ID: 1130040708

View in Genome Browser
Species Human (GRCh38)
Location 15:80403953-80403975
Sequence ATTTAGATTCAGAGGGAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130040708_1130040724 25 Left 1130040708 15:80403953-80403975 CCGGCTTCCCTCTGAATCTAAAT No data
Right 1130040724 15:80404001-80404023 CTGGCCTCCTGGCCTGGGCACGG No data
1130040708_1130040717 14 Left 1130040708 15:80403953-80403975 CCGGCTTCCCTCTGAATCTAAAT No data
Right 1130040717 15:80403990-80404012 CCCGCTCCGCCCTGGCCTCCTGG No data
1130040708_1130040713 6 Left 1130040708 15:80403953-80403975 CCGGCTTCCCTCTGAATCTAAAT No data
Right 1130040713 15:80403982-80404004 CTCCCTCACCCGCTCCGCCCTGG No data
1130040708_1130040719 19 Left 1130040708 15:80403953-80403975 CCGGCTTCCCTCTGAATCTAAAT No data
Right 1130040719 15:80403995-80404017 TCCGCCCTGGCCTCCTGGCCTGG No data
1130040708_1130040721 20 Left 1130040708 15:80403953-80403975 CCGGCTTCCCTCTGAATCTAAAT No data
Right 1130040721 15:80403996-80404018 CCGCCCTGGCCTCCTGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130040708 Original CRISPR ATTTAGATTCAGAGGGAAGC CGG (reversed) Intergenic
No off target data available for this crispr