ID: 1130044113

View in Genome Browser
Species Human (GRCh38)
Location 15:80430822-80430844
Sequence TGCCCACTGCTGCCCTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 315}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130044113_1130044116 14 Left 1130044113 15:80430822-80430844 CCTGTCCAGGGCAGCAGTGGGCA 0: 1
1: 0
2: 1
3: 22
4: 315
Right 1130044116 15:80430859-80430881 CAGCACTGATCTTCCCTTAGTGG 0: 1
1: 0
2: 1
3: 3
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130044113 Original CRISPR TGCCCACTGCTGCCCTGGAC AGG (reversed) Intronic
900326955 1:2113058-2113080 TGCCCACTGCTGGCCGAGGCTGG + Intronic
900606598 1:3526325-3526347 TGCCCATGTCTGCCCTGGCCTGG - Intronic
900671315 1:3856843-3856865 TCCCCACTCCGGCCCTGGGCCGG + Intronic
900897709 1:5495420-5495442 TTCCCAAAGCGGCCCTGGACTGG - Intergenic
901163733 1:7199579-7199601 TGCCCACCGCTGCCTTGGGTGGG - Intronic
901229583 1:7634347-7634369 TTCCCACAGCTGCCCAGGTCTGG - Intronic
902116352 1:14124880-14124902 TCCCCAGTGCTGCCCCCGACAGG - Intergenic
902518438 1:17002275-17002297 AGGTCAGTGCTGCCCTGGACCGG - Exonic
902529528 1:17081665-17081687 TGCACTCTTCTGCCCTGAACAGG - Intronic
902715592 1:18270449-18270471 TGCCCGAGGCTGCCCTGGAGAGG - Intronic
902737165 1:18408843-18408865 TGCCCTCGCCTGCCCTGGAGTGG - Intergenic
902775587 1:18672563-18672585 TGCCAAATGCGGCCCTAGACTGG + Intronic
903277967 1:22233580-22233602 AGCCCAGAGCTGCCCTGGATAGG - Intergenic
904264739 1:29311737-29311759 TGCGCACTTTTGCCCTGGAGCGG + Exonic
904607174 1:31704269-31704291 TGCCCAGAGCTGCCCTGGAAGGG + Exonic
904615197 1:31745802-31745824 TGCCCCCTGCTGCCCAGCCCGGG + Intronic
905258902 1:36703878-36703900 TGCCCTCTGCTGCCCCCAACTGG - Intergenic
905486548 1:38301277-38301299 TCCCCTCTGCTGCCCCGGCCAGG + Intergenic
907321763 1:53606963-53606985 TGCTCACTCTGGCCCTGGACCGG - Intronic
910684742 1:89904608-89904630 TGGCCACTCCTGCACTGCACAGG + Intronic
912378796 1:109235283-109235305 AGCCCATTGCTGCCCTGCACCGG + Exonic
912473830 1:109923593-109923615 TGCCCCCTCCTGGCCTGGAGGGG - Exonic
913193291 1:116431873-116431895 AGCCCACTGCTTCTCTGGATAGG - Intergenic
913221913 1:116667128-116667150 TTCCCACTGTTGCCCTGCTCTGG - Intronic
914739917 1:150455883-150455905 TGCTCACTGCAGCCCTGACCTGG + Intronic
915354406 1:155247600-155247622 TTGCCTCTGCTGCTCTGGACTGG - Exonic
918075984 1:181171907-181171929 TCCCCACTGCTGCCCTACAAGGG - Intergenic
923094152 1:230761394-230761416 TCCCCACTGCTCCCCTGCTCAGG + Intronic
923315694 1:232778048-232778070 TGCCCAGCAGTGCCCTGGACTGG - Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
923520347 1:234730672-234730694 ACCCCACTGCTGCCTTGGAGAGG - Intergenic
923938282 1:238790089-238790111 TGCCCTCTGCTTTCCGGGACCGG - Intergenic
924007747 1:239630894-239630916 TCCCCACTGCTGCCCTCCCCCGG - Intronic
924605238 1:245528509-245528531 TGCTCCCTGCTGTCCTGGAGGGG - Intronic
1064288679 10:14014022-14014044 GGTCCACTTCAGCCCTGGACGGG + Intronic
1064336537 10:14448382-14448404 TGCCCACAGCTGTCCTCAACAGG + Intronic
1065002253 10:21347728-21347750 TGCCATCTGCCACCCTGGACTGG - Intergenic
