ID: 1130046988

View in Genome Browser
Species Human (GRCh38)
Location 15:80453275-80453297
Sequence ACAGGTCCTGCCCTTGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 6, 3: 35, 4: 358}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130046988_1130046994 10 Left 1130046988 15:80453275-80453297 CCAGGGGCAAGGGCAGGACCTGT 0: 1
1: 0
2: 6
3: 35
4: 358
Right 1130046994 15:80453308-80453330 TCAATGGGCTTGACCTCTCTAGG 0: 1
1: 0
2: 1
3: 17
4: 182
1130046988_1130046995 11 Left 1130046988 15:80453275-80453297 CCAGGGGCAAGGGCAGGACCTGT 0: 1
1: 0
2: 6
3: 35
4: 358
Right 1130046995 15:80453309-80453331 CAATGGGCTTGACCTCTCTAGGG 0: 1
1: 0
2: 1
3: 13
4: 224
1130046988_1130046993 -5 Left 1130046988 15:80453275-80453297 CCAGGGGCAAGGGCAGGACCTGT 0: 1
1: 0
2: 6
3: 35
4: 358
Right 1130046993 15:80453293-80453315 CCTGTGGAAGGCAAATCAATGGG 0: 1
1: 0
2: 0
3: 12
4: 185
1130046988_1130046991 -6 Left 1130046988 15:80453275-80453297 CCAGGGGCAAGGGCAGGACCTGT 0: 1
1: 0
2: 6
3: 35
4: 358
Right 1130046991 15:80453292-80453314 ACCTGTGGAAGGCAAATCAATGG 0: 1
1: 0
2: 4
3: 39
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130046988 Original CRISPR ACAGGTCCTGCCCTTGCCCC TGG (reversed) Intronic
900018882 1:172883-172905 AAAGTCCCTGCCCTAGCCCCTGG + Intergenic
900049138 1:531478-531500 AAAGTCCCTGCCCTAGCCCCTGG + Intergenic
900071368 1:773302-773324 AAAGTCCCTGCCCTAGCCCCTGG + Intergenic
900246840 1:1640253-1640275 TCAGGCCCTCCCCTCGCCCCGGG - Intronic
900258062 1:1707385-1707407 TCAGGCCCTCCCCTCGCCCCGGG - Intronic
900368351 1:2320561-2320583 ACCGCACCTGCCCTGGCCCCTGG - Intergenic
900411502 1:2514678-2514700 GCAGGCCCTGACCCTGCCCCGGG - Intronic
900584650 1:3426813-3426835 GCACGTCCTGCCCTGTCCCCAGG - Intronic
901455734 1:9361803-9361825 ACAGGGCCTGGCCTGACCCCGGG + Intronic
902916167 1:19640956-19640978 ACAGGTTCTGCCTTTCCCGCTGG + Intronic
903276960 1:22228488-22228510 CCAGGGCCAGCCCTGGCCCCTGG - Intergenic
903438136 1:23368103-23368125 ACAGGCCCTGCCCACTCCCCAGG + Intronic
904292711 1:29498107-29498129 TCCTGTCCTTCCCTTGCCCCAGG - Intergenic
904321241 1:29698897-29698919 CCTGCTCCTGCCCCTGCCCCTGG + Intergenic
904832454 1:33313790-33313812 AGAGGACCAGACCTTGCCCCAGG - Intronic
905204906 1:36337881-36337903 ACAGGTCCAGCCAGTGTCCCTGG + Intergenic
905491615 1:38348707-38348729 ACTGGCCCTGCCTTAGCCCCAGG + Intergenic
907331836 1:53676675-53676697 ACAGGTCCTTCCCCAGCCCTCGG + Intronic
912410509 1:109477870-109477892 ATCGGTCAGGCCCTTGCCCCAGG - Exonic
912445387 1:109732171-109732193 TCAGATCCTGGCTTTGCCCCTGG - Intronic
913621892 1:120619916-120619938 ACAGGTCTTGCCCTTTGCTCAGG - Intergenic
915117177 1:153608410-153608432 CCAGGCCCTGCCCCAGCCCCAGG + Intronic
917666079 1:177227133-177227155 ACAGGTCCTGCCCATACTCAAGG + Intronic
917925708 1:179787670-179787692 TCAGGTCCCGCCCCTGCTCCTGG - Intronic
919752254 1:201044928-201044950 CCAGGTCCTGCTCTGGCCTCTGG + Intronic
919972593 1:202590731-202590753 ACATGTACAGCCCTTGCCCCCGG - Exonic
920927514 1:210356847-210356869 ACTGGTCCTGTCCTTGAACCAGG + Intronic
922099333 1:222468960-222468982 ACAGGCACTGCCACTGCCCCTGG + Intergenic
922106735 1:222518751-222518773 AAAGTCCCTGCCCTAGCCCCTGG + Intergenic
922261372 1:223948455-223948477 ACAGGCACTGCCACTGCCCCTGG + Intergenic
922724929 1:227918295-227918317 CCAGGTCCTCCTCTTTCCCCAGG + Intergenic
922924349 1:229335481-229335503 ACGGGTCCTCCCCTTGAACCTGG + Intronic
923363683 1:233237787-233237809 TGAGGTCCTTCCCTAGCCCCAGG + Intronic
923435640 1:233965385-233965407 ACAGGTCCTGCCCATACTCAAGG - Intronic
924348915 1:243096317-243096339 AAAGTCCCTGCCCTAGCCCCTGG + Intergenic
