ID: 1130041379

View in Genome Browser
Species Human (GRCh38)
Location 15:80407505-80407527
Sequence CTGTCATAGCAGAAGTCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130041379_1130041383 12 Left 1130041379 15:80407505-80407527 CCTCATGACTTCTGCTATGACAG 0: 1
1: 0
2: 0
3: 9
4: 186
Right 1130041383 15:80407540-80407562 TCCTCATATCCTGTGGCCCCTGG 0: 1
1: 0
2: 0
3: 16
4: 195
1130041379_1130041389 29 Left 1130041379 15:80407505-80407527 CCTCATGACTTCTGCTATGACAG 0: 1
1: 0
2: 0
3: 9
4: 186
Right 1130041389 15:80407557-80407579 CCCTGGTGCCTCCTCCTTCTGGG 0: 1
1: 1
2: 2
3: 58
4: 1014
1130041379_1130041382 5 Left 1130041379 15:80407505-80407527 CCTCATGACTTCTGCTATGACAG 0: 1
1: 0
2: 0
3: 9
4: 186
Right 1130041382 15:80407533-80407555 GTTATATTCCTCATATCCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 146
1130041379_1130041387 28 Left 1130041379 15:80407505-80407527 CCTCATGACTTCTGCTATGACAG 0: 1
1: 0
2: 0
3: 9
4: 186
Right 1130041387 15:80407556-80407578 CCCCTGGTGCCTCCTCCTTCTGG 0: 1
1: 0
2: 1
3: 40
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130041379 Original CRISPR CTGTCATAGCAGAAGTCATG AGG (reversed) Intronic
902499683 1:16901573-16901595 CTGTCAGAACAGAAGTTTTGGGG - Intronic
904922505 1:34020067-34020089 CAGTCATAGCATATGTCAGGAGG + Intronic
905930860 1:41786418-41786440 CTGTAAAATCAGAAGTGATGAGG - Intronic
908636107 1:66166952-66166974 CTGTCATACCATTAGTCATTAGG + Intronic
908784095 1:67718067-67718089 TGGTCATAGCTGAAGTCATAGGG - Intronic
913080085 1:115375802-115375824 ATGTAATAGAAGAAGTCATTTGG - Intergenic
913296151 1:117322571-117322593 CTTTCATAAGAGATGTCATGAGG - Intergenic
913533282 1:119748219-119748241 CTGTCATAGCACTTGGCATGTGG + Exonic
915617979 1:157055898-157055920 CAGTCATAGCAGAAGGCAAAGGG - Intergenic
915962217 1:160276403-160276425 CTGACATAGCAGAGGCCAGGTGG - Intergenic
917355586 1:174123558-174123580 CAATCATGGCAGAAGGCATGAGG - Intergenic
917381599 1:174416101-174416123 CTGTCACAGCAGAAGTGAGTTGG - Intronic
917832010 1:178901000-178901022 CTGTCAAATCAGCAGTCCTGTGG + Intronic
917946020 1:179971775-179971797 CTGTGATATCATATGTCATGTGG + Intronic
919189434 1:194196825-194196847 CTCACATAGCTGCAGTCATGTGG + Intergenic
920670572 1:208001030-208001052 CTCACATAGCAGAAGGGATGAGG - Intergenic
920987750 1:210906381-210906403 CTGCCCCAGCAGCAGTCATGTGG - Intronic
923567942 1:235090795-235090817 CTGTCAGAGAAGCAGTGATGTGG + Intergenic
924581356 1:245326691-245326713 CTCTCATAGAAGCAGTCAGGAGG + Intronic
1062859946 10:803328-803350 CTGCCAAAGCAGAGGTCAGGCGG + Intergenic
1063136857 10:3224799-3224821 CAGTCATAGCAGAAGGCAAAGGG - Intergenic
1063390906 10:5649353-5649375 CTGTGAGAACAGAAGACATGGGG + Intronic
1069208431 10:65723705-65723727 CAGTCATAGCAGAAGGCAAAGGG + Intergenic
1070653304 10:78253559-78253581 GTATCATGGCAGAAGTCATGTGG - Intergenic
1073931008 10:108576838-108576860 CTTACATAGCAAAAGTCATATGG + Intergenic
1075055475 10:119215356-119215378 TTTTCATGTCAGAAGTCATGGGG - Intronic
