ID: 1130041347

View in Genome Browser
Species Human (GRCh38)
Location 15:80407290-80407312
Sequence CTCTTCTGTGATGTGTAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 162}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130041343_1130041347 11 Left 1130041343 15:80407256-80407278 CCACTTCACAACAGCAGAACCAT 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1130041347 15:80407290-80407312 CTCTTCTGTGATGTGTAGTGGGG 0: 1
1: 0
2: 3
3: 15
4: 162
1130041344_1130041347 -8 Left 1130041344 15:80407275-80407297 CCATTTACAATGACACTCTTCTG 0: 1
1: 0
2: 0
3: 9
4: 210
Right 1130041347 15:80407290-80407312 CTCTTCTGTGATGTGTAGTGGGG 0: 1
1: 0
2: 3
3: 15
4: 162
1130041341_1130041347 20 Left 1130041341 15:80407247-80407269 CCCAGCTGACCACTTCACAACAG 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1130041347 15:80407290-80407312 CTCTTCTGTGATGTGTAGTGGGG 0: 1
1: 0
2: 3
3: 15
4: 162
1130041342_1130041347 19 Left 1130041342 15:80407248-80407270 CCAGCTGACCACTTCACAACAGC 0: 1
1: 1
2: 2
3: 14
4: 151
Right 1130041347 15:80407290-80407312 CTCTTCTGTGATGTGTAGTGGGG 0: 1
1: 0
2: 3
3: 15
4: 162
1130041340_1130041347 28 Left 1130041340 15:80407239-80407261 CCTTTTTTCCCAGCTGACCACTT 0: 1
1: 0
2: 1
3: 18
4: 343
Right 1130041347 15:80407290-80407312 CTCTTCTGTGATGTGTAGTGGGG 0: 1
1: 0
2: 3
3: 15
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130041347 Original CRISPR CTCTTCTGTGATGTGTAGTG GGG Intronic
901253662 1:7801892-7801914 CTTTTCAGTTATGTGTGGTGTGG - Intronic
907319768 1:53594924-53594946 CTCCTGTTTGATGTGTTGTGTGG + Exonic
908084130 1:60612086-60612108 CTGTTATGTGCTGTGTACTGGGG - Intergenic
909382903 1:75021079-75021101 TTCTTCATTGATGTGTTGTGTGG + Intergenic
909938489 1:81582766-81582788 CACTTTTTTGATGTGTGGTGGGG - Intronic
911971498 1:104443527-104443549 CTCTTCTGTATTGTGTAATCTGG + Intergenic
912058656 1:105636540-105636562 CTGTTCTGTGAGGTGTGGTAGGG + Intergenic
912225549 1:107729581-107729603 CTGTTCTGTGATGAGCTGTGTGG + Intronic
913615819 1:120558599-120558621 CTCTTCTGGGAGCTGTAGTCCGG + Intergenic
914574458 1:148952303-148952325 CTCTTCTGGGAGCTGTAGTCCGG - Intronic
916039788 1:160952063-160952085 CTTTTCTGTGCTGTCTTGTGGGG + Intronic
916606693 1:166349966-166349988 TTCATCTGTGATATGCAGTGAGG - Intergenic
918906201 1:190498875-190498897 CTCTTCTGTGCTCAGTAGTGAGG + Intergenic
920507041 1:206522625-206522647 CTGCTCTGTGATGTGCACTGAGG + Intronic
920739535 1:208567433-208567455 CTCTTCTGTGGAGTGAAGTGAGG + Intergenic
921656881 1:217750063-217750085 CTCTTCTGTGAGAGGTAGAGGGG - Intronic
922342870 1:224671460-224671482 CTCTTCTGTAAGGGGGAGTGAGG - Intronic
922526385 1:226307855-226307877 CTCTTTTGTGATGTCCAGTAGGG - Intronic
923139411 1:231148325-231148347 TTCTTCTGTGGTCTGCAGTGGGG + Intergenic
1064969489 10:21049781-21049803 CTCTTCTCTAATGTGGAGAGAGG + Intronic