1062793821 10:327158-327180 ACAAGTCCAGCCCTCGCGCCTGG + Exonic
1062832253 10:613794-613816 ACAGGTCTTCCCTGTGCCCCGGG + Intronic
1065914764 10:30344844-30344866 ACAGGACCTGCCACTGCGCCAGG + Intronic
1066727451 10:38408586-38408608 AAAGTCCCTGCCCTAGCCCCTGG - Intergenic
1067043161 10:42969291-42969313 ACAGGTGCAGCCCCAGCCCCTGG + Intergenic
1067415487 10:46098664-46098686 ACAGGTCCTGTGCCTCCCCCTGG - Intergenic
1069124221 10:64608894-64608916 ATAGGTACTGCACTTGACCCAGG - Intergenic
1069742069 10:70691115-70691137 ACAGGTCCTGCCTCTGGGCCAGG + Intronic
1070805807 10:79270089-79270111 ACAGGGCCTGTCACTGCCCCTGG + Intronic
1072563333 10:96597050-96597072 GGAGGTCCTGCCCTAGTCCCAGG + Intronic
1072951239 10:99848438-99848460 ACAGGTCTTGCTCCTGCCCCAGG + Intronic
1074346443 10:112690884-112690906 ATAGGTCCTGCCCTAGCCATAGG + Intronic
1074673355 10:115820884-115820906 CCAGGTCCTGCCCTAGACACTGG - Intronic
1074857495 10:117484004-117484026 TCAGTTCCTGCCCTGGCCACAGG + Intergenic
1075410709 10:122225950-122225972 CCAGGCCCTGCCCCTGCCCTGGG + Intronic
1075739989 10:124689454-124689476 TCAGGTCCTGCCCACGCACCTGG + Intronic
1076015480 10:127024253-127024275 ATAGGTGCTGCCCTTGCCACTGG + Intronic
1076032805 10:127173961-127173983 GCAGGTCCTGCCCTGGGCTCTGG - Intronic
1076313159 10:129522321-129522343 ACAGGTAATGCCTTTGCCTCAGG + Intronic
1076379184 10:130013809-130013831 ACATGTCCTGCCCCTGCCTTGGG - Intergenic
1076547394 10:131254458-131254480 ACAGGTGGTGCCCCTGCGCCTGG + Intronic
1076628932 10:131841255-131841277 ACAGGTGCTGCCCCTACACCCGG - Intergenic
1076810243 10:132882687-132882709 CAAGGTCCTGCCCTTAGCCCGGG + Intronic
1076870703 10:133191886-133191908 CCAGTGCCTGCCCTGGCCCCAGG + Intronic
1076975482 11:168079-168101 AAAGTCCCTGCCCTAGCCCCTGG + Intronic
1077059781 11:613040-613062 ACAGGTCCTGCCCGAAGCCCAGG + Exonic
1077377076 11:2210078-2210100 TCAGGCCCTGCCCTTCCCGCCGG - Intergenic
1077545155 11:3165966-3165988 AGAAGTCCTCCCCTGGCCCCTGG + Intronic
1080746294 11:35111480-35111502 AGAGGCCCTGGCCTTGTCCCTGG + Intergenic
1081762168 11:45584196-45584218 ACAGCTCCTCACCCTGCCCCAGG - Intergenic
1083358301 11:62084854-62084876 ACAGGTCCTGCCCTATTCCCTGG + Intergenic
1083361957 11:62115312-62115334 AAAGTTCCTGCCCTTTTCCCTGG + Intergenic
1084021919 11:66422844-66422866 CCAGGTCCTGGCCCTGGCCCTGG + Exonic
1084094563 11:66902545-66902567 TCAGGTCCTGCCCTGCCACCTGG + Intronic
1084177965 11:67433275-67433297 CCAGGCCCTGCCCTTGCCCCAGG - Intronic
1084677502 11:70644546-70644568 GCTGGTCCTGCCCTTGGCCGGGG - Intronic
1085427379 11:76416464-76416486 AAAGGTTCTGCCCTTAGCCCAGG - Intergenic
1089322839 11:117638086-117638108 CCAGGCCCTACCCCTGCCCCAGG - Intronic
1089351381 11:117823535-117823557 TAAGGTCCTGCCCCTGCCTCTGG + Intronic
1090057219 11:123433513-123433535 ACAGGCCATGCCATTGCACCCGG - Intronic
1090119928 11:124015611-124015633 ACAGGCCTTCCCCATGCCCCAGG + Exonic
1090202911 11:124868798-124868820 TCCGGTCCTACCCTTGACCCTGG - Exonic
1091661430 12:2386745-2386767 ACAGGGCACGCCCTTGCCCTCGG - Intronic
1094490689 12:30958769-30958791 ACTGCCCCTGCCCCTGCCCCAGG - Intronic
1097233819 12:57526892-57526914 CCTGGTCCTCCCCTAGCCCCAGG + Exonic
1097236758 12:57545952-57545974 ACAGGTCCTTCCCTTTCTCGGGG - Intronic
1099765791 12:86981693-86981715 CCAGGTCCTTCCCTTGACACAGG - Intergenic
1100089148 12:90949063-90949085 TCTGCCCCTGCCCTTGCCCCAGG - Intronic
1100454308 12:94737227-94737249 ACATGTCCTTTCCTAGCCCCAGG + Intergenic
1100958670 12:99938037-99938059 ACAGGTCCTGCCCATACTCAAGG - Intronic
1101031655 12:100666821-100666843 GCAGTTCCTGCCTTTGGCCCTGG + Intergenic
1102029242 12:109730505-109730527 CCAGGTGCTGCCCTTGCCCTTGG + Intronic
