ID: 1130051236

View in Genome Browser
Species Human (GRCh38)
Location 15:80485704-80485726
Sequence CAGTGGCCTGCAATTGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130051236_1130051240 -3 Left 1130051236 15:80485704-80485726 CCAAGACCAATTGCAGGCCACTG 0: 1
1: 0
2: 0
3: 12
4: 140
Right 1130051240 15:80485724-80485746 CTGAGGATTTTAACCAGTAGAGG 0: 1
1: 0
2: 0
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130051236 Original CRISPR CAGTGGCCTGCAATTGGTCT TGG (reversed) Intronic
902748933 1:18493078-18493100 CATTGGCCTTCACTTGGGCTAGG - Intergenic
902776007 1:18675498-18675520 CACCGGCATGCAATTGGGCTGGG - Intronic
904326855 1:29732110-29732132 CAGAGGCCTGGAATAGTTCTAGG - Intergenic
905260593 1:36715525-36715547 CAGTGGGCTGCAATGAGACTGGG - Intergenic
905959611 1:42032756-42032778 CAGTGGCATGAAATGGGTCCAGG - Intronic
907956755 1:59235859-59235881 CAGAGGCCTGAAATGTGTCTGGG - Intergenic
908402811 1:63787036-63787058 CAGTGGCCTGCCCTTGGTTTAGG + Intronic
909741665 1:79037102-79037124 CAGTGGCCTGCGATGTATCTGGG - Intergenic
912638996 1:111325961-111325983 CAATGGCTTGTAATTTGTCTAGG - Intergenic
915648518 1:157290888-157290910 CAGTGGCCTCCAAAATGTCTAGG + Intergenic
917638309 1:176958304-176958326 CTGAGGCCTGCAATTGGCTTGGG - Intronic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
918787693 1:188784941-188784963 CAGTGACCTGAAACTTGTCTGGG - Intergenic
919666537 1:200298083-200298105 CAGTGGCTTCCAATTGCTCTTGG + Intergenic
920291105 1:204923697-204923719 CAGGGGCCTGAAATCGGTTTGGG - Intronic
922496042 1:226058705-226058727 CAGTGGCCTCCCACTGCTCTTGG - Intergenic
924838736 1:247684542-247684564 AAGTGCCATGAAATTGGTCTTGG - Intergenic
1066125078 10:32333579-32333601 CAGTGCCCTGGATTTGATCTTGG - Intronic
1067792034 10:49295585-49295607 CTGTGTCCTGCACTTGGGCTGGG + Intergenic
1069557220 10:69406369-69406391 GAGGGGCCTGCACTTGCTCTGGG - Intronic
1070129938 10:73648812-73648834 AATTGTCCTGCATTTGGTCTTGG + Exonic
1071455882 10:85851222-85851244 CATTGGCCTGACATTTGTCTTGG - Intronic
1073317807 10:102595109-102595131 CAATGACCTGCATTTGGTCAGGG - Intronic
1073718936 10:106142820-106142842 CAGTGGCCTGCATTTTGCCTTGG - Intergenic
1075791729 10:125089501-125089523 CAGTGGCCAGAAACTGTTCTTGG - Intronic
1077482998 11:2825292-2825314 CCTTGGCCTCCCATTGGTCTGGG - Intronic
1079290584 11:19184639-19184661 CAGTGCCCTGCCTCTGGTCTTGG - Intronic
1084396175 11:68911937-68911959 CAGGGGCCTGGAGTTGGCCTGGG + Intronic
1086075511 11:82846938-82846960 CAGTGGGCTGGATTTGGCCTGGG - Intronic
1088030186 11:105239417-105239439 CAGTGCCCTGCTACTGCTCTTGG + Intergenic
1089001233 11:115054054-115054076 CAGTGGCCTGCCCTGGTTCTCGG - Intergenic
1091980260 12:4858796-4858818 CAGTGGCCTTCTAATGGTTTCGG + Intergenic
1092962295 12:13608028-13608050 CAGAGGCCTGCAATTAGTAAGGG + Intronic