1077418520 11:2437106-2437128 CTGTCTTAGGAGAAGGGATGGGG + Intergenic
1078105952 11:8358097-8358119 GTGTCATAATAGAAGACATGTGG - Intergenic
1079538563 11:21544468-21544490 CAGTCATAACAGAATTCTTGGGG + Intronic
1080182732 11:29443951-29443973 CAGTCATAGTAGAAGGCATGGGG + Intergenic
1081014237 11:37856271-37856293 CTCTCATGGCAGAAGTCAAAGGG + Intergenic
1082181762 11:49128354-49128376 CTGGCTTAGTAGAAGTCATCTGG - Intergenic
1086433444 11:86758367-86758389 CTGGCATATGAGAAGTCATGTGG - Intergenic
1086683733 11:89706505-89706527 CTGGCTTAGTAGAAGTCATCTGG + Intergenic
1087610785 11:100432010-100432032 CTGGAATAGCAGAGGGCATGTGG - Intergenic
1087853564 11:103062481-103062503 CTGTCATTGCAGAGCTCGTGGGG - Intronic
1088105127 11:106198260-106198282 CAGTCATAGCAGAAGGCAAAGGG - Intergenic
1088841740 11:113633256-113633278 CTGTCCAAGCAGAAAGCATGGGG - Intergenic
1089127641 11:116188188-116188210 CTTTCATTGCAAAAGTCAAGAGG + Intergenic
1089293806 11:117456038-117456060 CTGTCTTAGCAAGAGGCATGTGG + Intronic
1091969000 12:4770415-4770437 CTGTCAAAGCTCATGTCATGTGG + Intronic
1092530234 12:9338061-9338083 CTCACATAGCAGAAGGGATGAGG + Intergenic
1094310059 12:29070408-29070430 CTGTCATAGCAGTGGCCAAGAGG - Intergenic
1096589599 12:52648840-52648862 CTTTCATAGCATAGGTCTTGTGG - Intronic
1101817982 12:108160461-108160483 CAGTCATAGCAGAAGGCAAAGGG + Intronic
1102800766 12:115731520-115731542 TGGCGATAGCAGAAGTCATGAGG - Intergenic
1104574720 12:129956625-129956647 CTCACAAAGCAGAAGTCCTGAGG - Intergenic
1105434468 13:20364690-20364712 ATGTCAGAGGAGGAGTCATGGGG - Intergenic
1106126680 13:26905633-26905655 CTGAAATAGCAGCAGTAATGAGG + Intergenic
1106986209 13:35354441-35354463 CCTCCATAGCAGCAGTCATGTGG + Intronic
1107632736 13:42358694-42358716 CAGTACTAGCAGAAGCCATGTGG - Intergenic
1108566673 13:51706326-51706348 CTGTCATTGCAGCTGTCTTGGGG + Intronic
1110775183 13:79400403-79400425 CTCCCATAGCAGAAGTCAGAGGG + Intronic
1111240184 13:85463737-85463759 CAGTCATAGCAGAAGGCAAAGGG + Intergenic
1113118629 13:106901971-106901993 GTGTCTTAGCAGATGTCATATGG - Intergenic
1113147713 13:107226927-107226949 CAGTCATTATAGAAGTCATGTGG - Intronic
1113354107 13:109561707-109561729 CAGTCATATTGGAAGTCATGTGG + Intergenic
1116078900 14:40147563-40147585 CTCACATAGCAGAAGGGATGAGG - Intergenic
1118145332 14:63128566-63128588 CAGTCATGGCAGAAGGCAAGGGG - Intergenic
1120096663 14:80396533-80396555 CTTTGATAGCAAAAGTCCTGGGG + Intergenic
1124167236 15:27339037-27339059 CTGCCACAGCAAAAGACATGGGG - Intronic
1124249613 15:28098288-28098310 CTCTCATAGAAGAACTAATGAGG - Intronic
1127550565 15:60033660-60033682 CAGTCATAGCAGAAGGCAAAGGG - Intronic
1127768442 15:62210535-62210557 CAGTGATAGCAGGAGCCATGGGG - Intergenic
1129579547 15:76792778-76792800 CTGTCATAGCTGACACCATGTGG + Intronic
1130041379 15:80407505-80407527 CTGTCATAGCAGAAGTCATGAGG - Intronic
1134196295 16:12161803-12161825 CAGTCATGGCAGAAGGCATAGGG - Intronic
1138369141 16:56510799-56510821 CTGTCATGGCAAAATTCATTTGG + Intronic