1102754446 12:115326079-115326101 ACAGGGCCTGGCCTAGCGCCTGG + Intergenic
1102865506 12:116370949-116370971 ACTTGTCCTGCCCGTGCCCGAGG + Intergenic
1103686912 12:122739450-122739472 ACAGGTCTTGCCCTTTGCCCAGG + Intergenic
1104954253 12:132456799-132456821 ACAGCTCCTGCCCTCACCCCAGG + Intergenic
1104970393 12:132528239-132528261 ACAGGGCCAGCCCGTCCCCCTGG - Intronic
1105759761 13:23503217-23503239 CATGTTCCTGCCCTTGCCCCAGG + Intergenic
1106154234 13:27137717-27137739 ACAGGTCCTGCCCATATTCCAGG - Intronic
1106314263 13:28579351-28579373 ACAGATGCTGCCCTTTACCCAGG - Intergenic
1106637685 13:31546780-31546802 CCAGGTCTCTCCCTTGCCCCTGG - Intergenic
1106874956 13:34061463-34061485 AAAGGTGCTGCCCCTGCACCAGG + Intergenic
1109230195 13:59747580-59747602 TCAGGTCCTGCCTTGGCCACTGG + Intronic
1110558873 13:76888626-76888648 ACATCTCCTGCCCTGCCCCCAGG + Intergenic
1111269501 13:85863047-85863069 ACAGGTCCTGCCCTTTCTCTTGG - Intergenic
1111598942 13:90447137-90447159 CCATTTCTTGCCCTTGCCCCTGG + Intergenic
1113554383 13:111220068-111220090 ACCGGGCCTGCCCTAGCCCTAGG - Intronic
1114553939 14:23550953-23550975 ACCGGGCCTCCCCTTCCCCCCGG + Intronic
1114565538 14:23629997-23630019 ACAAGTCCTGCACTTCCCCTAGG + Intergenic
1114614822 14:24062756-24062778 ACAGATCCTGCCCTTGGCCTGGG - Exonic
1117997930 14:61495626-61495648 ACAGGTCCTGCCCTCGAGCTTGG + Intronic
1118678520 14:68214781-68214803 ACAGCTCGTGTCCTTCCCCCAGG + Intronic
1118729734 14:68658023-68658045 ACAGCTCCTTGCCTTGGCCCAGG + Intronic
1119231698 14:72985001-72985023 CCTGGCCCTGCCCTTGCCCTAGG + Intronic
1121307767 14:92917712-92917734 AGGGGTCCTGCCTGTGCCCCAGG - Intergenic
1121535180 14:94686215-94686237 CCAGGGCCTGGCCTTGTCCCAGG - Intergenic
1122203315 14:100135844-100135866 TGATGTCCTGCCCTGGCCCCAGG + Intronic
1122266343 14:100548683-100548705 ACAAACCCTGCCCCTGCCCCGGG + Intronic
1122976970 14:105174712-105174734 ACAGGCCCGGCCCTTGGCCCGGG + Intronic
1123744646 15:23310235-23310257 ACAGGACCAGCACTTGGCCCTGG + Intergenic
1125061930 15:35436034-35436056 ATAGCTGCTGCCCTGGCCCCAGG + Intronic
1125679960 15:41524311-41524333 ACAGGTCATGGCCCTGACCCAGG + Intronic
1127300428 15:57647724-57647746 ACACCTCCTGCACTTGGCCCTGG + Intronic
1127621332 15:60737449-60737471 CCAGGTACTGCCCATGCCGCTGG - Intronic
1128753372 15:70164627-70164649 ACAGCTTCTGCTCTTGCCCTTGG - Intergenic
1128995145 15:72289798-72289820 ACCGGTCCTGACCCTGGCCCCGG + Intronic
1129470263 15:75749927-75749949 GCAGGCCCTGCACCTGCCCCAGG + Intergenic
1129606993 15:77029849-77029871 AAAGGTCCAGTACTTGCCCCAGG + Intronic
1130046988 15:80453275-80453297 ACAGGTCCTGCCCTTGCCCCTGG - Intronic
1130917714 15:88318945-88318967 ACAGCCCCAGCACTTGCCCCCGG + Intergenic
1130927990 15:88399314-88399336 TCAGGTCCTCCCCTTCCCGCAGG - Intergenic
1132590285 16:723522-723544 ACCGGGCCAGCCCTTGCCTCTGG - Intronic
1132864248 16:2085781-2085803 CCAGGCCCTGCCCTTTCCCTTGG - Intronic
1133246360 16:4451375-4451397 CCAGCCCCTGCCCCTGCCCCTGG - Intronic
1133403944 16:5508494-5508516 ACAGGTCCTGCCCACTCCCGAGG + Intergenic
1135207960 16:20499068-20499090 ACAGGCCCTGAGCCTGCCCCTGG + Intergenic
1135210939 16:20524632-20524654 ACAGGCCCTGAGCCTGCCCCTGG - Intergenic
1136552524 16:30989291-30989313 ACAGGGCCTGACCTGGCCCAGGG + Exonic
1137272575 16:46912005-46912027 GCAGGACCTGGCCTTGCTCCCGG + Intronic
1137435796 16:48453454-48453476 GCAGGCCCTGCCCTTGCAGCTGG + Intergenic
1137699029 16:50482586-50482608 ACAGTGCCTGCCATTGCCACTGG - Intergenic
1138337482 16:56264466-56264488 ACAAGTCCTGGCCTTGCCCCTGG + Intronic
1138457794 16:57131373-57131395 ACATCTCCTGCCCTGGCCCTTGG - Intronic
1139375392 16:66493574-66493596 CCAGGCCCAGCCCTGGCCCCTGG + Intronic
