ID: 1130040913

View in Genome Browser
Species Human (GRCh38)
Location 15:80404579-80404601
Sequence CAGCCCGCAGGCCTTGCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 198}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130040902_1130040913 -2 Left 1130040902 15:80404558-80404580 CCTGGGCCCCGCCGCCCGCCGCA 0: 1
1: 0
2: 19
3: 129
4: 761
Right 1130040913 15:80404579-80404601 CAGCCCGCAGGCCTTGCCCGGGG 0: 1
1: 0
2: 1
3: 23
4: 198
1130040901_1130040913 13 Left 1130040901 15:80404543-80404565 CCGGGTGAGTAGCGGCCTGGGCC 0: 1
1: 0
2: 3
3: 13
4: 219
Right 1130040913 15:80404579-80404601 CAGCCCGCAGGCCTTGCCCGGGG 0: 1
1: 0
2: 1
3: 23
4: 198
1130040904_1130040913 -9 Left 1130040904 15:80404565-80404587 CCCGCCGCCCGCCGCAGCCCGCA 0: 1
1: 0
2: 5
3: 59
4: 563
Right 1130040913 15:80404579-80404601 CAGCCCGCAGGCCTTGCCCGGGG 0: 1
1: 0
2: 1
3: 23
4: 198
1130040903_1130040913 -8 Left 1130040903 15:80404564-80404586 CCCCGCCGCCCGCCGCAGCCCGC 0: 1
1: 1
2: 10
3: 139
4: 936
Right 1130040913 15:80404579-80404601 CAGCCCGCAGGCCTTGCCCGGGG 0: 1
1: 0
2: 1
3: 23
4: 198
1130040898_1130040913 16 Left 1130040898 15:80404540-80404562 CCTCCGGGTGAGTAGCGGCCTGG 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1130040913 15:80404579-80404601 CAGCCCGCAGGCCTTGCCCGGGG 0: 1
1: 0
2: 1
3: 23
4: 198
1130040905_1130040913 -10 Left 1130040905 15:80404566-80404588 CCGCCGCCCGCCGCAGCCCGCAG 0: 1
1: 0
2: 7
3: 75
4: 612
Right 1130040913 15:80404579-80404601 CAGCCCGCAGGCCTTGCCCGGGG 0: 1
1: 0
2: 1
3: 23
4: 198
1130040897_1130040913 17 Left 1130040897 15:80404539-80404561 CCCTCCGGGTGAGTAGCGGCCTG 0: 1
1: 0
2: 0
3: 9
4: 35
Right 1130040913 15:80404579-80404601 CAGCCCGCAGGCCTTGCCCGGGG 0: 1
1: 0
2: 1
3: 23
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130040913 Original CRISPR CAGCCCGCAGGCCTTGCCCG GGG Intronic
900157470 1:1208967-1208989 CAGCCTGCAGGCCCTGCACAGGG - Intergenic
900488583 1:2935220-2935242 CAGCCCTCAGGGCTGCCCCGTGG + Intergenic
900531431 1:3155318-3155340 CAGGCTGCAGGGCTTGGCCGCGG + Intronic
900677810 1:3899822-3899844 GAGCTCCCAGGCCATGCCCGCGG - Intronic
900766473 1:4509351-4509373 CAGCAAGCAGGGCTGGCCCGAGG + Intergenic
900956125 1:5887439-5887461 CAGCCGGCCGGCCTTGGCGGAGG + Exonic
901063732 1:6485387-6485409 CAGCCTCCAGGCCGGGCCCGGGG - Intronic
902067593 1:13700602-13700624 CAGCCCGCACGCGTCCCCCGCGG - Intronic
902634122 1:17724067-17724089 CAGCCCACTGGCCTTGACCTTGG + Intergenic
902662759 1:17916840-17916862 CAGCCCCCAGCCCTTACCCGGGG - Intergenic
903336303 1:22626896-22626918 CAGCCCACAAGCCCTGCCCTAGG - Intergenic
903668505 1:25022237-25022259 CAGCCCTCAGGCCTAGGCCAGGG - Intergenic
908480529 1:64534864-64534886 CAGCCCCCTGGCCTTGCCCTTGG + Intronic
910398255 1:86812847-86812869 CTGCCCCCAGGCCTGGCCCATGG - Intergenic
918066582 1:181105564-181105586 CAGCCCCCGGGCCGTGCCAGTGG + Intergenic