1140108890 16:71986225-71986247 GTGTCATTGCAGAAGGCATCTGG - Exonic
1142416976 16:89948597-89948619 CTCTCATCGCAGAAGGCCTGTGG - Intronic
1144090735 17:11854009-11854031 CTGACAGAGCTGAAGTCATTTGG + Exonic
1146356809 17:32141513-32141535 TTCTCCTAGGAGAAGTCATGTGG - Exonic
1150155972 17:62853439-62853461 CAGTCATAGCAGAAGGCAAAGGG + Intergenic
1150412292 17:64955436-64955458 CTGTCATTCCAAAAGTCAGGTGG - Intergenic
1151384926 17:73749066-73749088 CTGTCAGAGGGGAAGTCAGGGGG + Intergenic
1152521773 17:80860558-80860580 GTGTCACAGCTGAAGTCAGGGGG + Intronic
1153455409 18:5276086-5276108 CTCTCATAGCAAAAGGCAGGAGG - Intergenic
1154103395 18:11498343-11498365 CAGTCATGGCAGAAGTCGAGGGG - Intergenic
1155531862 18:26775561-26775583 CTCTGATGACAGAAGTCATGGGG + Intergenic
1157027561 18:43864270-43864292 CTGACATGGCAGAAATAATGTGG + Intergenic
1158878389 18:61753557-61753579 CAGTCATAGCAGAAGGCAAAGGG - Intergenic
1159496421 18:69213312-69213334 CAGTCATGGCAGAAGTCAAAGGG + Intergenic
1163420814 19:17212728-17212750 CTGTCAGAGCAGAAGCCACTAGG + Exonic
1164326317 19:24195536-24195558 CAGTAAGAGCAGAAGTCATAAGG - Intergenic
1164861766 19:31567292-31567314 CTCTCATGGCAGAAGGGATGAGG - Intergenic
925521727 2:4753856-4753878 CTTGTATAGCAAAAGTCATGTGG + Intergenic
925787764 2:7449446-7449468 CTGACACAGGAGAAGTCCTGGGG - Intergenic
929314963 2:40465975-40465997 CTCACATAGCAGAAGCCAGGAGG - Intronic
931673337 2:64669273-64669295 CTGTCATACAGTAAGTCATGTGG - Intronic
932477060 2:72013010-72013032 GTGTCAGAGAAGAAGTCATGGGG + Intergenic
932526486 2:72475443-72475465 CTGTGGTAGTAGCAGTCATGTGG + Intronic
934958469 2:98645863-98645885 TTATCACAGCAGAAGTTATGGGG + Intronic
935074873 2:99731298-99731320 CTTTCATATCAGAAATCATTAGG - Intronic
936014368 2:108946621-108946643 CAGTCATAGCAGAAGGCAAAGGG + Intronic
938146592 2:128839538-128839560 CTGGAATTCCAGAAGTCATGTGG - Intergenic
938847720 2:135228351-135228373 CTACTATAGCAAAAGTCATGAGG + Intronic
940581919 2:155591276-155591298 CTGTAATATCAGAAGTCAGCAGG + Intergenic
940916890 2:159265952-159265974 CTGGCATAGCAGAAGACAGCTGG - Intronic
941642306 2:168001691-168001713 CTGTTATATAAGAAATCATGAGG + Intronic
942534202 2:176946112-176946134 CAATCATAGCAGAAGCCACGTGG - Intergenic
944368518 2:198953917-198953939 CTGTCAAAGCAGAAGTGACTTGG - Intergenic
946731150 2:222710838-222710860 CTGTCATACGAAAACTCATGTGG + Intergenic
1170994767 20:21341983-21342005 CTGCCATAGGAGTAGTAATGGGG + Intronic
1172096707 20:32463999-32464021 CTGTCACAGCAGCAGCCAGGCGG + Intronic
1172530862 20:35630521-35630543 CATTCTTAGCAGAGGTCATGGGG - Intronic
1173496940 20:43526286-43526308 CTGTCATAGTAGAAGAGATTTGG + Intronic
1175565636 20:59974579-59974601 CTGACATAACAGAATTAATGGGG - Intronic
1176869704 21:14075040-14075062 CTGTTGTAGCAGAGGGCATGGGG + Intergenic
1177170063 21:17645052-17645074 CTGTCATGGCAGAAGGCAAAGGG - Intergenic
1177179915 21:17734077-17734099 CTGTCATGGCAGAAGGCAAAGGG + Intergenic
1180045897 21:45305002-45305024 CTCTCATAGCAGAAGGCAGGAGG - Intergenic