1139471530 16:67180463-67180485 TCAGTCCCTGGCCTTGCCCCTGG - Exonic
1140701836 16:77588218-77588240 ACAAGTCCTGCCCTTTCACCAGG + Intergenic
1141330786 16:83108886-83108908 ACAGGTTCTGCCCTGCCTCCTGG + Intronic
1141832303 16:86516630-86516652 GCAGCTCCTGCCCCTGCTCCGGG - Intergenic
1142252960 16:89001182-89001204 ACTGGGCCTGCCCATCCCCCAGG + Intergenic
1142462733 17:105886-105908 AAAGTCCCTGCCCTAGCCCCTGG + Intergenic
1142805212 17:2367843-2367865 ACAGCTGCTGCCCCTGCCCCAGG - Intronic
1143792438 17:9308256-9308278 AGGGGTCCTGCCCTATCCCCGGG - Intronic
1143794752 17:9327602-9327624 AGAGGTCCTGCCCTGTACCCAGG - Intronic
1144285989 17:13775158-13775180 ACATGTCATGCCCTCTCCCCTGG + Intergenic
1145007873 17:19347744-19347766 ACAAGTCCTGCCCAGGGCCCAGG + Intronic
1146915652 17:36676740-36676762 AGAGGTCCAGTCCTTGCACCAGG + Intergenic
1147165545 17:38591303-38591325 AGAGGTCATGACCTTCCCCCAGG - Intronic
1147559228 17:41498843-41498865 ACAGGACATGCCCTTGCTCCCGG - Intergenic
1148075053 17:44930827-44930849 TCAGGTCCTGCCCAGGGCCCTGG - Intronic
1148130344 17:45258363-45258385 CCAGGTCCTGCTGTTCCCCCAGG + Intronic
1150847357 17:68673125-68673147 ACAGGCCCTGCCCTTGATCTGGG - Intergenic
1151373569 17:73666626-73666648 ACAGCCCCTGCCCCTGCCCTGGG - Intergenic
1151421403 17:74000472-74000494 AGAGGTCCTGCCCTATACCCTGG - Intergenic
1152240352 17:79157631-79157653 ACAGCTCCTCTCCTTGTCCCAGG + Intronic
1152344705 17:79743898-79743920 ACAGGTCCTGCCACTGGTCCTGG - Intergenic
1152615160 17:81334503-81334525 ACAGCTCCTCCCCTTCCCCTGGG - Intergenic
1152744757 17:82033571-82033593 ACAGGGCCTGGCCATGGCCCGGG + Exonic
1152867909 17:82735342-82735364 GCAGGTCCGGCCCTCGGCCCGGG - Intergenic
1153226103 18:2901247-2901269 ACAGGGCCAACCCTTTCCCCAGG + Intronic
1153980184 18:10302283-10302305 ACAGGTCCTGCTCTCTCCTCAGG + Intergenic
1154279913 18:12993377-12993399 CCAGGACCTGCCCTTGCCCCAGG + Intronic
1156055160 18:32993467-32993489 AGAGGTACTGCACTTGCCCAGGG - Intronic
1157581761 18:48777811-48777833 CCATGGCCTGCCCTTGACCCTGG - Intronic
1157607868 18:48937571-48937593 CCAGGTCATGCACTTCCCCCTGG - Intronic
1157674724 18:49560820-49560842 ACAGGTCCTGCCCCTGCCTGGGG - Intronic
1158285307 18:55874157-55874179 ACAGGTACTGTCCATGGCCCGGG + Intergenic
1158881105 18:61780466-61780488 AGAGGTCCTGCCCCATCCCCTGG + Intergenic
1159995757 18:74962442-74962464 CCAGATCCTGCTCTAGCCCCTGG - Intronic
1160015018 18:75133810-75133832 ACAGCCCCGGCCCTGGCCCCCGG - Intergenic
1160077815 18:75694510-75694532 ACAGGTCCTGCCTTTCCCTGTGG - Intergenic
1160507005 18:79432805-79432827 TGAGGTCCTGCCCGTGCCCTCGG - Intronic
1160652438 19:238262-238284 AAAGTCCCTGCCCTAGCCCCTGG + Intergenic
1160740327 19:682609-682631 ACAGGCCGTGCCCTTTCCCAGGG - Exonic
1160918332 19:1508160-1508182 CCAGGCACTGCCCTTTCCCCAGG - Intronic
1160936752 19:1599721-1599743 ACAGGCCCTGCCCATGCTGCCGG + Intronic
1161141130 19:2648635-2648657 GCAGGTGGTGCCCTTGCCACAGG + Intronic
1161236134 19:3199077-3199099 ACAGGCCCGGCTCTTGCCCCGGG + Intronic
1162135336 19:8551835-8551857 CCAGGTTCTGCCTTTGCTCCTGG + Exonic
1162384503 19:10353145-10353167 TCAGGTCCTGCCGCCGCCCCCGG - Intronic
1162386236 19:10362037-10362059 AGGGGCCCTGCCCTTGCCCCGGG + Intronic
1162566432 19:11447671-11447693 ACTGACCCTGCCCCTGCCCCAGG + Exonic
1162716587 19:12638269-12638291 GAAGATCCTGCCATTGCCCCTGG + Intronic
1162841662 19:13361167-13361189 ACAGTTCCTACCCTTGCCTAAGG + Intronic
1162913584 19:13862865-13862887 ATGGGGCCTGCCCTTGCCCAAGG - Intronic
1163195847 19:15719394-15719416 TCAGATCAAGCCCTTGCCCCTGG + Intergenic
1163484845 19:17579645-17579667 CTAAGTCCTGGCCTTGCCCCAGG - Intronic