919922053 1:202171819-202171841 CAGCTGGAAGGCCTTGCCAGGGG + Intergenic
920275098 1:204798693-204798715 CAGCCAGCAGGGCCTGCCAGAGG + Intergenic
921189882 1:212699796-212699818 CCGCCCGCGCGCCCTGCCCGTGG + Exonic
922485416 1:225969864-225969886 CAGCCGGCAGGGCTGGCCCTGGG + Intergenic
922753418 1:228081726-228081748 CACCCCTCAGGCCCTGCCCCCGG + Intergenic
1067567872 10:47351189-47351211 CAGGTCCCAGGCCTTGCCTGTGG - Exonic
1067575571 10:47406390-47406412 CTGCCCGCAGGCTCTGCCCATGG + Intergenic
1067784095 10:49229890-49229912 CAGCCCACAGGCCTTGGCTAGGG - Intergenic
1069898360 10:71692836-71692858 TAGCACACAGGCCCTGCCCGTGG + Intronic
1071544738 10:86521103-86521125 CAGCCCCGAGTCCTTTCCCGTGG - Intronic
1072187983 10:93060556-93060578 GAACCCGCAGGCCCCGCCCGAGG + Intergenic
1074867340 10:117552561-117552583 CTGCTCGGAGGCCTGGCCCGGGG + Intergenic
1075323343 10:121510210-121510232 CCTCCCGCAGGCCTTTCCCTGGG + Intronic
1076064681 10:127439900-127439922 CAGCCCTCAGGCCCAGCCCCAGG - Intronic
1076427714 10:130379474-130379496 CAGCCTGCAGGCCCTGGCCAGGG - Intergenic
1077107192 11:847373-847395 CAGCCCAGGGGCCTTGCCAGCGG + Intronic
1077365501 11:2159938-2159960 CAGCCTGCAGCCCTTGGCCCTGG - Exonic
1079136233 11:17777272-17777294 CAGCCTGCAGTTCTTGCCTGGGG - Intronic
1079782264 11:24622442-24622464 CAGCCTGCTTGCCTTGGCCGTGG + Intronic
1081675525 11:44966852-44966874 CAGCCAGCAGGCCGGGCCCAGGG - Intergenic
1084888244 11:72224220-72224242 CTCCCCGCAGGCTTTGCCGGGGG + Intronic
1085455835 11:76664911-76664933 CTGCCCGCAGCCCTTCCCTGGGG - Intronic
1087027283 11:93661923-93661945 CAGGCCGTGGGCCCTGCCCGCGG + Intronic
1091567941 12:1662005-1662027 CACCCCGCGGGCCATGCCAGCGG + Intergenic
1096521119 12:52185335-52185357 CAGCCCTCAGGCCTTGCTCATGG + Intronic
1096811433 12:54172914-54172936 CAGTCTGCAGGCCTTCCCCACGG + Intronic
1097107949 12:56636142-56636164 CATCCCTCAGGCCTTCCCCGGGG + Intronic
1099956059 12:89353534-89353556 CAGCCTGCAGGTCTTGCGGGAGG - Intergenic
1101353651 12:103956729-103956751 CAGCCTGCCGACCATGCCCGCGG - Exonic
1103374746 12:120446845-120446867 CAGCCCCGAAGCCTTGACCGTGG + Intronic
1104805535 12:131587008-131587030 CAGCCTTCAGGCCTTACCAGGGG - Intergenic
1109472092 13:62821375-62821397 CATCCTGCAGGACTTGCCTGGGG - Intergenic
1112597268 13:100818892-100818914 CAGCCCTCTGGCCATGCCTGGGG - Intergenic
1113297046 13:108970516-108970538 GCCCCCGCAGGCCTTGCCTGTGG - Intronic
1113959162 13:114116226-114116248 AAGACAGCAGGCCTGGCCCGAGG - Intronic
1116886935 14:50231315-50231337 CAGCCCGCGGGCCGGGCCGGTGG + Exonic
1118870431 14:69736764-69736786 CATCCCTCAGGCCTGGCCCTGGG - Intronic
1119201074 14:72753359-72753381 CTGTCCACAGGCCTTGCCCCGGG - Exonic
1122193661 14:100068361-100068383 CAGCTCGCAGGCTTTGCCGTTGG - Intronic
1122298300 14:100717754-100717776 CAGCCCGTTAGGCTTGCCCGAGG - Intergenic
1122647676 14:103206127-103206149 CAGCCTCCAGGCCTTGCTCAAGG - Intergenic