1067143533 10:43676562-43676584 GGCCCAGTGCTGACCTGGCCCGG - Intergenic
1070032626 10:72692241-72692263 TGCCGGCTGCTTCCCTGGGCTGG + Exonic
1070889176 10:79929537-79929559 TGGCCACTGCTGCCGGGGCCAGG - Intergenic
1071772478 10:88744433-88744455 TGGCCACTGCTGCACTGGAGAGG - Intronic
1072735737 10:97878145-97878167 AGCCCACTGCTCCCCAGGCCAGG - Intronic
1073100162 10:101002306-101002328 TGCCCAATGCTGGTCTGAACAGG - Exonic
1074308186 10:112298316-112298338 AGCACACAGCTGCCCTGGCCTGG - Intronic
1075079795 10:119375725-119375747 TGCCCACAGCTGGCCTGGGAAGG - Intronic
1075258334 10:120942992-120943014 TGCCCTCTGCTGCCCGGTGCCGG - Intergenic
1075335226 10:121604032-121604054 TGCCCACTGCTCCCCAGCAGCGG + Intergenic
1075336070 10:121609612-121609634 TCACCACAGCTGCCCTGGAGAGG + Intergenic
1076508878 10:130998360-130998382 TGTCCGCTGCTGACCAGGACTGG + Intergenic
1076729196 10:132429799-132429821 TGGGCACTGCTGACCTGGGCAGG + Intergenic
1077214393 11:1389367-1389389 TGCAGATGGCTGCCCTGGACGGG - Intergenic
1078349399 11:10580345-10580367 GATTCACTGCTGCCCTGGACTGG + Intronic
1078537596 11:12187440-12187462 TGCTCACTGCTGCCCCAGAGGGG - Intronic
1078618843 11:12889400-12889422 TGCCAGCTGCTGCCCTGGTGGGG - Intronic
1080386978 11:31816182-31816204 TGCCCCCTTCTGCCCCGGAGGGG + Intronic
1080642484 11:34165930-34165952 GGCCCTCTGCTGTCCTAGACTGG - Intronic
1081814287 11:45929833-45929855 TGCCCACTCCTGTCTTGGAGAGG + Intronic
1082003609 11:47408233-47408255 GGCAGACTGCGGCCCTGGACGGG + Intronic
1083596529 11:63920498-63920520 TGGCCACTGATGGCCTGGCCAGG - Intergenic
1083596627 11:63920786-63920808 CGCCCACTGGGGCCCTGGGCAGG + Intergenic
1083602946 11:63960283-63960305 TATGCAGTGCTGCCCTGGACAGG + Intergenic
1083632125 11:64101211-64101233 TGCCCACTAATGCCCTGAGCTGG - Intronic
1083677296 11:64333208-64333230 TGTCCACTGCTGCCCAGCATGGG - Intergenic
1084708910 11:70831901-70831923 TGCCCCCTGCAGCCATGGGCCGG + Intronic
1085045384 11:73349754-73349776 TCCCAAGTGCAGCCCTGGACGGG - Intronic
1085052007 11:73384771-73384793 TGCCCAGTGCCGACCTGGGCGGG - Intronic
1085269171 11:75260040-75260062 GCCTCCCTGCTGCCCTGGACTGG - Intergenic
1086001539 11:81990850-81990872 TGCCCCCTGCTCCACTGCACCGG - Intergenic
1088585423 11:111356521-111356543 TTCCCACGGTTTCCCTGGACTGG + Intronic
1088901260 11:114119421-114119443 TCCCCTTTGCTGACCTGGACTGG + Intronic
1089168111 11:116493329-116493351 TGGACAATGCTGCCATGGACAGG + Intergenic
1089458291 11:118638525-118638547 GGCCCTCTGCTTCCCTGGTCTGG - Intronic
1089912011 11:122110456-122110478 TGCTCAGTGCTGACCTGGATTGG - Intergenic
1090357565 11:126150147-126150169 TTCCCTCTGCTCTCCTGGACTGG - Intergenic
1090463510 11:126912306-126912328 TGCCCACATGTGCCCTGGGCTGG + Intronic
1091991622 12:4960449-4960471 GGCCCACTGCTGCCCAAGGCAGG + Intergenic
1094674695 12:32608060-32608082 TGCCTCCTGATTCCCTGGACTGG + Exonic
1101374104 12:104156135-104156157 TGCCAACCCCTGCCCTAGACAGG - Intergenic
1102042221 12:109808351-109808373 GCTCCACTGCTGACCTGGACGGG - Exonic