1163485415 19:17582770-17582792 CCAGGACCTGTGCTTGCCCCTGG - Exonic
1163673722 19:18644833-18644855 ACAGGAACTGCCCCCGCCCCTGG - Intronic
1163821613 19:19499442-19499464 CCAGGCCCTGCCCCTGCCCTGGG - Intronic
1164580113 19:29429643-29429665 ACAGGCCCTGACCTTTCCCCGGG - Intergenic
1165073937 19:33270430-33270452 CCTGGTCCTGCCCCTGCCCCTGG - Intergenic
1165169617 19:33882532-33882554 CCTGGTCCTGGCCTTGCCCTGGG + Intergenic
1165722614 19:38090480-38090502 ACAGTGCCTGGCCCTGCCCCTGG - Intronic
1166689643 19:44814665-44814687 ATAGGTCCCGCTCTGGCCCCGGG - Exonic
1166836217 19:45669445-45669467 AGAGGTGCTGACCTTGCCCTGGG + Intronic
1166852242 19:45766491-45766513 ACAGGTGGTGACCCTGCCCCAGG - Exonic
1167362176 19:49036105-49036127 GCAGCACCTGCCCTGGCCCCGGG + Intronic
1167566792 19:50261805-50261827 ACAGGGCCTGCCCTGCCCACAGG - Intronic
925337558 2:3109111-3109133 CCAGGCCCTGCCCATGCTCCAGG + Intergenic
925516663 2:4690732-4690754 TCAGGTCCTGGGCTTGTCCCAGG + Intergenic
925825677 2:7846540-7846562 CCAAGTCCAGCCCGTGCCCCAGG - Intergenic
926735732 2:16071994-16072016 CCAGGCCCTGCCCTAGACCCCGG - Intergenic
926764553 2:16312878-16312900 TCAGCTCCTGCCCTTGCTCTAGG - Intergenic
926765850 2:16322230-16322252 ATAGGTCCTGCCCTTACTACTGG - Intergenic
927215105 2:20663982-20664004 GCAGGACCTGCCCATGACCCAGG - Intergenic
927428386 2:23006122-23006144 ACAGGTCCTGCCCACGCTCAAGG + Intergenic
927783134 2:25955065-25955087 ACATGTCTTTCCCTTGCCACGGG + Intronic
927871695 2:26628228-26628250 AGAGGCCCTGCCCTTCCCCCAGG - Intronic
932721729 2:74143596-74143618 CCAGGTCCTGAACTTGCCCCAGG - Intronic
935814570 2:106835215-106835237 ACAGGCACTGTCCTTGCTCCAGG - Intronic
935914876 2:107938369-107938391 AGAGGTCCTGCCCCATCCCCAGG - Intergenic
935951660 2:108335290-108335312 ACTAGTCCTGGCCTTGGCCCTGG + Intergenic
936008343 2:108909348-108909370 CCAGGTCCTGCCCTTGGTCCTGG + Intronic
937318929 2:120949124-120949146 ACAGGACCTGCCCTTGTCCAGGG + Intronic
937842077 2:126534241-126534263 AGAGGTCCTGCCCTACACCCAGG - Intergenic
937850013 2:126623585-126623607 GCAGGCGTTGCCCTTGCCCCAGG - Intergenic
938689816 2:133777203-133777225 ACAGCTCCAGCCCTTGAGCCTGG + Intergenic
942358686 2:175148492-175148514 ACAGACCCTTCCCTTGGCCCAGG + Intronic
944020102 2:195092463-195092485 ACAAGTCCTGCCCATGCTCCAGG - Intergenic
946774669 2:223125040-223125062 CAAGGTCCTGCCCTTGCCCCAGG - Intronic
946863559 2:224022810-224022832 CCTGGTCCTGCCCTTGGCACAGG - Intronic
947519082 2:230829916-230829938 ACATGTCCTGCCATTGCACTTGG - Intergenic
947722107 2:232376523-232376545 CCTGGGCCTCCCCTTGCCCCAGG - Intergenic
949058170 2:241940821-241940843 AGAGGTCCTGGCCTTGTCCCAGG - Intergenic
1168733033 20:103777-103799 ACAGATCATCCCCGTGCCCCAGG + Intergenic
1168770059 20:408831-408853 GCAGGACCTGGCCTTGCCCCTGG + Intronic
1168951835 20:1807675-1807697 ACAAGTCTTGCCCATGCTCCGGG - Intergenic
1168963003 20:1881590-1881612 ACAGGGACTGCCCTGGCTCCTGG + Intergenic
1169136295 20:3199875-3199897 CCAGGACCTGCCCTTGTGCCAGG + Intronic
1169203893 20:3729628-3729650 GCATGTCCCCCCCTTGCCCCCGG - Intergenic
1169800597 20:9508232-9508254 ACAGGTCCTGGGGTTGTCCCAGG + Intergenic
1171347750 20:24478742-24478764 ACTGGGCCTCCCCTTGCCCATGG - Intronic
1171376662 20:24698640-24698662 ACATTTCCTGCCTGTGCCCCAGG - Intergenic
1172518451 20:35552129-35552151 ACAGAGCCTGCCCTTCCTCCTGG - Intronic
1172593003 20:36130724-36130746 ACAGTTCCTGCCATTCACCCTGG - Intronic
1172887564 20:38241408-38241430 ATATGTCCTGCCCTTACCCTTGG + Exonic
1173516443 20:43667969-43667991 GCAGTTCCTGCCTTTGCCCCAGG - Intronic
1174170384 20:48614160-48614182 ACAGGCTCTGCCCCAGCCCCCGG + Intergenic
1175355116 20:58359278-58359300 ACATGTCCTGCTTCTGCCCCAGG - Intronic