1093635319 12:21459579-21459601 CCGGGGCATGCAATTGGTATTGG + Intronic
1096522207 12:52190892-52190914 CCATGGCCTGCAACAGGTCTGGG - Intronic
1097018351 12:56002974-56002996 CAGTGGCCTGATCTTGATCTTGG - Intronic
1101367047 12:104082772-104082794 CAGTGGCCAGCTCTTGGTCTTGG - Exonic
1101416186 12:104510112-104510134 CACTGGCCAGAACTTGGTCTTGG + Intronic
1101958199 12:109228908-109228930 TAGTGGCATGCCATTGGCCTGGG + Intronic
1102761779 12:115393338-115393360 CAGTGTCTTGATATTGGTCTTGG + Intergenic
1106243658 13:27928813-27928835 CAGTGGCCTTCAAAAGGTCTGGG + Intergenic
1107375830 13:39803296-39803318 CAGTCTCCTGCCATTGGTTTAGG - Intergenic
1108741133 13:53339454-53339476 CAGTGGCTTGCAATGGTTCCAGG + Intergenic
1109886948 13:68555729-68555751 CAATGGCCTGCTTTAGGTCTGGG - Intergenic
1113709106 13:112452488-112452510 CAGTGGCCAGCATGGGGTCTGGG - Intergenic
1113890641 13:113733385-113733407 CACTGGCCTCCATTTGATCTTGG - Intronic
1119074501 14:71622472-71622494 CAATGGCTTGAATTTGGTCTTGG + Intronic
1119316155 14:73696769-73696791 CAATGGCCAGCATTTAGTCTAGG - Exonic
1120319356 14:82939851-82939873 CACTGGCCTGCCTTTGCTCTGGG + Intergenic
1120923823 14:89778802-89778824 CAGTGGTCTTCCATTGCTCTCGG + Intergenic
1122543031 14:102508404-102508426 CAGGGGCCTCCAAGTGGTCTGGG - Intronic
1122739382 14:103862611-103862633 CAGTGGCCCACAATTGGTTGCGG + Intergenic
1123856404 15:24416326-24416348 CAGTGGCCTGATATGTGTCTGGG + Intergenic
1126580655 15:50239566-50239588 CACAAGCCTGCAATTGCTCTTGG + Intergenic
1126744297 15:51810474-51810496 CAGTGGCTTGAAATTGGCCATGG + Exonic
1130051236 15:80485704-80485726 CAGTGGCCTGCAATTGGTCTTGG - Intronic
1130820456 15:87489822-87489844 CAGTGACTTCCAATTGTTCTTGG - Intergenic
1132666394 16:1083079-1083101 CGGTGGCCTGCAAGGGGTCTCGG - Intergenic
1132998415 16:2836430-2836452 CAGTGGCCTGCAGGAGGCCTTGG - Intronic
1137704611 16:50526052-50526074 GAGTGGCCTACCATTGTTCTAGG - Intergenic
1141397011 16:83714035-83714057 CAGTGGCCAGCGATGGGTATAGG - Intronic
1142832334 17:2558484-2558506 CAGTGGCCTCCCATTACTCTTGG - Intergenic
1143492983 17:7294626-7294648 CAGCGGGCTGCCATTGGCCTCGG - Intergenic
1144129407 17:12231534-12231556 CCTTGGCTAGCAATTGGTCTGGG + Intergenic
1146724831 17:35148416-35148438 CTGTGGCCTGAAAACGGTCTGGG + Exonic
1149924926 17:60693463-60693485 CAGTGGCCTGAACTTGAACTTGG + Intronic
1153830932 18:8921934-8921956 AATTGGCCTACAATTGGCCTGGG + Intergenic
1155537661 18:26833560-26833582 CAGAGGCCTGCACTTGGGCGCGG + Intergenic
1157901979 18:51526716-51526738 CAGGGGCCTGCAGGTGGTCCTGG - Intergenic
1159018428 18:63122241-63122263 TAGTGGCTTGTAATTGGCCTTGG - Intergenic
1159071121 18:63624971-63624993 CAGTGGCCTGCGATGTATCTGGG + Intergenic
1160437887 18:78865867-78865889 CAGTGGCCTTCTACTGGTCTTGG - Intergenic