1122967091 14:105136459-105136481 CAGCCCGGTGGCCTCCCCCGTGG + Intergenic
1123978764 15:25579228-25579250 CAGCCTGCAGGCCTACCCTGTGG - Intergenic
1124138640 15:27057571-27057593 CAGCCCAGAGGCCTTTCCAGGGG - Intronic
1124468445 15:29961670-29961692 CAGACCACAGGCCTGGCCCCTGG + Intronic
1124631927 15:31342986-31343008 CAGCAAGCAGGCCCTGCCTGGGG - Intronic
1125112244 15:36047188-36047210 CAGTCCGGAGGCCTGCCCCGCGG - Intergenic
1130040913 15:80404579-80404601 CAGCCCGCAGGCCTTGCCCGGGG + Intronic
1130948061 15:88564056-88564078 CAGCCAATAGGCCTTGCCAGTGG + Intergenic
1131003128 15:88954534-88954556 CAGCCAGCAGGCCTGGACCCAGG + Intergenic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1131625836 15:94119590-94119612 CAGCCAGCAGCACTTGCCCGGGG - Intergenic
1132365102 15:101251507-101251529 CAGCCCGCTGCCCCCGCCCGCGG + Exonic
1132715519 16:1288275-1288297 CACCCAGCAGGTCTTCCCCGAGG + Intergenic
1132870566 16:2114026-2114048 CAGCCAGCAGGACCTGCCCGGGG + Intronic
1132893151 16:2214406-2214428 CAGCACGTAGGCCTTGGGCGCGG + Exonic
1134521966 16:14922878-14922900 CAGCCAGCAGGACCTGCCCGGGG - Intronic
1134709636 16:16321529-16321551 CAGCCAGCAGGACCTGCCCGGGG - Intergenic
1134716849 16:16361558-16361580 CAGCCAGCAGGACCTGCCCGGGG - Intergenic
1134949967 16:18347116-18347138 CAGCCAGCAGGACCTGCCCGGGG + Intergenic
1134957903 16:18390601-18390623 CAGCCAGCAGGACCTGCCCGGGG + Intergenic
1135822485 16:25696332-25696354 CAGCCAGTTGGCCTGGCCCGAGG - Intronic
1136619153 16:31416502-31416524 CAGCCTGCAGACCCTGACCGTGG + Exonic
1137349069 16:47694756-47694778 CAGACAGGAGGCCTTGCCAGAGG - Intronic
1138436680 16:57004687-57004709 CAGCCCACAGGCCTTTGCCTTGG - Intronic
1138491674 16:57380774-57380796 CAGCCCTGAGGCCTTTCCCCAGG + Intronic
1141675488 16:85515271-85515293 CAGCCCGGAGGCAGTGCCCGGGG + Intergenic
1142187500 16:88701465-88701487 CGAACCGCAGGCCTTGCTCGGGG + Intronic
1142323089 16:89397466-89397488 CAGGAAGCAGGCCTTCCCCGTGG + Intronic
1143151371 17:4809158-4809180 GAGCCCTCAGGACCTGCCCGGGG - Exonic
1144207770 17:12991099-12991121 CACACCGCAGGCCGAGCCCGTGG - Exonic
1144497263 17:15756615-15756637 GAGCAGGCAGGCTTTGCCCGTGG - Intergenic
1145003252 17:19320310-19320332 CAGTCCCCAGGCCTGGCCCCAGG - Intronic
1145060470 17:19730063-19730085 CAGCCCGCCGGCCTCGCCTCAGG + Intergenic
1145199328 17:20927848-20927870 CAGCCCGCCGGCCTACCCTGCGG + Intergenic
1146492404 17:33292331-33292353 CAGCCCGCAGCCCCTGGCAGTGG + Exonic
1148203420 17:45764973-45764995 CAGCCACCAGGCCTGGCCCCAGG + Intergenic
1150136312 17:62697194-62697216 AAGCCTGCAGGCTTTCCCCGGGG - Intergenic
1151147702 17:72056873-72056895 CAGCCCAGAGGCCTGGCCTGTGG + Intergenic
1151591495 17:75047373-75047395 CAGCCGGGCGGCCGTGCCCGCGG - Exonic
1151925587 17:77193828-77193850 CAGCCCCCAGGCCTTGCTGCAGG + Intronic
1152484294 17:80579646-80579668 GAGCCTGCTGGCCTTGCCCAAGG + Intronic
1152545553 17:80998518-80998540 CAGGCAGCAGGGCTTGCCCACGG - Intronic