1102220067 12:111188320-111188342 TGCCAGGTGCTGCCCTGGGCTGG + Intronic
1102572849 12:113838091-113838113 GGCCCCCTGCAGCCCTGAACTGG - Intronic
1103804012 12:123558476-123558498 CACCCACTGCTGCTCTGGATGGG + Intergenic
1104789533 12:131473058-131473080 AGCCCACAGCTGCCCTGCCCAGG - Intergenic
1105891248 13:24684019-24684041 TGCCCTCTGCTGGCCAGCACTGG - Intronic
1106476985 13:30107541-30107563 CGCCCTCTGCTGCCCTGGGAAGG - Intergenic
1107432564 13:40352979-40353001 TGCCCACAGCTGCCCCAGCCTGG + Intergenic
1107959344 13:45544684-45544706 AGGCCACTGCTGGCTTGGACTGG - Intronic
1109753522 13:66727187-66727209 AGCTCACTGCAGCCTTGGACTGG - Intronic
1111824873 13:93255040-93255062 TGCCCACTGCAGCACAGAACTGG - Intronic
1111933376 13:94534683-94534705 TGCCATCGGCTGCCCTGGGCAGG + Intergenic
1112322789 13:98422325-98422347 TCCCCACTGCTCCCCTGAAAAGG - Intronic
1113467843 13:110524684-110524706 TGCCCTGTGCTGCCCTGCCCAGG + Intronic
1115877270 14:37874822-37874844 TGCCCTCTGCTGCCCTCTGCTGG + Intronic
1117284885 14:54277557-54277579 TGACCTCTACTTCCCTGGACAGG - Intergenic
1117880268 14:60306404-60306426 TGGCCACTGCAGCCCTGAACTGG - Intergenic
1119162404 14:72463670-72463692 TTGACAATGCTGCCCTGGACAGG - Intronic
1120805022 14:88737494-88737516 AGCCCAGTGCAGCCCGGGACAGG + Intronic
1121118968 14:91364019-91364041 AGCCCAGTGGTGCTCTGGACAGG + Intronic
1121427120 14:93860281-93860303 TCCTCACAGCTGCCCTGGAAGGG + Intergenic
1122404606 14:101492774-101492796 AGCCACCTGCTGCCCTGAACAGG + Intergenic
1122703467 14:103605727-103605749 TGTCCAGTGCAGCCCTGGTCTGG + Intronic
1122770390 14:104095202-104095224 AGCCCCCTGCTGCCATGGAGAGG + Intronic
1122773516 14:104107362-104107384 TGCACAGAGCTGCCTTGGACAGG + Intronic
1122881101 14:104690773-104690795 TGCTCCCTGCCGCCCTGCACTGG + Intronic
1122905836 14:104801050-104801072 TGCCCGCGGCGGCTCTGGACGGG + Exonic
1123054870 14:105564580-105564602 TGCCTGCTGCTGTCCTGGCCTGG + Intergenic
1123060274 14:105591274-105591296 TGCCCTGAGCTGCCCTGGCCTGG - Intergenic
1123079314 14:105684159-105684181 TGCCTGCTGCTGTCCTGGCCTGG + Intergenic
1123084753 14:105712265-105712287 TGCCCTGAGCTGCCCTGGGCTGG - Intergenic
1124470058 15:29976516-29976538 TGCCCTCGGCAGCCCTCGACAGG + Intergenic
1126675996 15:51159736-51159758 TGGGCACTGCTTCCCAGGACCGG - Intergenic
1128836707 15:70814700-70814722 TGCCCAGTGATGACCTGAACTGG + Intergenic
1129111572 15:73340142-73340164 TCCCCACTGCCACCCTGGCCAGG - Intronic
1129405386 15:75313602-75313624 TGCCCTCTGGAGCCCTGGGCAGG - Intergenic
1129669982 15:77602219-77602241 TGCCAGCTGCTGCCCTGTGCTGG - Intergenic
1129775688 15:78234938-78234960 TGCCGAATGCTGCCCTGGGAGGG + Intronic
1130044113 15:80430822-80430844 TGCCCACTGCTGCCCTGGACAGG - Intronic
1131354512 15:91733005-91733027 TTCCCCGTGCTGCACTGGACAGG + Intergenic
1132146516 15:99432842-99432864 TGCCCACTGCTGCCCCAAAAAGG - Intergenic
1132316957 15:100897416-100897438 TGCCCACTGTACCCCTGGAGGGG - Intronic
1132350995 15:101139688-101139710 TGCCTACTGCTGCTCTTGGCTGG - Intergenic
1132828479 16:1916519-1916541 TGCCCAGGGCGGGCCTGGACTGG + Intronic
