35513607-35513629 ATAGAGAAGAAGAGATGTGTGGG - Intergenic
1189106257 X:38238746-38238768 AAAGAGAAGACAGCAGGAGTGGG + Intronic
1189200787 X:39194053-39194075 TGAGTGAAGAAGGCAGGGCTGGG + Intergenic
1189214494 X:39311417-39311439 AGAGAGAAGAACACAGGGGACGG + Intergenic
1189432391 X:40959156-40959178 ATAGAGAGGGAGGCAGGGATTGG - Intergenic
1189850662 X:45173331-45173353 ATAGAGGAGCAGGCTTGGGTAGG + Intronic
1189954201 X:46261563-46261585 CTAGAGAAGAAGGCATCTGTAGG + Intergenic
1190303024 X:49067426-49067448 CGGGAGGAGAAGGCAGGGGTTGG - Exonic
1191785572 X:64914083-64914105 AGAGAGAAGAAGGAAGAGGAGGG - Intergenic
1191870981 X:65744761-65744783 TTAAAGAACAAGGCAGGGGATGG + Intergenic
1192558292 X:72107745-72107767 GTGGAAAAGAGGGCAGGGGTGGG + Intergenic
1195116743 X:101706961-101706983 ATAGAGTAGTAGCCAGGGGCGGG + Intergenic
1196061265 X:111410612-111410634 ATAGAGAAGAAGGAGGGGCTGGG + Intronic
1196551780 X:117036768-117036790 ATAGAGCACAAGGCAAGGATGGG - Intergenic
1197226938 X:123963053-123963075 ACAGAAAAAAAGGCAGAGGTTGG - Intronic
1197271170 X:124426230-124426252 ATAGAGAACAAGTGAGTGGTAGG - Intronic
1197585221 X:128338560-128338582 ATAGAGAACAAGTGAGTGGTGGG + Intergenic
1198201469 X:134423700-134423722 GTAGAATAAAAGGCAGGGGTGGG - Intronic
1199101085 X:143801327-143801349 AAAGAGAAGAAGGCTGGGAGCGG + Intergenic
1199145729 X:144363945-144363967 ATAGAGAAAGAGATAGGGGTAGG + Intergenic
1199377787 X:147133615-147133637 ATAGTGAAGGAGGCAAGGGGTGG + Intergenic
1199560763 X:149160287-149160309 ATTGAGTAAAAGGCAGAGGTTGG - Intergenic
1199874666 X:151920661-151920683 ATGGGGATGAAGGTAGGGGTGGG - Intronic
1199882531 X:151986016-151986038 AGGGAGGAGAAGGCTGGGGTAGG - Intergenic
1200147880 X:153935720-153935742 ACAAAGATGAAAGCAGGGGTGGG + Intronic
1201465293 Y:14274136-14274158 ATTGAGAGGATTGCAGGGGTGGG - Intergenic
1201615049 Y:15887621-15887643 AAACAAAAAAAGGCAGGGGTTGG + Intergenic