1175415078 20:58795756-58795778 ACAGTCCCTTCCCTTGACCCTGG + Intergenic
1175980630 20:62736818-62736840 CCTGGTCCTGCCCTTGACACGGG - Intronic
1176148193 20:63574616-63574638 GCAGGACCTGCCCGTGGCCCTGG + Intergenic
1176866078 21:14055938-14055960 CCTGGTCCTGGCCCTGCCCCTGG - Intergenic
1179645156 21:42771143-42771165 ACAGTGCCTGGCCTGGCCCCAGG + Intronic
1179801607 21:43813822-43813844 CCAGGTCCTCACCCTGCCCCTGG + Intergenic
1181451354 22:23024162-23024184 ACAGGTCTTTCCCTTGATCCAGG + Intergenic
1181692250 22:24570156-24570178 AAAGGTCCTGCCCTATACCCTGG - Intronic
1182298820 22:29326918-29326940 ACAGCTCGAGCCCTTGACCCTGG + Intergenic
1182428536 22:30287269-30287291 ACAGGTCCTGCTCCCGCACCTGG + Exonic
1182909043 22:33965185-33965207 ACAGGTCCCACCCTTCCTCCAGG + Intergenic
1183104030 22:35603269-35603291 ACAGGCCCTGCCCCTGCCTCGGG - Intergenic
1183414737 22:37675739-37675761 TCAGTTCCTGCCCTATCCCCTGG - Intronic
1183418675 22:37697508-37697530 ACTGGTCCTTCCGTGGCCCCAGG - Intronic
1183736802 22:39648952-39648974 TGAGGGTCTGCCCTTGCCCCAGG + Intronic
1183832442 22:40425502-40425524 TCAGGTCCTGGCCCTGGCCCTGG - Intronic
1184580328 22:45412956-45412978 ACTGCTCTTGCCCTTGGCCCTGG - Intronic
1185340596 22:50289221-50289243 ACAGGCCCTTCCCTTCCCTCCGG + Intronic
950455504 3:13090590-13090612 CCAGGACCTGCCCCTGCACCAGG - Intergenic
950455997 3:13093117-13093139 ACAGGTCCTGCCCCTGCCCAGGG + Intergenic
950705093 3:14774620-14774642 GCAGGTCCTGGCCCTGCCCACGG + Intergenic
954214607 3:49117295-49117317 ACAGTTCCTGCCCATTCTCCTGG + Exonic
954678979 3:52331313-52331335 TGAGGTCCTGCCGCTGCCCCAGG + Intronic
955060251 3:55487231-55487253 CCAGGCCCTGCCCTTGCTGCCGG - Exonic
955086865 3:55710963-55710985 CCTGGCCCTGTCCTTGCCCCTGG + Intronic
955687926 3:61563510-61563532 CCAAGTCCTGCCCTAGCCCGGGG + Intronic
956384686 3:68704062-68704084 ACAGGTCCTGCTCCTGTCCAAGG + Intergenic
958889747 3:99770184-99770206 ACATGTCCTGCCCTATACCCAGG - Intronic
959810869 3:110617690-110617712 ACAGGTGCTGCCACTGCACCTGG - Intergenic
960991603 3:123315086-123315108 CCTGGGCCAGCCCTTGCCCCAGG - Intronic
961031064 3:123604386-123604408 ACAGTTCCTCCCCTCGACCCTGG - Intergenic
961353271 3:126317139-126317161 ACAGGGCCTGCCTGTGCCCTGGG + Intergenic
961499665 3:127323378-127323400 ACAGGTCCTGCTCCAGGCCCGGG + Intergenic
961573467 3:127816794-127816816 GCAGTTCCTTCCCTTGCTCCCGG - Intronic
961653885 3:128430931-128430953 ACTGCTCCTGCCCCTGCCCCAGG - Intergenic
963694419 3:148547166-148547188 ACAGTCCCAGACCTTGCCCCAGG - Intergenic
963932737 3:151020993-151021015 CCAGGTGCTGTCCTTGCTCCTGG - Intergenic
967812330 3:193771332-193771354 ACAGGTCCTGCACCTGCCGCTGG + Intergenic
967819869 3:193830790-193830812 CCAGGGCCTGCCCATGGCCCTGG + Intergenic
967907986 3:194517475-194517497 ACAGGGCAGGCCCTTGCTCCAGG + Intergenic
968079313 3:195835480-195835502 ACACGTCCTGGCCCTGTCCCTGG - Intergenic
968365396 3:198181710-198181732 AAAGTCCCTGCCCTAGCCCCTGG - Intergenic
968392579 4:205369-205391 CCAGGTCCTGCCAATACCCCTGG + Intergenic
969183065 4:5456608-5456630 CCAGGTCCTGCACTGCCCCCTGG + Intronic
969484731 4:7465955-7465977 CCTGGCCCTGCCCCTGCCCCAGG - Intronic
973713156 4:53649548-53649570 ACAGCTCCTCCTCTTGCCTCTGG + Intronic
976962301 4:90992921-90992943 ACAGATCCTTCCCATGCCCAAGG + Intronic
979254431 4:118596877-118596899 AAAGTCCCTGCCCTAGCCCCTGG - Intergenic
979334533 4:119449154-119449176 AAAGTCCCTGCCCTAGCCCCTGG + Intergenic
984314211 4:178105392-178105414 CCTGGTACTGCCCTTGACCCAGG + Intergenic
984651491 4:182275280-182275302 ACAGGTGCAGGACTTGCCCCTGG + Intronic
984835339 4:184014452-184014474 ACATGTCTTCCCCTGGCCCCAGG - Intronic