1155149773 18:23113724-23113746 GAGCCCCCAGGCCATGCCCATGG - Intergenic
1157627448 18:49062400-49062422 CAGTCCCCAGGCCTTGACTGTGG + Intronic
1159800901 18:72898260-72898282 GAGTCCGCAGGCCTTGCCCAGGG + Intergenic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1161944813 19:7429003-7429025 AAGCCCGCAGGCCTAGGCCACGG + Intronic
1162909439 19:13841446-13841468 CAACAGGCAGGCCTTGCCTGTGG - Intergenic
1162940496 19:14006189-14006211 CACCCCCCAGGCCCGGCCCGGGG - Exonic
1163820139 19:19491848-19491870 CAGCCCGCAGCCCCTGGCCATGG - Intronic
1165092863 19:33395854-33395876 CAGCCCTCAGGGCCTGCCCTGGG - Intronic
1165389326 19:35529359-35529381 CAGCCCCCTGCCCTTGCCCAAGG - Intergenic
1166283471 19:41809996-41810018 CAGCCCCAAGCCCTTGCCCCTGG + Exonic
1166809587 19:45507506-45507528 CAGCGCGCACCCCTTGCCGGTGG - Exonic
1167880245 19:52451516-52451538 CAGCCAGCGGGCCCAGCCCGCGG + Intronic
1168340659 19:55621469-55621491 CAGCCCGTGGGCCTTGCCTTTGG + Exonic
925412613 2:3648602-3648624 CAGCTGGCAGGCCTTCCCTGTGG - Intergenic
926063138 2:9816931-9816953 CGGCCTGCAGATCTTGCCCGTGG + Intergenic
926227467 2:10978556-10978578 CAGCCCACAGGGCTTTCCCTGGG - Intergenic
926244311 2:11112050-11112072 CAGAGAGCAGGCCTGGCCCGGGG + Intergenic
927705736 2:25295287-25295309 CAGCCCGCAGGCCCTGGCCCAGG + Intronic
927825895 2:26310139-26310161 CAGCCCGCAGGCCGGGGCCGTGG - Intronic
928586771 2:32767493-32767515 CAGTCCGCAGTCCTTGGCCTGGG - Intronic
929864877 2:45709321-45709343 CAGCCCTCTGGCCTTGACCCAGG - Intronic
932213248 2:69948831-69948853 CAGCACTCAGGCCTCCCCCGCGG + Intergenic
932708629 2:74046632-74046654 CAGCCCTCAGGCCCTGGCCGGGG - Exonic
935657950 2:105441021-105441043 CAGCCTGCAGGCTCTGCCCTGGG - Intergenic
935686934 2:105692126-105692148 GAGCCAGCAGGCCTTCCCTGAGG - Intergenic
935732211 2:106073567-106073589 CAGGGCCCAGGCCTTTCCCGGGG - Intronic
936046661 2:109193894-109193916 CAGGCTGCAAGCCTTGCCCCAGG + Intronic
936145210 2:109976118-109976140 CAGCCCGGAGAGCTTGCCCAAGG - Intergenic
936199475 2:110395360-110395382 CAGCCCGGAGAGCTTGCCCAAGG + Intergenic
937975738 2:127581185-127581207 CACCCCGCAGGGCTTCTCCGGGG + Intronic
937988184 2:127647974-127647996 CAGCCCTCAGCCCTTCCCCAGGG + Intronic
937990837 2:127661431-127661453 CAGCCTGCAGGCCTTCCCCTAGG - Intronic
940878430 2:158921952-158921974 CAGCCCACAGGCTCTGCACGGGG + Intergenic
943093829 2:183404991-183405013 CAGTCTGCTGGCCTTTCCCGGGG - Intergenic
946410968 2:219514974-219514996 CAGGCGGCTGGCCTGGCCCGGGG + Exonic
947503715 2:230690993-230691015 CAGCCAGCAGGCACTGCCTGGGG + Intergenic
947671809 2:231941767-231941789 CAGCACCCAGGGCTTGCCCATGG - Intergenic
947744875 2:232502290-232502312 CAGCCCCCTCCCCTTGCCCGTGG - Intergenic
948262042 2:236611708-236611730 CAGCCCTCATGACTTGCCCTGGG - Intergenic
948601691 2:239111234-239111256 CAGTCCACAGCCCATGCCCGTGG - Intronic