1134131645 16:11654362-11654384 TGCCCACTGCTCCCCTGGGGTGG + Intergenic
1134234282 16:12453212-12453234 TGGCCACGTCTGCCATGGACAGG - Intronic
1136114678 16:28087279-28087301 TTGCCCCTGCTGCCCTGGCCTGG - Intergenic
1136540571 16:30925679-30925701 GGCCCACTGGGGCCCTGGCCTGG - Intronic
1136750226 16:32628888-32628910 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1139092054 16:63660179-63660201 TGACCACTGCTCACTTGGACAGG + Intergenic
1140277770 16:73526142-73526164 ATCTCACAGCTGCCCTGGACTGG - Intergenic
1140660833 16:77190443-77190465 TGCCCGCCCCTGCCCTGGGCTGG + Intergenic
1141701190 16:85642858-85642880 TGCTCGCTGCTGGCCTGGTCAGG + Intronic
1142201592 16:88763621-88763643 TACCCAGTGCTGCCCTGACCTGG - Intronic
1203052357 16_KI270728v1_random:888093-888115 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1142561857 17:814645-814667 GGCCCAGTGCTGCCCTTGAGTGG - Intronic
1143082105 17:4389314-4389336 TGCCCACTGAGGCCCTAGTCTGG - Intergenic
1146917637 17:36688249-36688271 TGCCTACAGCGTCCCTGGACAGG - Intergenic
1146940623 17:36841981-36842003 TGCCTACCACTGCCCTGCACTGG + Intergenic
1147038821 17:37701604-37701626 TGCACACTCCTGCCCTCTACTGG - Intronic
1147200286 17:38797062-38797084 TTCCCACCACTGCCCTGGACAGG - Intronic
1147636513 17:41967431-41967453 TGCCCTGTGCTGCCCTGTTCTGG + Intronic
1147896650 17:43755801-43755823 TGGCCACCCCTGCCCTGGACCGG + Intronic
1148136631 17:45296725-45296747 TGCCCAGTGCTGCCCTGCTCGGG - Intronic
1148185457 17:45640216-45640238 TGCCCAGTGCTGCGGAGGACAGG - Intergenic
1149638409 17:58187706-58187728 TGCCCACTAGGACCCTGGACGGG + Intergenic
1150965301 17:69960982-69961004 AGCCCAGTGCTGCACTGGCCAGG - Intergenic
1151195466 17:72428105-72428127 TGCCAACTGCTGCTCTGAGCTGG + Intergenic
1152208983 17:78992983-78993005 TGCCCACAGCTGCACAGGCCAGG - Exonic
1152220671 17:79063452-79063474 TACCCACCGCTTCCCTGGGCTGG - Intergenic
1152469625 17:80483441-80483463 TACCCACTGCCTCCCTGGATGGG - Intergenic
1152544190 17:80992417-80992439 TGCCTCCTGGTGCCCTGGGCCGG + Intronic
1152664453 17:81559230-81559252 TGCCCTCTGCTGGCTAGGACCGG - Exonic
1152693128 17:81730329-81730351 GACCCACTGCTGCCCTGTCCAGG - Intergenic
1152709514 17:81863988-81864010 TGCCCTCTGCTACCCTGGCTAGG - Intergenic
1153352694 18:4098463-4098485 TAATCACTGCAGCCCTGGACTGG - Intronic
1153942603 18:9990804-9990826 TGTCCAGGGCTGCCCTGAACAGG + Intergenic
1154131200 18:11738351-11738373 TGCCCACAGCAGACCTGGCCTGG - Intronic
1154406382 18:14095795-14095817 TGCACTGTGCTGCCCAGGACTGG + Intronic
1157467038 18:47956227-47956249 TAGCCACTGGTCCCCTGGACAGG - Intergenic
1158169896 18:54585939-54585961 TGGCTACTGCAGCCCTGAACAGG + Intergenic
1158305641 18:56102486-56102508 TCCTCAGTTCTGCCCTGGACTGG - Intergenic
1158648051 18:59264849-59264871 TAGGCACTGCGGCCCTGGACCGG - Intergenic
1159946021 18:74445395-74445417 TGCCCCCTGCTGCCCTGGAGGGG - Intronic
1160289292 18:77575698-77575720 TGCACATTGCTGCTCTGGTCTGG + Intergenic
1160374820 18:78403639-78403661 TGCCCACCTTTGTCCTGGACTGG - Intergenic
1161086543 19:2338145-2338167 TGCCGACTGCTGGGCTGGGCAGG + Intronic