1065284478 10:24174463-24174485 CTCTTCTGTGATAGGAAATGGGG - Intronic
1066682897 10:37952408-37952430 GTTTTCTCTGATGTTTAGTGAGG + Exonic
1066693365 10:38055405-38055427 GTGTTCTCTGATGTTTAGTGAGG - Exonic
1066999440 10:42593647-42593669 GTGTTCTCTGATGTTTAGTGAGG + Exonic
1067122173 10:43482957-43482979 GTGTTCTCTGATGTGTTGTGAGG - Exonic
1070530187 10:77330272-77330294 CTCTGTTGTGATGTGGACTGAGG - Intronic
1072537937 10:96377460-96377482 CTCTTCTGTGGTGGGCACTGTGG + Intronic
1073564186 10:104521227-104521249 CTCTTCTTTGATAAGGAGTGTGG - Intergenic
1076986417 11:239567-239589 CACTTCTGTCCTGGGTAGTGTGG + Intronic
1078004650 11:7523454-7523476 CTCTTTTGAGCTTTGTAGTGGGG + Intronic
1087310865 11:96541451-96541473 CACTTCTCTGATGATTAGTGAGG + Intergenic
1087579182 11:100030030-100030052 CTCTACTTTGAACTGTAGTGTGG + Intronic
1088040100 11:105370831-105370853 CACTTTTGTGATGTGGAGGGAGG + Intergenic
1089278572 11:117356368-117356390 GTCTTCTAGGATGTCTAGTGAGG + Intronic
1089343397 11:117774855-117774877 CTCTTCTGTAAAGTGGAGAGGGG + Intronic
1090823303 11:130364472-130364494 CTGTTCTTTCATCTGTAGTGTGG + Intergenic
1091626843 12:2127576-2127598 CTGTCCTGTGCTGTGTAGTGGGG + Intronic
1093278762 12:17163770-17163792 CTCTTTTGAGAACTGTAGTGAGG - Intergenic
1093666426 12:21818763-21818785 CTCCTTTGTGTTGTGTAGTGAGG + Intronic
1098237212 12:68428664-68428686 CTCTTATGTGATGGTCAGTGGGG - Intergenic
1100775984 12:97975256-97975278 GTTTTGTTTGATGTGTAGTGTGG + Intergenic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1102416247 12:112765430-112765452 GTGTTCTGTGAGGTATAGTGGGG - Intronic
1104642437 12:130476083-130476105 GTCACCTGTGATGTGTAGAGGGG + Intronic
1107522741 13:41199618-41199640 CTCTTGTGTAAGGGGTAGTGGGG + Intergenic
1110803701 13:79730443-79730465 CACTTCTGTAATGATTAGTGAGG + Intergenic
1111178011 13:84623598-84623620 CTTTTCTGTGATCTTCAGTGTGG + Intergenic
1111220717 13:85202323-85202345 CTTTTCTCTGATGATTAGTGAGG - Intergenic
1113252250 13:108466684-108466706 GTCTTCTGTGATGTTTATTAAGG - Intergenic
1118439018 14:65796136-65796158 ATCTTTTGTGATGTGGAGCGAGG + Intergenic
1118465159 14:66024127-66024149 CTTTTCTGGGAGGTGTGGTGAGG - Intergenic
1119951349 14:78749037-78749059 CTCTTATTTGATGTTTTGTGAGG - Intronic
1123074415 14:105660662-105660684 CCCTTCTGTGATGTGGTGTTGGG - Intergenic
1124233408 15:27966480-27966502 GTTTTCTGTGAAGTGTACTGTGG - Intronic
1126561105 15:50045207-50045229 GTATTCTGTGTTGTGTACTGGGG - Intronic
1128707198 15:69845212-69845234 CCCTTCTGTCATCTGTAGGGGGG + Intergenic
1130041347 15:80407290-80407312 CTCTTCTGTGATGTGTAGTGGGG + Intronic
1130867294 15:87943767-87943789 CTCTTCTGGGATGTTGAGGGAGG - Intronic
1132395238 15:101468162-101468184 CTCATCTGTGATGTGGAGACAGG + Intronic
1136676745 16:31916187-31916209 GACTTCTCTGATGTGTAGTGAGG - Exonic