948756313 2:240161516-240161538 CAGCCTGCAGGCCTTTGCAGTGG - Intergenic
1172007776 20:31829303-31829325 CAGCCCACAGGCCATGTCCTGGG + Intronic
1173289655 20:41703257-41703279 CAGACTGCTGGCCTTCCCCGTGG + Intergenic
1174533190 20:51230855-51230877 CAGCCTGCAGACCTCGGCCGAGG + Intergenic
1175254176 20:57629023-57629045 CAGTCCCCAGGCCTGCCCCGCGG - Intergenic
1176145076 20:63561894-63561916 CAGCCCGGAGGCCCCCCCCGTGG - Exonic
1179435316 21:41358602-41358624 CAGCCTGCAAGCCCTGCCCTGGG + Intergenic
1180087030 21:45512280-45512302 CAGCGAGGAGGCCTGGCCCGTGG - Exonic
1180592608 22:16954060-16954082 CATCCCTCAGGCCTTGCTCGTGG + Intergenic
1180960210 22:19759089-19759111 CAGCACCCAGCCCTAGCCCGAGG - Intronic
1180996599 22:19968850-19968872 CAGGGCGCAGGCCTCGGCCGAGG - Exonic
1181052137 22:20242982-20243004 CAGCCTGCAGGCCCTGCTGGGGG + Exonic
1182913105 22:34004128-34004150 CAGCCTGCAGGGCACGCCCGAGG + Intergenic
1185337775 22:50278438-50278460 CAGCCAGCAGGACCTGCCTGGGG - Exonic
950548982 3:13655198-13655220 CAACCCGCAGCCCCTGGCCGGGG + Intergenic
952324911 3:32312487-32312509 CTGCCCACATGCCTTGCCCTGGG - Intronic
954619213 3:51986179-51986201 CAGCCTGCTGGCCCTGCCTGTGG + Intronic
954807835 3:53230595-53230617 CTGCCCGTAGGCCTTGCGGGTGG + Exonic
955076308 3:55616998-55617020 CAGCCTGCAGGCTTTGCCGATGG + Intronic
956414347 3:69012108-69012130 CAGCCAGAAGGCCTGGCCGGTGG + Intronic
959946441 3:112130401-112130423 CACCCCCCAGACCTTGCCCAAGG - Intronic
963932989 3:151023604-151023626 AACCCAGCAGGCCTTGCCTGTGG - Intergenic
964757137 3:160098501-160098523 CAGCCTTCAGTTCTTGCCCGGGG - Intergenic
966975049 3:185075761-185075783 CAGCCCTCAGGTATCGCCCGAGG - Intergenic
968438714 4:610508-610530 CAGCCTGGAGGCCTTTCCTGGGG - Intergenic
968919228 4:3514097-3514119 CAGCCTGTGGCCCTTGCCCGTGG - Intronic
968921049 4:3522530-3522552 CATCCCACACGCCCTGCCCGGGG + Intronic
969239070 4:5887865-5887887 CTCCCCGCAGGCCTCGCGCGGGG - Intronic
969507728 4:7598561-7598583 CAGCCGCCATGCCTTGCCCAAGG - Intronic
972285711 4:37645960-37645982 CTGCCCTCAGGCCCTGCCCTGGG - Intronic
976199100 4:82561812-82561834 CAGCCCGCAGGCGGAGACCGGGG - Intronic
982232692 4:153223243-153223265 CGGCTCCCAGGCCCTGCCCGCGG + Intronic
984662274 4:182386785-182386807 CAGTCCGGAGGCCTGCCCCGCGG - Intronic
984736931 4:183117765-183117787 CAGCCCGCAGACCTTGATTGGGG + Intronic
984778919 4:183506049-183506071 AAGCCCGCAGGCCCCGCCCCCGG - Intronic
984928394 4:184826114-184826136 CCGCCCGCAGGCCCCGCCCCCGG + Intronic
985848352 5:2370835-2370857 CTGACCGCAGGCCTTGCGGGAGG + Intergenic
986301052 5:6478767-6478789 CAGCCCTAAGCCCTTGCCTGTGG - Intronic
986325242 5:6667877-6667899 CAGCCTGCATGCTTTCCCCGGGG + Intronic
988842048 5:35092849-35092871 CAGCCCCCACACCTTGCCTGTGG + Intronic
990492074 5:56312349-56312371 CAGCCCTGAGTCCTTGCCTGAGG + Intergenic
992473285 5:77077831-77077853 CAGCCCGCGGGCCTGGTCCATGG + Exonic
999238691 5:150115088-150115110 CAGCCTGCAGCCCTTGCCCAGGG - Exonic