1162298632 19:9830680-9830702 AGCCCACTGCAGCCCTGAACTGG + Intergenic
1162480752 19:10925733-10925755 GGCTCACTGCTGCCCCGGCCTGG - Exonic
1163323776 19:16590036-16590058 TGCACTCTCCTGCCCTGGATGGG + Intronic
1163362078 19:16853098-16853120 TCCCCACTGCAGCGATGGACAGG - Exonic
1163826099 19:19525796-19525818 TGCACACAGCTGCCAGGGACAGG - Intronic
1165243401 19:34483892-34483914 AGCTCACGGCTGCCCTGAACTGG + Intronic
1166884867 19:45954217-45954239 TGCCCACAGCAGCCCTGGGCAGG + Intronic
1167037824 19:47004378-47004400 CGGCCACTGCTGACCTGGGCTGG + Exonic
1167423587 19:49417752-49417774 TGCCCACAGCTGCCCTCGCCAGG - Exonic
1167592772 19:50413531-50413553 TGCCCACCGCTGCCCTGAGATGG + Intronic
1167612722 19:50515095-50515117 TGCCCATAGCTGCCGTGTACGGG + Intergenic
1168257794 19:55176065-55176087 TGCCACCTGCTGCCCTGGCCCGG + Exonic
925478662 2:4246882-4246904 TGCACACTGCTGCCTTGGCGAGG + Intergenic
926075665 2:9940991-9941013 CTCCCACTGCTGCCCAGGAAGGG + Intergenic
927889678 2:26740536-26740558 TGCCGACAGCTGGCCTGGTCTGG - Intergenic
928126695 2:28621267-28621289 CGCCTCCTGCTGCCCTGGAGAGG - Intronic
930359153 2:50357192-50357214 TACTCACTGCTGCCTTGAACTGG - Intronic
932083056 2:68732676-68732698 TCCCCACTGCTGCTGAGGACTGG + Intronic
932373491 2:71213044-71213066 TCCCCACTGCTCCCCAGGCCAGG - Intronic
935710693 2:105895508-105895530 TGGCCACTGATGCTCTGGCCAGG + Intergenic
937252539 2:120533798-120533820 TTCCCACAGCTGCCGGGGACCGG + Intergenic
937336164 2:121063593-121063615 GCCACACTGCTGCCCTGGCCTGG + Intergenic
937434687 2:121870677-121870699 GGCCTTCTGCTGCCCAGGACAGG + Intergenic
937888357 2:126915856-126915878 ATCTTACTGCTGCCCTGGACTGG + Intergenic
937970651 2:127546364-127546386 TGCCCACTCCAGCCCTGTCCTGG + Intronic
938088332 2:128416475-128416497 TTCACACTGCTGCCCGGGGCAGG + Intergenic
938313380 2:130309663-130309685 TGCCTTCTGCTGTTCTGGACAGG + Intergenic
944907925 2:204281468-204281490 TGGCCAATGCTTCCCAGGACTGG - Intergenic
947826441 2:233108740-233108762 TGCCCCGTGCTGCCCTGGGAGGG - Intronic
948027446 2:234789373-234789395 TGCCCCCAGCTGCTCTGGGCAGG + Intergenic
948627774 2:239279724-239279746 TGCCCCCTGCGGGCCTGGCCTGG - Intronic
948724281 2:239922204-239922226 TACCCACTTCTGCTCTGGAGTGG + Intronic
1170304025 20:14917820-14917842 CCCCCACTGCTTCCCTGGAATGG - Intronic
1170614195 20:17936023-17936045 TGAACACTGCTGCTCTGGAGAGG + Intergenic
1170638924 20:18134523-18134545 TGGCCACTGCTTTCCTGGAGAGG - Intergenic
1171305499 20:24102473-24102495 TGCCCTCTGCTGGCCTGGCATGG - Intergenic
1172790673 20:37503294-37503316 AGCCCCCTGGAGCCCTGGACTGG + Intronic
1172800990 20:37576079-37576101 TGCCCTGTGCTTCCCTGGAGGGG + Intergenic
1173018446 20:39247642-39247664 TGACCACTGCAGCTCAGGACAGG - Intergenic
1176231674 20:64036198-64036220 AGCCAACCGCTTCCCTGGACAGG - Intronic
1176241541 20:64077920-64077942 CGCCCACTTCTGCCCAGGGCAGG + Intronic
1178597691 21:33969607-33969629 GTCCCACTGCTTCCCTGGCCTGG + Intergenic
1179150021 21:38802027-38802049 TGATCACTGCTGCCCTGCACTGG - Intergenic