1181897514 22:26123597-26123619 CAGTCATGGCAGAAGTCAAAGGG + Intergenic
1184108287 22:42381308-42381330 CTGACAGAGCAGGAGTCAAGCGG + Exonic
1184558784 22:45248952-45248974 CTGTGCTAGCAGAAGTCAAAAGG - Intergenic
949133494 3:535119-535141 CTTTCATATCAGGAATCATGTGG - Intergenic
949802686 3:7920881-7920903 CTGTGATATGAGAAGACATGGGG - Intergenic
952806546 3:37360031-37360053 CTGGCATAGCAGAAGTAGTCTGG - Intronic
953225647 3:41017012-41017034 CTCTCATAGCAGATGTCAGAAGG - Intergenic
955343458 3:58143480-58143502 CTGTCTTCCCAGAAGGCATGTGG - Exonic
955873389 3:63463553-63463575 CTGTCAGAGCAGAAGTTCTTAGG + Intronic
958038731 3:88200693-88200715 CAGTCATAGCTGAAGTCAAAGGG + Intergenic
958888225 3:99752952-99752974 AAGTCATAGCAGTAGGCATGTGG - Intronic
962979217 3:140472734-140472756 ATGTCATAGAAAAAGTCATTCGG - Intronic
963854875 3:150243188-150243210 ATTTCCAAGCAGAAGTCATGAGG - Intergenic
971645528 4:29196315-29196337 TAGTCCTAGCAGAAGACATGAGG - Intergenic
971729067 4:30352965-30352987 TTGTCATAGCAGAAAGCAAGGGG - Intergenic
971868432 4:32203965-32203987 CTGTCATAGCAGCAGACAATGGG + Intergenic
972628976 4:40827261-40827283 CTGGAATAGCTGAAGACATGGGG - Intronic
975359414 4:73450510-73450532 CTCTCATGCCAGAAGACATGAGG - Intronic
982917356 4:161228494-161228516 CAGTCATAGCAGAAGCCAAAGGG + Intergenic
984837856 4:184039322-184039344 CTGGCATAGCAGAAGGCACATGG + Intergenic
987137875 5:14916778-14916800 CAGTCATAGCAGAAGGCAAAAGG - Intergenic
987719574 5:21616625-21616647 CTGACATAGGGGAAGTCTTGTGG + Intergenic
987758102 5:22123207-22123229 CTCACATAGCAGAAGGAATGAGG - Intronic
988924649 5:35977587-35977609 CTGTCATAGCAGAAGACAAAGGG - Intronic
990172045 5:53062378-53062400 TTGTCATAGCAAAAGGCAGGAGG - Intronic
990194924 5:53303855-53303877 ATCTCATAGCAGAAGGCAGGAGG - Intergenic
991544517 5:67766635-67766657 CTGTCATTGGATAAGTCATTTGG + Intergenic
992149917 5:73892745-73892767 CTGTCCTTGCACAAGTAATGAGG - Intronic
996033131 5:118729005-118729027 CTGAAAGAGCAGAAGTCAGGGGG - Intergenic
999068207 5:148714999-148715021 CTGTCATGGCAGAAGGCAAAGGG - Intergenic
1000105933 5:158058753-158058775 ATGGCAGAGCAGGAGTCATGGGG + Intergenic
1001020550 5:168178866-168178888 CTGTAATTCCAGAAGTCAAGAGG + Intronic
1003798154 6:9629582-9629604 CTATCATGGCAGAAGTCAAAGGG - Intronic
1004017449 6:11744991-11745013 CTGTCATGGGATCAGTCATGCGG - Intronic
1004775127 6:18835604-18835626 CTGTCACATGAGATGTCATGGGG + Intergenic
1008147437 6:47908468-47908490 CATTCATTGCAGAAGCCATGTGG - Intronic
1010363476 6:75022494-75022516 CTGTGATAACATAACTCATGTGG - Intergenic
1011844428 6:91545847-91545869 CAGTCATAGCAGAAATCAGATGG + Intergenic
1012310045 6:97712437-97712459 CTGTCACAGCAGAGGCCATGGGG + Intergenic
1013611742 6:111802292-111802314 CAATCATGGCAGAAGGCATGGGG - Intronic
1015940857 6:138450473-138450495 CTCCCACAGCAGACGTCATGTGG - Intronic
1016305434 6:142679025-142679047 CTGACATAGAAGAAAACATGGGG + Intergenic