1161728590 19:5945185-5945207 CCGTGGCCTGCAAGGGGCCTGGG - Intronic
1167457223 19:49602959-49602981 CAGTGGGCTGGATTTGGCCTAGG - Intronic
1167765830 19:51481657-51481679 CTGTGGCCTGTGAGTGGTCTGGG + Exonic
925502698 2:4523332-4523354 CACTGGCCTGAACTTAGTCTGGG - Intergenic
928438029 2:31268532-31268554 CAGTGGGCTGGAGTTTGTCTAGG + Exonic
929847642 2:45547013-45547035 CACTGCCCTGCATTTGGTATAGG + Intronic
930559180 2:52938795-52938817 CTGGGGCTTGCAATTGGTATCGG + Intergenic
932896635 2:75646832-75646854 CACTGGGCTGCAATGGGCCTAGG + Exonic
933100391 2:78248251-78248273 CAGTGGCCTGACAATGGTCATGG + Intergenic
933741356 2:85536986-85537008 CAGTGGCTTTCAATTGCTGTCGG - Intergenic
944397877 2:199289990-199290012 CAGTGGCCTTCAGGTGGTCTAGG + Intronic
948388614 2:237596993-237597015 CTGTGGCCTGGAGTGGGTCTGGG - Intronic
948852435 2:240715018-240715040 CTGTGGCCTCCAAAGGGTCTGGG - Exonic
949032121 2:241802220-241802242 CAGTCGCCTGCCGTTGCTCTTGG + Intronic
1171420947 20:25017339-25017361 CAGCTGCCTGGAATGGGTCTGGG + Intronic
1172464986 20:35149442-35149464 CAGTGGCCTGATCTTGATCTTGG - Intergenic
1178408521 21:32345697-32345719 CGGTGGCCTGAAATTGGTCACGG + Intronic
1179967374 21:44815332-44815354 GAGTGGCCTGCAAGGGGCCTTGG + Intronic
1180017177 21:45095084-45095106 CAGTGGCCTGTATTTCGTCCTGG + Intronic
1181992688 22:26849520-26849542 CAGTGGCTCCCAATTGCTCTTGG + Intergenic
1182325855 22:29512119-29512141 CAGCGGCCTGCAGTTTGGCTGGG + Exonic
1183377006 22:37471266-37471288 TAGTGACATGCAATGGGTCTGGG - Intronic
1183467197 22:37985679-37985701 GAGTGGGCTGCAAAGGGTCTGGG + Intronic
949742479 3:7252382-7252404 GAGTGGTCTGCACATGGTCTGGG + Intronic
950774690 3:15339288-15339310 CTGTGGCCTGTAATTCATCTGGG - Intronic
951779506 3:26346903-26346925 CAATGGCCTGCAGCTGCTCTAGG - Intergenic
951870438 3:27355759-27355781 CTGTGGCCTTCTATTGGACTTGG + Intronic
954240879 3:49292523-49292545 CAGGGGCCTGCAATGGCTCCAGG - Exonic
959303491 3:104631345-104631367 CAGTGGCCTGAGATGTGTCTGGG + Intergenic
973004264 4:44989516-44989538 CAGCCGCCTGCAATTGGTTCAGG + Intergenic
975185800 4:71400923-71400945 CAGTGTCCTGGAAGTGATCTTGG + Intronic
975206852 4:71654093-71654115 CTCTTGCCTGCAATTGATCTGGG + Intergenic
981905166 4:149914401-149914423 GAGCAGCCTGCAATTGCTCTGGG - Intergenic
982309985 4:153974691-153974713 CAGTGGCCTGAAATGTATCTGGG - Intergenic
987381722 5:17291789-17291811 CAGTGGGCTAGATTTGGTCTTGG + Intergenic
988720107 5:33869226-33869248 CAGTGGCCTGACATATGTCTGGG - Intronic
990396389 5:55384629-55384651 CAGTGGCCTGCAAGAGGTGGAGG - Intronic
992180902 5:74197478-74197500 CAGTGGCCTGCAGTGGAGCTCGG + Intergenic
993442933 5:87978647-87978669 CAGTGGCCTGAAATGTATCTGGG - Intergenic
993616268 5:90116443-90116465 CAATTGCCTGCAATTGCTCAAGG + Intergenic
994513932 5:100745689-100745711 CAGTGGATTGCAAGTGGTATGGG - Intergenic