1136676753 16:31916271-31916293 GTCTTCTCCGATGTGTAGTGAGG - Exonic
1136676761 16:31916355-31916377 GACTTCTCCGATGTGTAGTGAGG - Exonic
1138344776 16:56313554-56313576 CTCTGTTGTGATGTGTTGTTTGG + Intronic
1139637739 16:68268392-68268414 CTCTTCTGTGTTGATTATTGTGG + Intronic
1140696484 16:77539279-77539301 ACCTTCTCTGATGTGTAGTACGG + Intergenic
1145762377 17:27433048-27433070 TTCTTCTGTGATGGGTATTTTGG + Intergenic
1149345277 17:55728229-55728251 TTCTTCTATGTTGTGTTGTGAGG + Intronic
1149758995 17:59212224-59212246 TTCTTCTGTTATGTGTATTTAGG + Intronic
1150436334 17:65157159-65157181 CTCTTCTTTGATGTGTTATGTGG + Intronic
1156475737 18:37404321-37404343 CTCTTCTGTGGGGTGTAGTCTGG - Intronic
1157057289 18:44245801-44245823 CTTCTCTGTGATGTATTGTGTGG + Intergenic
1157557664 18:48623177-48623199 GTCTGCTGTGAAGTGTGGTGTGG + Intronic
1159330876 18:66992482-66992504 CTCTTTGGTGATGTGAAGTGTGG + Intergenic
1162009621 19:7804354-7804376 CTCTTGTGTGTTGGGGAGTGGGG - Intergenic
1164861478 19:31565427-31565449 ATGTTCTGTGATGTGAAGAGTGG + Intergenic
1165555407 19:36626995-36627017 GTGTTTTGTGATGTCTAGTGAGG - Exonic
1168159441 19:54499588-54499610 CTCTTCTTTCATGTGTAGAATGG - Intronic
1168247562 19:55120759-55120781 CTCTTCTGTCCTGTGTGGAGAGG - Intergenic
930877459 2:56235109-56235131 TTCTTCAGTGATGTGCAATGTGG + Intronic
932370652 2:71184732-71184754 CTCTAATTTGGTGTGTAGTGGGG - Exonic
940898797 2:159107514-159107536 TTCTTGTGTGATGTGAAGTAGGG + Intronic
942058752 2:172208510-172208532 CACTGCTGTGACGTGGAGTGGGG - Intergenic
943464501 2:188212109-188212131 CTCTTCTCTGAGGTTTAGTCAGG + Intergenic
945128017 2:206535020-206535042 CTCTTCTCTGAATTGTACTGTGG + Intronic
945466399 2:210174843-210174865 CTATTCTGTGAGAGGTAGTGAGG - Intergenic
945992992 2:216412363-216412385 GTCTTCTGGGATTTGTAGTTCGG - Intergenic
946163831 2:217851834-217851856 CTCTTCTTTTATGTGTAGCAAGG - Intronic
947148446 2:227089787-227089809 CATTTCTGAGATGTGTAATGTGG - Intronic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
947622617 2:231600521-231600543 CTCTTCTGTGTTGAGAAGTGAGG + Intergenic
1169790594 20:9406204-9406226 ACTGTCTGTGATGTGTAGTGAGG - Intronic
1169945347 20:10982457-10982479 CTCTTTAGAGATGTGTAATGTGG - Intergenic
1170848176 20:19980067-19980089 CTCTTCTGAGAGGTGTAGCCAGG + Intronic
1170929441 20:20755548-20755570 CTCTTCTTGGATGTCTAATGGGG + Intergenic
1171006142 20:21467492-21467514 CTCTTAGGTGATGTGTGGAGGGG - Intergenic
1176672530 21:9747995-9748017 CACCTCTGTGGTGTGCAGTGTGG + Intergenic
1179285636 21:39975307-39975329 CCTTTCTGTGTTGTGTATTGTGG - Intergenic
1179303975 21:40138377-40138399 GTGTTGTGTGATGTGTGGTGTGG + Intronic
1180610939 22:17097617-17097639 CTCTTCTCTAATGTTTACTGGGG - Intronic
1184297078 22:43531804-43531826 CTGCCCTGTGATGTGTGGTGTGG - Intronic