1019096590 6:169586312-169586334 CTGTTATAGGAAAAGCCATGCGG - Intronic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1023689360 7:42770274-42770296 CTGTCATATCATTAGTCATCAGG + Intergenic
1025071567 7:55904159-55904181 CTGTCTTGGAAGAAGTAATGAGG + Intronic
1026280741 7:68919748-68919770 CAGTCATGGCAGAAGTGAAGGGG + Intergenic
1026502471 7:70954665-70954687 CAGTCATAGCAGAAAGCAAGAGG - Intergenic
1026803136 7:73412346-73412368 CTGTCATGGAAGAAACCATGTGG - Intergenic
1028081209 7:86579303-86579325 CTGTCACAGCAAAATTCATTGGG - Intergenic
1028326622 7:89534728-89534750 GTTTCATAGCAGAAATCAAGAGG - Intergenic
1028724862 7:94075544-94075566 CAGTCATAGCAGTGGGCATGTGG + Intergenic
1030762139 7:113365023-113365045 CAGTCATAGCAGAAGGCAAAGGG - Intergenic
1031192948 7:118577841-118577863 CTGACATGGGAGATGTCATGGGG + Intergenic
1031252672 7:119407780-119407802 CTCTAATAGCAGAATTAATGTGG - Intergenic
1031549715 7:123093447-123093469 ATCTCATAGCAGAAGACAAGAGG - Intergenic
1033069936 7:138192783-138192805 CTGTCATGGCAGCAGGCAGGAGG - Intergenic
1033287244 7:140051999-140052021 CAGTCACAGCAGAAGTGATCAGG - Intronic
1034004421 7:147453323-147453345 CTGAGACAGCAGAAGTCATAGGG - Intronic
1035052161 7:156005212-156005234 CTGTCTTAGGATAAGTCATAGGG - Intergenic
1039159116 8:34596890-34596912 CAGTCATAGCAGAAGGCAAAGGG + Intergenic
1039412258 8:37364921-37364943 CTGTAATGGCAGAGGACATGTGG + Intergenic
1046660721 8:116945995-116946017 CTGTTACAGCAGAAGTCATTTGG - Intergenic
1046742924 8:117847599-117847621 TTGTCATTGCAGAAGCCATGAGG - Intronic
1046743174 8:117849621-117849643 CTTTCATAGCAGATGGCATTTGG - Intronic
1048949199 8:139479937-139479959 CTGTCTTAGTAGATGTGATGTGG - Intergenic
1050175279 9:2863724-2863746 CAGTCATGGCAGAAGTCAAAGGG - Intergenic
1051305850 9:15708392-15708414 CTGTCATAGGATAAGTCAAAGGG - Intronic
1052555854 9:30015619-30015641 CTGACATAACAGTAGACATGAGG - Intergenic
1053630504 9:39933199-39933221 CAATCATAGCAGAAGGCAAGGGG + Intergenic
1053775268 9:41530310-41530332 CAATCATAGCAGAAGGCAAGGGG - Intergenic
1054213383 9:62317502-62317524 CAATCATAGCAGAAGGCAAGGGG - Intergenic
1054744085 9:68836785-68836807 CTGTCTTACCAGAAGCCAGGTGG + Intronic
1185666497 X:1769451-1769473 CAGTCATGGCAGAAGTCAAAGGG + Intergenic
1186114520 X:6291649-6291671 CTGTAATATCACATGTCATGCGG + Intergenic
1187734880 X:22293247-22293269 TAGTCATAGCAGAAGTCAAAGGG - Intergenic
1189362381 X:40362762-40362784 CTCTCCTAGCAGGAGTCAAGAGG + Intergenic
1190272309 X:48875478-48875500 CAGTATTAGCAGAATTCATGTGG - Intergenic
1192054367 X:67758391-67758413 CAGCCATAGCAGAAGACTTGAGG - Intergenic
1192108850 X:68343614-68343636 CTGTCATATAAGAATTGATGTGG + Intronic
1194205723 X:91008972-91008994 CTCACATACCAGAAGTGATGGGG + Intergenic
1195746754 X:108126344-108126366 CTGTCCAAGCAAAAGTCCTGAGG - Intronic
1198095252 X:133373852-133373874 CTGTGATAAGAGGAGTCATGTGG - Intronic
1198264515 X:134996989-134997011 CAGTCAGAGGTGAAGTCATGGGG + Intergenic
1200551482 Y:4583783-4583805 CTCACATACCAGAAGTGATGGGG + Intergenic