994715790 5:103320310-103320332 CAGTGGGCTGCAGCTTGTCTAGG + Intergenic
996157082 5:120115309-120115331 CAGTGGCCTGAGATTTATCTGGG - Intergenic
1001415030 5:171539713-171539735 CAGTGGGATTCAATTGGTCTGGG - Intergenic
1003274277 6:4636009-4636031 CAGTGGCTTCCAATTGGTCATGG - Intergenic
1005973295 6:30778322-30778344 CAGAGGCCAGCACTAGGTCTTGG - Intergenic
1009866881 6:69408951-69408973 CAGTTGCCTGCAAATAGACTTGG + Intergenic
1010174201 6:73007634-73007656 CAGCTGCCTGCAATGGGCCTGGG - Intronic
1011209169 6:84936330-84936352 CAGTGGTCTGCAATGGACCTGGG + Intergenic
1017183210 6:151573991-151574013 CATTGGCCTCCAAATGGACTGGG - Intronic
1019730063 7:2624611-2624633 CTGTGGGCTGCAATTGGCATTGG - Intergenic
1019988891 7:4678852-4678874 CAGTGGCTTCCCATTGCTCTAGG + Intergenic
1020125729 7:5531581-5531603 CAGCGGCCTCCAGATGGTCTGGG - Intronic
1021553747 7:21899180-21899202 CAGTGCCCTGCAAATTGTCAGGG + Intronic
1030315755 7:108112721-108112743 CAGTGGCCTGCAGTTATTCCTGG + Intronic
1036786264 8:11689724-11689746 CAGTGCCCTGCAAGGGGTGTGGG + Intronic
1039396893 8:37234142-37234164 CAGTCCTCTGCAATTGGCCTGGG + Intergenic
1039427082 8:37495016-37495038 AGGTGGCCTGTAATTGGACTTGG - Intergenic
1039612948 8:38933420-38933442 CAGTGCCCTGCAAGTGGCATGGG - Intronic
1040596838 8:48846818-48846840 CAGCTGCCTGCACTTGGTCGGGG + Intergenic
1040871959 8:52109021-52109043 CACTGGCCTGAAAATGATCTCGG + Intergenic
1043329299 8:79094123-79094145 CAGTCGGCTGAATTTGGTCTGGG - Intergenic
1043883594 8:85573166-85573188 CATTAGGCTGCATTTGGTCTTGG + Intergenic
1044600242 8:93996555-93996577 CAGTGGCTTTCCATTGCTCTTGG - Intergenic
1044926103 8:97210071-97210093 AAGTGGCCTGCTATAGTTCTGGG + Intergenic
1049244739 8:141556274-141556296 CAGTGTCCTGCAGTTAGTGTTGG + Intergenic
1050412108 9:5377069-5377091 CACTGCCCTGCAATTGGACAGGG - Intronic
1053556744 9:39145537-39145559 CAGGGGCCTGTATTTGGCCTCGG + Intronic
1053820854 9:41965815-41965837 CAGGGGCCTGTATTTGGCCTCGG + Intronic
1054089724 9:60833954-60833976 CAGGGGCCTGTATTTGGCCTCGG + Intergenic
1054111135 9:61109512-61109534 CAGGGGCCTGTATTTGGCCTCGG + Intergenic
1054609722 9:67221613-67221635 CAGGGGCCTGTATTTGGCCTCGG - Intergenic
1056816428 9:89804759-89804781 CAGTGGTTTGCAACTGTTCTCGG + Intergenic
1059685103 9:116627453-116627475 AAGTTGCCTGCATTTGGTCCTGG + Intronic
1061101309 9:128494596-128494618 CATAGCCCTGCAGTTGGTCTTGG - Exonic
1061191146 9:129083462-129083484 GACTGGCCTGGAGTTGGTCTGGG - Intronic
1187792948 X:22970600-22970622 CTGTGGCCTGCCACTGTTCTAGG + Intergenic
1190748553 X:53341459-53341481 CAATGGCCTGACATTGGGCTGGG + Intergenic
1191740498 X:64432417-64432439 CAGTGGATTGCACTTGGACTTGG - Intergenic
1193534069 X:82691238-82691260 CATTGGCCTGAAATTGGGGTGGG + Intergenic
1195995332 X:110725878-110725900 CAATAGCCTGCAAATGTTCTAGG - Intronic