984961027 4:185099153-185099175 ACAGACCCTGCTCTTTCCCCTGG - Intergenic
986707476 5:10463717-10463739 ACAGGTCACGCCCTGACCCCTGG + Intronic
986984153 5:13481057-13481079 CCAGGTGATGCCCTTGCTCCTGG + Intergenic
987743955 5:21946908-21946930 CCAGGTCTTGCCCTTGACACGGG - Intronic
989480449 5:41925145-41925167 CCAGTACCCGCCCTTGCCCCTGG + Intergenic
989501262 5:42170819-42170841 AAAAGTCCTGCCCTTTCCCCTGG - Intergenic
992227880 5:74636303-74636325 ATAGGACCTTCCCTTGCCACCGG - Exonic
992739797 5:79762240-79762262 TCCGATCCTGCCCCTGCCCCAGG - Intronic
992833350 5:80616830-80616852 AAAGGTCCTGCCCTGTACCCTGG - Intergenic
995308953 5:110689208-110689230 ATTAGCCCTGCCCTTGCCCCAGG - Intronic
997405599 5:133644334-133644356 TCAGTTCCTGCCCCTGCCGCAGG - Intergenic
997743173 5:136275679-136275701 CCATGTCCTGCCCTCACCCCTGG + Intronic
998043474 5:138968257-138968279 ACAGGTCCTCCCCTGGCCCCTGG + Intronic
1002295915 5:178231456-178231478 ACATGTACTGCCCTTGGGCCCGG + Exonic
1002860500 6:1075481-1075503 CCAGCTCCTGCACCTGCCCCTGG + Intergenic
1006365197 6:33611123-33611145 ACAGGACCTGCTCCTGCGCCGGG - Intergenic
1006450266 6:34101938-34101960 ACACGTCCTGGCCATACCCCTGG - Intronic
1006501025 6:34458833-34458855 AAAGGTCCTGCCCCAGACCCTGG - Intergenic
1006794489 6:36722833-36722855 GCAGGTTCTGCCCTGGCCACGGG + Intronic
1009946415 6:70346853-70346875 CCAGGGCCTCCCCTTGCCCTTGG - Intergenic
1010076727 6:71806884-71806906 CCAGTTCCTCCCTTTGCCCCAGG + Intergenic
1010991491 6:82484958-82484980 ACAGCTGCTGCCCAGGCCCCAGG + Intergenic
1011508016 6:88068665-88068687 ATATGGCCTGCCCTTCCCCCTGG + Intergenic
1012916744 6:105179462-105179484 GCAGGTCCTACTCTGGCCCCAGG - Intronic
1012958765 6:105599648-105599670 ACAGTTGCTCCCCTTGCCCGAGG - Intergenic
1013506494 6:110805555-110805577 TCAGGTCCTGCAGTTGGCCCTGG + Intronic
1015813690 6:137186209-137186231 ACAGCTGCTGCCCCAGCCCCAGG - Intergenic
1017011341 6:150065777-150065799 CCAAGTCCTGCCCTTGCTGCTGG + Intronic
1018034118 6:159866996-159867018 ACGCTTCCTGCCCCTGCCCCTGG + Intergenic
1019129249 6:169861572-169861594 ACAGATCCTGCTATTCCCCCAGG - Intergenic
1019134454 6:169899491-169899513 TCAGGTCCGGCCTCTGCCCCAGG + Intergenic
1019662028 7:2229920-2229942 AGAGGTCCTGCCCGGGCCCAGGG + Intronic
1020118970 7:5492159-5492181 CCAAGTCCTCCCCTTTCCCCTGG - Intronic
1020130832 7:5557812-5557834 GCAAGTCCTCCCCTTCCCCCGGG - Intronic
1020242449 7:6406307-6406329 ACAGGCCCTACCTTTGACCCAGG + Intergenic
1022111600 7:27235670-27235692 TCAGTCCCTCCCCTTGCCCCAGG - Intergenic
1022518767 7:30992429-30992451 ACACGTACTGCCTGTGCCCCTGG - Intronic
1023306624 7:38837115-38837137 AGAAGTCCAGCCCTTGCCCTTGG + Intronic
1023862204 7:44223536-44223558 GCTGTTCCTGTCCTTGCCCCTGG + Intronic
1023980791 7:45068825-45068847 CCAGGTCCTGCCCCAGGCCCAGG + Intronic
1023986682 7:45101140-45101162 ACATGCCCTGCCCGTGGCCCCGG - Intronic
1023987188 7:45103539-45103561 GAGGGTCCTGCCATTGCCCCTGG - Intronic
1024069525 7:45774543-45774565 AAAGTCCCTGCCCTAGCCCCTGG - Intergenic
1025099881 7:56125346-56125368 AAAGTTCCTGCCCTAGCTCCTGG + Intergenic
1025904635 7:65774593-65774615 AAAGTCCCTGCCCTAGCCCCTGG - Intergenic
1026050129 7:66939614-66939636 ACAGCTACAGCCCTGGCCCCTGG - Intronic
1026774665 7:73223887-73223909 ACAGGTCCTGCCATTTCACCAGG - Intergenic
1026986615 7:74559125-74559147 CTAGGTCCTGCCCTCCCCCCTGG + Intronic
1027015524 7:74777278-74777300 ACAGGTCCTGCCATTTCACCAGG - Exonic
1027072508 7:75168679-75168701 ACAGGTCCTGCCATTTCACCAGG + Intergenic
1029119413 7:98256902-98256924 ACAGGTCCTGCCTTTGGCGATGG - Intronic
1030215358 7:107039572-107039594 ACAGGGCCTGTTCTTGCCCAAGG - Intergenic