1184800732 22:46757505-46757527 CTCAGCTGTGGTGTGAAGTGGGG + Intergenic
949460769 3:4290994-4291016 CTCTACAGTAATATGTAGTGAGG + Intronic
949511159 3:4768520-4768542 CTCTTCTGTTATCTGTGTTGTGG - Exonic
952665248 3:35896196-35896218 CTTTTCTGTGATGTGGACAGAGG - Intergenic
952682531 3:36111093-36111115 CTTTAATGTGAGGTGTAGTGTGG + Intergenic
953025616 3:39143251-39143273 ACCTTCTGTGATGTGTAGTGAGG + Exonic
953688685 3:45098608-45098630 CTAGTCTGTGCTGTGTTGTGGGG - Intronic
954460202 3:50622155-50622177 CTCTTCTGTGTTGTGCTTTGAGG - Intronic
957190251 3:76999061-76999083 GTCTTCTGTGCTGTGTATTCAGG + Intronic
960201567 3:114842973-114842995 CTCTTCTGTGATAGTAAGTGAGG + Intronic
962954977 3:140256611-140256633 TTCTTCTGTGATGTAAAGTGGGG - Intronic
964305904 3:155339410-155339432 TTCTTGTGTGATGTGGTGTGTGG + Intergenic
965807722 3:172559228-172559250 CTATCCTGTGATTTGAAGTGAGG + Intergenic
968126686 3:196165390-196165412 CTGTTGTGTGTTGTGTGGTGTGG + Intergenic
969881149 4:10175128-10175150 CTCGTCTGAGATGGGTAATGTGG + Intergenic
971476834 4:27080485-27080507 CTCTTCTGTGCTGTGCAGAATGG - Intergenic
973602745 4:52558157-52558179 CTCTGCTGTCATGTGGAGCGAGG + Intergenic
975325363 4:73053151-73053173 CTCCTCTGAGATGTGAACTGTGG + Intergenic
981715474 4:147747545-147747567 CCCTTCAGGGATGTGGAGTGTGG + Intronic
981955969 4:150474700-150474722 CACTTCTGTGATCTGTAAAGAGG + Intronic
983037030 4:162879184-162879206 CTCTTCTGAGATGTTTTGAGAGG - Intergenic
985402195 4:189603836-189603858 CACCTCTGTGGTGTGCAGTGTGG - Intergenic
986292565 5:6411771-6411793 CGTTTCTGTGAGGTGTGGTGTGG + Intergenic
986930509 5:12813846-12813868 TTCTTCTGTGAGCTGTAATGAGG + Intergenic
987644208 5:20648195-20648217 CTGTTCAGTGAGGTGAAGTGAGG - Intergenic
987644220 5:20648257-20648279 CTGTTCAGTGAGGTGAAGTGAGG - Intergenic
987721355 5:21636895-21636917 CTCTGCTCTGAGGTGGAGTGAGG + Intergenic
990294691 5:54389024-54389046 CTCTTCTGTGCTGTGTAATATGG + Intergenic
991008293 5:61854077-61854099 CTCTTCTGGGATGTGCAGTGCGG - Intergenic
991403679 5:66280043-66280065 TTCTTCTGTGCTGTGTTCTGTGG - Intergenic
992629335 5:78665757-78665779 CTGCTCTGTGATGTTGAGTGTGG - Intronic
993927248 5:93882695-93882717 CTATTCAGTTATGTGTTGTGAGG + Intronic
995009810 5:107244607-107244629 TCCTTCTGGGATGTGTAGTTAGG - Intergenic
995358708 5:111269202-111269224 ATCTTCTGCAATGAGTAGTGGGG + Intronic
998066067 5:139159968-139159990 CACTTCTGTGATGCCTAATGAGG - Intronic
999803914 5:155064268-155064290 CTGTTCTGTGCTGGGTACTGTGG + Intergenic
1001612722 5:173016359-173016381 CTCTTCTGTGTTGATTATTGTGG + Intronic
1002125961 5:177044302-177044324 CTGTTCTGTTATGGGCAGTGGGG + Intronic
1003439705 6:6128207-6128229 CACCTCTGTGGTGTATAGTGAGG - Intergenic
1003656573 6:8016577-8016599 CTCTTCTGGGATGGGCAGAGTGG + Intronic
1003804048 6:9705376-9705398 CTCTTCTCCAATGTGAAGTGAGG + Intronic