1002876442 6:1215164-1215186 CATCCTGCAGGCCTGGCCTGAGG + Intergenic
1005889813 6:30127735-30127757 CAGAGCGCAAGCCTTGCCCCTGG + Intergenic
1008673205 6:53794446-53794468 AAGCCTGCAGGCGGTGCCCGAGG + Intergenic
1017737679 6:157380111-157380133 CCGCCCGCAGGCCTGCGCCGAGG - Intergenic
1017811961 6:157990026-157990048 CAGCCCACAGGACCTGGCCGGGG - Intronic
1019334584 7:476966-476988 CAGGCCACACGCCCTGCCCGTGG + Intergenic
1019810899 7:3164495-3164517 CAGCCCGGAGACCTTTCCAGAGG + Intronic
1020382985 7:7566762-7566784 CACCCCGCAGGCCCTGCCCGTGG - Intergenic
1022427889 7:30285325-30285347 CAGCGCGCGGGCCCGGCCCGGGG + Exonic
1024526369 7:50353371-50353393 CAGACCTCAGGCCTTGCAGGAGG - Intronic
1027868126 7:83673553-83673575 CAGTCCCCAGGCCTGCCCCGAGG - Intergenic
1028198709 7:87935379-87935401 CAGGCCGAGGGCTTTGCCCGAGG + Intronic
1035221300 7:157407972-157407994 CAGCACACAGGCCATGCCCGCGG - Intronic
1035590049 8:805755-805777 CAGTCCGCCGGCCTTGGCCTCGG + Intergenic
1038388660 8:27174177-27174199 CAGCCCTCAGGCCTTGCACTGGG + Intergenic
1038520678 8:28229726-28229748 CCCTCCCCAGGCCTTGCCCGAGG - Intergenic
1041477109 8:58278827-58278849 CAGCCAGAAGTCCTTGCCCTGGG - Intergenic
1042122120 8:65499379-65499401 CAGCCCTCAGTCCTTGGCAGTGG - Intergenic
1044730547 8:95225567-95225589 CAGCCCCCAGGCCAAGCCCCAGG - Intergenic
1045098713 8:98825284-98825306 CGGCCGGCAGGCCTGGCGCGTGG - Intronic
1047961570 8:130015711-130015733 CAGCCTGCAGGGCTTTCCTGGGG - Intronic
1048965158 8:139609564-139609586 CAGCCCACAGGCCTGGCCCCTGG - Intronic
1049671002 8:143869842-143869864 GAGCCTGCAGGCCGTGCCGGGGG - Exonic
1050689160 9:8205723-8205745 CAGGCCTCAGGCCTTGCTCCAGG + Intergenic
1053157750 9:35792174-35792196 CAGTCCTCAGTCCTTGCCCTAGG + Exonic
1053516687 9:38736221-38736243 CAGCCCCCAGGCCTTGGAAGGGG + Intergenic
1054792404 9:69268311-69268333 CAGCCCAAAGCCCTTGCCCAGGG + Intergenic
1056738767 9:89234701-89234723 CAGCCCGCAGGGTTTACCCTTGG - Intergenic
1060543658 9:124448199-124448221 CAGCCTGCAGGCTTTGTCCTTGG + Intergenic
1060789791 9:126478395-126478417 GAGCCCCCAGGCCCTGCCCCTGG + Intronic
1061139123 9:128753649-128753671 CCGGCCCCAGGCCTTGCCCTGGG + Intronic
1061152612 9:128837493-128837515 CAGCCCTCAGGCCTTCCCTGGGG + Intronic
1061234915 9:129336678-129336700 CAGCCCGCAGGCCGTGGGAGGGG - Intergenic
1062406998 9:136401357-136401379 CAGGCCACAGGCCTTCCCTGAGG - Intergenic
1192178982 X:68903536-68903558 CAGTGGGCAGGCCTTGCCTGGGG + Intergenic
1192585211 X:72313730-72313752 CAGCAAGCAGGCCTGGCCCTGGG + Intergenic
1197746066 X:129932680-129932702 CAGCCCGCAGCCCGTCCTCGGGG + Intergenic
1199596934 X:149513408-149513430 CAGCCCAGAGCCCTGGCCCGTGG - Intronic
1199847453 X:151701373-151701395 CAGCCCCCAGGCCAGGCCTGTGG - Exonic
1200124306 X:153806037-153806059 CAGGCTGCAGGCCTGGCCCAAGG - Intronic
1200244597 X:154516253-154516275 CAGCCCGCCGGCCCCGCCCCCGG + Intergenic