1179354805 21:40649297-40649319 TGCCTCCTGCTGCTCTGGAGTGG - Intronic
1179397298 21:41053008-41053030 TCCCCACTGCACCCCTGGATGGG + Intergenic
1179604353 21:42503893-42503915 TGACCACTGAGGCCCTGCACTGG + Intronic
1179659336 21:42864499-42864521 GCCTCACTGCTGCCCTGGGCTGG - Intronic
1179659520 21:42865497-42865519 TGCCCTCTGCTGAGCTGGGCAGG - Intronic
1180549177 22:16527798-16527820 CCCCTACTGCTGCCCTGGCCTGG + Intergenic
1181408827 22:22703983-22704005 TGCTCAATGCAGCCCAGGACAGG + Intergenic
1182559365 22:31147726-31147748 TGCCCAAGGCTGCCCAGGAGGGG - Intergenic
1183512587 22:38244800-38244822 TGCCCAGGTCTGCCCTAGACAGG - Intronic
1183698149 22:39434787-39434809 GGCCCACTCCTGCCCTGCCCTGG - Intronic
1183931223 22:41237299-41237321 TGCCCACTGGGGCCTTGGAGGGG - Exonic
1184081813 22:42226775-42226797 TGCCCACTTCTGCTTTGGATTGG - Intronic
1184089226 22:42283674-42283696 TGCCCAGCCCTGCCCTGGCCCGG + Intronic
1184264310 22:43338906-43338928 TGCCGGCTGCTTCCCTGGAAGGG - Intronic
1184415410 22:44349288-44349310 TGGCCCCTGCTGCACTGGGCAGG + Intergenic
1184861328 22:47174691-47174713 GGACCACTCCTGCCCTGGACCGG + Exonic
1184867600 22:47210116-47210138 TGCCCTCTTCTCCCCTGGACAGG + Intergenic
1185351708 22:50343133-50343155 TGCTGACTGCTGCCTTGGAGTGG - Intergenic
950081453 3:10225087-10225109 TGCCCTCTGCTGCCCTTTTCTGG + Intronic
952196042 3:31076195-31076217 TCCCCACTGAGCCCCTGGACTGG + Intergenic
954112820 3:48444915-48444937 TACCTCCTGCTGCCCAGGACTGG + Intergenic
954331151 3:49891046-49891068 TGCCCAGTGCAGACTTGGACTGG - Intronic
961696642 3:128709724-128709746 TGCCCTCTGCCTCCCTGGAGAGG - Intergenic
962345015 3:134612324-134612346 TGCCTCCTTCTGCCCTGGAGTGG - Intronic
963056847 3:141193221-141193243 CACCCACTGCTTCCCTGGGCAGG - Intergenic
963283480 3:143410247-143410269 TGCTAACTGCAGCCCTGTACTGG + Intronic
967859798 3:194141876-194141898 TGCCCACTCCTGCCCCGGCGTGG - Intergenic
968902451 4:3438076-3438098 TACCAACTGCTGCCCTCCACAGG - Intronic
969117080 4:4877352-4877374 TGACCTCTGCTGCCATGGAGTGG - Intergenic
969345457 4:6567140-6567162 TCCCCACTTCTGCCCCGGCCGGG + Intergenic
969617653 4:8262866-8262888 TGGGCCCTGTTGCCCTGGACTGG - Intergenic
972246416 4:37249429-37249451 TGCCCACTGCTGACAATGACTGG - Intronic
973718768 4:53702806-53702828 TGCTCGCTGCAGCCCTGGCCTGG + Intronic
973978556 4:56286764-56286786 CTCCCACTGCTGCCGTGGTCAGG + Intronic
975658020 4:76660872-76660894 AGCTCACTGCAGCCCTGAACTGG + Intronic
975903929 4:79187334-79187356 GGCCCACTGCTGCCCAGGGCTGG + Intergenic
976119447 4:81763467-81763489 TACCCACTCCTGCTCTGGAGAGG - Intronic
977510236 4:97953146-97953168 GGGCCACTGCTGCCCTGCATGGG - Intronic
981727586 4:147863524-147863546 TGCCCCCTGCTGCTATGAACAGG + Intronic
985551892 5:537950-537972 TGGGCACAGCTGCCCTGCACAGG + Intergenic
985930782 5:3056056-3056078 GGCTCACTGCAGCCATGGACAGG + Intergenic
987061415 5:14247192-14247214 TTCCCTCTGCTGCCCTCGGCTGG + Intronic
988367820 5:30324236-30324258 TGCTCACTGCTGCCCCAGGCTGG + Intergenic
995728146 5:115203793-115203815 TGCACACTGCTGCTCTGGTCTGG - Intergenic