1005371921 6:25142456-25142478 ATTTTCTGTGATCTCTAGTGAGG - Intergenic
1006087110 6:31603870-31603892 TGCTTCTCTGATGGGTAGTGTGG + Intergenic
1006399073 6:33805557-33805579 CTGTTGTGAGATGTGCAGTGTGG + Intergenic
1006834708 6:36990703-36990725 CTCTTCTGCTAAGTGAAGTGAGG + Intergenic
1007982471 6:46172782-46172804 CTTTTCTGTGTTGTGCACTGTGG - Intergenic
1012395384 6:98790576-98790598 GTATTCTGTGTTGTGTATTGAGG - Intergenic
1013040435 6:106427552-106427574 TTCTTCTGTGATGTCTAGCTTGG + Intergenic
1014505730 6:122252898-122252920 CTCTTCTGTGATTTTTAGCTTGG - Intergenic
1017896486 6:158684561-158684583 CTCCTCTGTGATGTGATGTTGGG + Intronic
1019623996 7:2006575-2006597 CTCTTCTGTGCTGGGCCGTGCGG - Intronic
1024527057 7:50357697-50357719 GTCCTCCCTGATGTGTAGTGTGG + Intronic
1028023904 7:85812340-85812362 TTCTTCTATAATGTGTATTGAGG + Intergenic
1028831717 7:95335551-95335573 TACTTCTGTGATGTGTAGTGAGG + Intergenic
1028965953 7:96801437-96801459 CTCCTCAGAGATGTGTTGTGAGG - Intergenic
1029882984 7:103836421-103836443 CTGTTCTGTGCTGTCCAGTGTGG - Intronic
1032448273 7:132003401-132003423 CTCCTCTGTGGGGTGGAGTGGGG + Intergenic
1034378835 7:150671208-150671230 CTCTACTGTGAGATGTAATGGGG - Intergenic
1037159952 8:15757522-15757544 CTCATCAATGATGTGTACTGTGG - Intronic
1043229839 8:77788081-77788103 CTGTTTGGTGATGAGTAGTGCGG + Intergenic
1043472472 8:80576708-80576730 CTCTTGTGGAATGTGTAGTCAGG + Intergenic
1049020681 8:139955864-139955886 CGCTTCTGTGATGCCTGGTGTGG + Intronic
1049359394 8:142204811-142204833 CTCATTTGTGATGTGGGGTGAGG - Intergenic
1050998855 9:12255870-12255892 CTCCTCTGAGCTGTGTAGTGTGG + Intergenic
1056582048 9:87896039-87896061 CTCTTCTGTGTAGTGTTGGGTGG - Intergenic
1057640894 9:96820305-96820327 TTCTTTTGTGATGTGTAGAATGG - Intronic
1059116265 9:111602678-111602700 CTCCTCTGTGCTGTGCAGAGAGG - Intergenic
1059540029 9:115121104-115121126 CTCTGCTGTAATGTCTAGTGTGG - Intergenic
1059624775 9:116051178-116051200 CTCTTCTGTCATGATTAGAGTGG - Intergenic
1061342515 9:129993956-129993978 CCCTTCTGTAATGTGTTGAGGGG - Intronic
1061675028 9:132210779-132210801 CTCTGCTGAGATGTGGAGGGAGG - Intronic
1061776710 9:132970515-132970537 CTGATCTGTGACGTGCAGTGTGG + Intronic
1062026539 9:134343221-134343243 CTCATCTGTGACGTGGGGTGAGG + Intronic
1194403882 X:93469329-93469351 CTATGCTGTGCGGTGTAGTGAGG - Intergenic
1196593942 X:117521568-117521590 CTCTTCTGTGATGTGAAGAACGG + Intergenic
1196680972 X:118469126-118469148 CTTTTCTTTGATTTTTAGTGAGG + Intergenic
1198283671 X:135169486-135169508 CTCTGCTGTGATCCGTAGAGTGG - Intronic
1198285996 X:135192790-135192812 CTCTACTGTGATCCGTAGAGTGG - Intergenic
1198287123 X:135201961-135201983 CTCTACTGTGATCCGTAGAGTGG + Intergenic
1201748624 Y:17407852-17407874 CTTTTCAGTGATGTGCATTGAGG + Intergenic
1201949580 Y:19549311-19549333 CTCATCTGTAGTGAGTAGTGGGG + Intergenic