1030330483 7:108265019-108265041 ACAGGTGCCACCATTGCCCCTGG - Intronic
1032189483 7:129755887-129755909 CCAGGTGCTGACCTTGCCACAGG + Exonic
1032493657 7:132344404-132344426 ACTGGTCCCTCCCTTGCCTCTGG - Intronic
1032642034 7:133780716-133780738 GGAGTTCCTGCCCTTCCCCCAGG - Intronic
1034565788 7:151914550-151914572 ATAGGTCCTGCCCATGCTCAAGG - Intergenic
1034778991 7:153859928-153859950 CCTGGTCCTGCCCTTGACACAGG + Intergenic
1035727791 8:1835284-1835306 ACAGAGCCTGTCCCTGCCCCAGG + Intronic
1036657848 8:10689221-10689243 TCAGGTCCTGACTTTGCCACAGG + Intronic
1036679287 8:10859179-10859201 AAAGGTCCTGCCTGGGCCCCTGG + Intergenic
1037145161 8:15562978-15563000 ACAGGTCTTGTCCATGCCCAGGG + Intronic
1037563361 8:20095044-20095066 AGAAGTCATGCCCTTGTCCCTGG + Intergenic
1038446488 8:27608021-27608043 ACAAGTCATGCCCCTTCCCCAGG + Intronic
1038807095 8:30804329-30804351 AGAGGTCTGGCCTTTGCCCCTGG + Intronic
1039179849 8:34854365-34854387 AGAGGTCCTGCCCTCTACCCAGG - Intergenic
1039412341 8:37365512-37365534 ACAGCTCCTGCTCTAGGCCCTGG - Intergenic
1040110390 8:43564606-43564628 ACAGGTCCTGCCCCAGACCCGGG - Intergenic
1040483623 8:47850076-47850098 ACAGGTCATGTCCCTGCCCTTGG - Intronic
1040546585 8:48402657-48402679 AAAGGTTCTGCCACTGCCCCAGG - Intergenic
1043053453 8:75408376-75408398 ATTTGTCCTGGCCTTGCCCCAGG - Intronic
1045312749 8:101017374-101017396 GCAGGTGTTGCCCTGGCCCCAGG + Intergenic
1047305516 8:123649886-123649908 ACAGGTGCAGCCCATGGCCCTGG - Intronic
1048473520 8:134723486-134723508 ACAGGCCCTGTCCTGGCCCTGGG - Intergenic
1048610682 8:136019568-136019590 ACATGTCCAGTCCCTGCCCCAGG + Intergenic
1049433283 8:142575058-142575080 ATGGGGCCTGCCCTGGCCCCAGG - Intergenic
1049434587 8:142580489-142580511 ACGTGTCCTGCGCTTGCGCCTGG - Intergenic
1049541387 8:143210740-143210762 AGAGGTCATGACCTTGCCCTGGG + Intergenic
1049790179 8:144468824-144468846 AGGGGTCCTGACCTGGCCCCGGG - Exonic
1051353852 9:16223342-16223364 ACAGATACTGCGCTTGTCCCAGG + Intronic
1052413219 9:28148026-28148048 ACAGGTCCTGGCCATGCCATTGG + Intronic
1052745370 9:32435017-32435039 TCAGGTTCTGCCTCTGCCCCAGG - Intronic
1056949370 9:91029732-91029754 GAAAGTCCTGCCCTTGCCCCAGG - Intergenic
1060811374 9:126613072-126613094 ACTGCTCCTGCCCCTGCCCGGGG + Intergenic
1061161255 9:128895661-128895683 CCTGGTCCTGCCCTGCCCCCAGG - Intronic
1061186660 9:129059053-129059075 AGAGCTCCTCCCCTTTCCCCAGG + Intronic
1061382516 9:130266691-130266713 AGAGGCGCTGCCCTTTCCCCAGG - Intergenic
1062161761 9:135084170-135084192 CCAGGTCCTTTCCTTGCTCCTGG + Intronic
1062419685 9:136474167-136474189 CCAGTGCCTGCACTTGCCCCCGG - Exonic
1062444375 9:136587545-136587567 CGAGGGCCTGCCCTTGCTCCTGG + Intergenic
1062503636 9:136861862-136861884 AAAGTTCCTGCCCTTGGCGCTGG - Intronic
1062590652 9:137273029-137273051 ACAGGCCCAGCCATAGCCCCGGG - Exonic
1062749763 9:138244577-138244599 AAAGTCCCTGCCCTAGCCCCTGG - Intergenic
1185524579 X:767189-767211 AAAGGCCCTGTCCTTTCCCCGGG + Intergenic
1186795542 X:13044088-13044110 ACAGAGCCTGGCCCTGCCCCTGG + Intronic
1186902151 X:14068228-14068250 ACAGGACCGGTCCTTGCCCTTGG + Intergenic
1187372664 X:18723567-18723589 ACATTTCCAGGCCTTGCCCCAGG + Intronic
1192201229 X:69067986-69068008 GCAGGTACTGCCCCAGCCCCTGG + Intergenic
1192560935 X:72127497-72127519 ACAGGTCCTGCCTGTTCCCATGG - Intronic
1196320501 X:114334666-114334688 ATAGGTGCTGCCCTGGACCCTGG + Intergenic
1196774773 X:119328191-119328213 ACAGGGCTTGGTCTTGCCCCAGG - Intergenic
1199711574 X:150473372-150473394 ACAGGTGCTTCCCTTGGGCCAGG - Intronic
1199762588 X:150916470-150916492 AGAGGTCCTGCCCTGGCATCAGG - Intergenic
1200608499 Y:5296458-5296480 ACAGTTCTGGCCCTTGCCCATGG + Intronic