997226117 5:132210698-132210720 GGCCCAGCCCTGCCCTGGACTGG + Intronic
998867072 5:146516009-146516031 TGCCCTCTGATTCCCAGGACTGG - Exonic
999372157 5:151062460-151062482 TGCTCCTTGCTGCCCTGAACAGG + Intronic
999743577 5:154575002-154575024 TCCCCACTGCTGCCTTGGGGAGG + Intergenic
1001995257 5:176152330-176152352 TGCCCGCAGCTTCCCTGGGCTGG - Intergenic
1005300396 6:24464846-24464868 TCCCCACTACTGACCTGAACCGG - Intronic
1005687953 6:28273183-28273205 TGCTCACTGCAGCCTTGAACTGG - Intronic
1007252005 6:40502141-40502163 TGCCCACAGCAGCCCTAGAGGGG + Intronic
1007284613 6:40738468-40738490 TGCCTACTCCCACCCTGGACTGG + Intergenic
1007786782 6:44284851-44284873 TGTCCACTGCTGCCCTGCCCAGG + Intronic
1007790432 6:44305404-44305426 TGCCCACTGCTGCCCCTGGAGGG + Intronic
1009702476 6:67201811-67201833 CGCCCATTGCTGCTCTGGATAGG + Intergenic
1013823036 6:114178514-114178536 TTCCCAGAGCTGCCCTAGACAGG + Intronic
1014243359 6:119041755-119041777 TGCCCACTGCCACTCTGGATCGG + Intronic
1016825817 6:148387762-148387784 TTCACTCTGCTGCCCTGGCCAGG + Intronic
1017104170 6:150872490-150872512 TTCTCACTGCTTCACTGGACTGG - Intronic
1017603129 6:156105033-156105055 CACCCAATGCTGCCCTTGACAGG + Intergenic
1018939310 6:168297848-168297870 TGCCCCGTGCTGCCCTTGACTGG - Intronic
1019101924 6:169638587-169638609 TGCTCTCTGCGGCCCGGGACGGG - Exonic
1019147974 6:169986928-169986950 TGCCCAGTGCTGCCTGGGGCAGG - Intergenic
1019215341 6:170439380-170439402 GGGCAGCTGCTGCCCTGGACTGG - Intergenic
1019285087 7:219376-219398 TGGCCATTGCTGTCCTGGGCTGG - Intronic
1019285097 7:219416-219438 TGGCCATTGCTGTCCTGGGCTGG - Intronic
1019423607 7:963050-963072 TGCCCTGTGCTGCCCTGATCTGG + Intronic
1019430326 7:996169-996191 TGGCCACTGCTGGCCTGGCTGGG - Intergenic
1020137832 7:5596421-5596443 GGCCCAGAGCTGCCCTGGGCAGG + Intronic
1022213688 7:28236944-28236966 TGCCCACAGCTGCCCTGCCTCGG - Intergenic
1022497782 7:30863976-30863998 TGCTCAGTGCTGCCCAGGTCTGG - Intronic
1022949535 7:35322689-35322711 TTCCCACTCCTGCCCTTCACAGG + Intergenic
1023621446 7:42077462-42077484 TGCACAGTGTTTCCCTGGACAGG - Intronic
1023733120 7:43210746-43210768 CGCCCATTGCTGCTCTGGATTGG - Intronic
1023874940 7:44281843-44281865 TGCCCACTGCTCTCCCGGCCAGG + Intronic
1025158278 7:56630162-56630184 GGCCCACTTCTGCTCTGGCCTGG + Intergenic
1026891562 7:73985659-73985681 TGCCCACCGGTGCCCTGAGCTGG - Intergenic
1027136642 7:75629209-75629231 TGCCTACTGCTACCCGGGCCTGG - Intronic
1028892507 7:96003689-96003711 AGCCCACTCCTGCTCTGTACTGG - Intronic
1028902415 7:96116333-96116355 TGCCTACCGCTGCTTTGGACAGG - Intergenic
1029699340 7:102236246-102236268 TGCCCACTGATGACCTGCCCAGG + Intronic
1031311729 7:120207291-120207313 TGCCCCCTGCTGTGCTGGAGGGG - Intergenic
1032006291 7:128304632-128304654 TGGACACTGCTGGCCTGGATAGG + Exonic
1034284363 7:149874428-149874450 TGCCCACTTGTGCCCTTTACTGG - Intronic
1034470691 7:151252795-151252817 AGCGCACAGCTGCCCTGGCCTGG - Intronic
1034885899 7:154798655-154798677 TCCCAACTGCTGCCATGGGCGGG - Intronic
1035659049 8:1333224-1333246 AACCCACTGCTACCCTGGCCAGG + Intergenic
1037912132 8:22749745-22749767 TCCACACTGCTGCCCGTGACTGG - Intronic
1037954359 8:23042572-23042594 TGCCCACTCCTGGACTGAACCGG - Intronic
1038424229 8:27454161-27454183 AGCCCACAGCTAACCTGGACCGG + Exonic
1040314608 8:46254387-46254409 TTCCCAGGGCTGTCCTGGACGGG + Intergenic
1040315568 8:46259121-46259143 CCCCCACGGCTGCCCTGGATGGG + Intergenic
1040326051 8:46342136-46342158 TCCCCAGTGCTGTCCTGGTCAGG + Intergenic
1041496512 8:58491528-58491550 TGCCCAAGCCTGCCCGGGACTGG + Exonic
1045300755 8:100908252-100908274 TGCCTCCTGCTGCCATTGACAGG + Intergenic
1045863500 8:106839298-106839320 TGCCCACTGCTGCTCTCAACTGG - Intergenic
1047303194 8:123632665-123632687 TCCACACTGCTTCTCTGGACCGG + Intergenic
1047318380 8:123755139-123755161 TGCCTCCTGCTGCCATCGACAGG + Intergenic
1047746892 8:127851835-127851857 TGGCCCCTGCTGCTCCGGACTGG + Intergenic
1048138124 8:131766059-131766081 TGGCCACAGCTGCCAAGGACTGG - Intergenic
1049256362 8:141616010-141616032 TCTCCAATGCTGCCATGGACGGG - Intergenic
1049408143 8:142460741-142460763 GGCCCACTTCTGGCCTGGAGAGG - Intronic
1049475594 8:142795664-142795686 TTCCCACAGCCGCCCTGGTCCGG - Intergenic
1050614093 9:7383520-7383542 TTTCCACTGCTGCCTTGGCCAGG + Intergenic
1054805479 9:69392754-69392776 TGCCCACCGCTGCCCTGACTCGG - Intergenic
1055282570 9:74691264-74691286 TGCCCCGTGCTGCCCTGAACAGG - Exonic
1056551386 9:87655907-87655929 GGCACAGTGCTGCCCTGGAAGGG - Intronic
1056724096 9:89097058-89097080 TGCCCACTGGTGTCCAGGGCTGG - Intronic
1057218155 9:93240960-93240982 GGGGCACTGCTGCCCTGGGCCGG + Intronic
1058119156 9:101119406-101119428 AGCCCTCTGCTGCCCTCCACTGG - Intronic
1059322328 9:113479503-113479525 TGTCCATTGATGCCCAGGACCGG + Exonic
1059698203 9:116748743-116748765 CACCCAGTCCTGCCCTGGACAGG + Intronic
1059958705 9:119544599-119544621 TGCTCTCTTCTGCCCTGGCCAGG + Intergenic
1060203089 9:121663539-121663561 TGCCCACTGCTGCTGGGGAGTGG - Intronic
1060235587 9:121860397-121860419 TGTCCACGGCAGCCATGGACAGG + Exonic
1060236127 9:121863916-121863938 TCCCTCCTGCAGCCCTGGACTGG - Intronic
1060266131 9:122112384-122112406 TACCCACAGCTGCCCTGGGAGGG + Intergenic
1060267759 9:122122160-122122182 TGTCCTCGGCTGCCCTGGGCTGG + Intergenic
1060819880 9:126655168-126655190 TGCCCAAAGATGCCCTGGCCTGG + Intronic
1061360298 9:130137409-130137431 TGTCCACTGCTGCTCTGGAAGGG - Exonic
1061413402 9:130432885-130432907 TGGCAGCTGCTGCCCTGGAAAGG + Intronic
1062278237 9:135740619-135740641 TGACCACTGCTGCCCTAAGCAGG + Intronic
1062467937 9:136689436-136689458 TGCCCACTGCTCTCCTGAAGAGG + Intergenic
1062511176 9:136907037-136907059 AGCCCACTGCTGCCCCAGGCAGG - Intronic
1062566836 9:137167322-137167344 CGCCCAGTGCCGCCCTGGCCCGG - Intronic
1062679970 9:137774143-137774165 TGCCCACTGCTGGCCTGTGATGG + Intronic
1189437728 X:41007740-41007762 TCTCCACTGCTGCCCTGCCCTGG + Intergenic
1192161179 X:68789074-68789096 TCCCCACTGTTCCCATGGACAGG - Intergenic
1197594654 X:128451055-128451077 TTCCCACTGCTGCCATTGCCAGG - Intergenic
1199880832 X:151973451-151973473 GGCTCACTGGTGCCCTGGAGTGG - Intronic