ID: 1130053601

View in Genome Browser
Species Human (GRCh38)
Location 15:80504101-80504123
Sequence CATTTGGAGCAGTGGGACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 161}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130053589_1130053601 20 Left 1130053589 15:80504058-80504080 CCATCCTCTCTTGCATGTATTTT 0: 1
1: 1
2: 5
3: 62
4: 652
Right 1130053601 15:80504101-80504123 CATTTGGAGCAGTGGGACGCAGG 0: 1
1: 0
2: 0
3: 11
4: 161
1130053590_1130053601 16 Left 1130053590 15:80504062-80504084 CCTCTCTTGCATGTATTTTCACT 0: 1
1: 0
2: 1
3: 24
4: 269
Right 1130053601 15:80504101-80504123 CATTTGGAGCAGTGGGACGCAGG 0: 1
1: 0
2: 0
3: 11
4: 161
1130053594_1130053601 -9 Left 1130053594 15:80504087-80504109 CCCACACCTTCCTCCATTTGGAG 0: 1
1: 0
2: 3
3: 20
4: 222
Right 1130053601 15:80504101-80504123 CATTTGGAGCAGTGGGACGCAGG 0: 1
1: 0
2: 0
3: 11
4: 161
1130053593_1130053601 -8 Left 1130053593 15:80504086-80504108 CCCCACACCTTCCTCCATTTGGA 0: 1
1: 0
2: 2
3: 42
4: 307
Right 1130053601 15:80504101-80504123 CATTTGGAGCAGTGGGACGCAGG 0: 1
1: 0
2: 0
3: 11
4: 161
1130053595_1130053601 -10 Left 1130053595 15:80504088-80504110 CCACACCTTCCTCCATTTGGAGC 0: 1
1: 0
2: 0
3: 21
4: 253
Right 1130053601 15:80504101-80504123 CATTTGGAGCAGTGGGACGCAGG 0: 1
1: 0
2: 0
3: 11
4: 161
1130053591_1130053601 -7 Left 1130053591 15:80504085-80504107 CCCCCACACCTTCCTCCATTTGG 0: 1
1: 0
2: 2
3: 40
4: 461
Right 1130053601 15:80504101-80504123 CATTTGGAGCAGTGGGACGCAGG 0: 1
1: 0
2: 0
3: 11
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130053601 Original CRISPR CATTTGGAGCAGTGGGACGC AGG Intronic
901614966 1:10531534-10531556 CACGTGGAGCAGTGCGGCGCTGG + Intronic
902552192 1:17225770-17225792 CCTTGGGATCAGTGGGACCCAGG - Intronic
903300512 1:22375482-22375504 CATGTGGAGCCGTGGGACTTGGG - Intergenic
905399149 1:37689447-37689469 CATCTGGGGCAGTGGGACCTCGG - Intronic
905952733 1:41965333-41965355 CATTTGGAGAAGAGGCACTCTGG - Intronic
906984879 1:50672387-50672409 CATTTGGAGCAGCTGGAGGTGGG + Intronic
909276202 1:73690106-73690128 CATTTGGAGAAGAGGCACTCTGG + Intergenic
909697652 1:78484937-78484959 CATTTGGAGAAGAGGCACTCTGG - Intronic
911508660 1:98784819-98784841 CATTTGGAGAAGGGGCACTCTGG - Intergenic
914218368 1:145655362-145655384 CATTTGGAGAAGAGGCACTCTGG + Intronic
914470929 1:147978053-147978075 CATTTGGAGAAGAGGCACTCTGG + Intronic
916848903 1:168683307-168683329 CATTTGGAGAAGATGGACTCTGG + Intergenic
917062660 1:171057046-171057068 CATTTGGAGAAGAGGCACTCTGG - Intronic
922909715 1:229205291-229205313 AATATGGAGCAGTGGGGCCCAGG - Intergenic
924670374 1:246118476-246118498 CATTTGGATCATTGGGGTGCAGG - Intronic
1065005819 10:21379195-21379217 CATTTGGACCAGTGGGGTGTGGG - Intergenic
1067712592 10:48661879-48661901 CATTTCAAGAAGTGGGAAGCAGG - Intergenic
1072317822 10:94220942-94220964 CATTTGGAACAAGGGGAAGCTGG - Intronic
1072402618 10:95121328-95121350 CATTTGGAGAAGAGGCACTCTGG + Intergenic
1072913760 10:99524520-99524542 CATTTGTGGGAGTGGGAAGCTGG + Intergenic
1075105640 10:119538452-119538474 CTGTTGGAGCAGGGGGACCCAGG + Intronic
1078691357 11:13583388-13583410 CATTTGGAGAAGGGGCACTCTGG - Intergenic
1078800252 11:14636542-14636564 CATATGGAGAAGTGGAACCCTGG - Intronic
1079481946 11:20890440-20890462 CATTTGGAGAAGAGGCACTCTGG - Intronic
1079648248 11:22894238-22894260 CATCTGGAGGAGTGAGATGCAGG - Intergenic
1080252910 11:30255890-30255912 CACTTGGAGTAGTGGGACTATGG - Intergenic
1080292685 11:30688537-30688559 CATTTGGAGAAGAGGCACTCTGG - Intergenic
1083284137 11:61646959-61646981 CACTTCGGGCAGTGGGCCGCAGG - Intergenic
1083445609 11:62706337-62706359 CTTTTGTAGCCGTGGGAGGCGGG + Intronic
1084554482 11:69867823-69867845 CAGCTGGAGCAGTGGGGCCCGGG - Intergenic
1085009394 11:73127413-73127435 CATCTGCAGCAGTGGGACAAAGG + Intronic
1085879303 11:80446704-80446726 CATGTGGAGCAGTGGAGAGCAGG - Intergenic
1088708292 11:112483210-112483232 CATTTAGGGCAGTGGGATGTTGG - Intergenic
1089911539 11:122105604-122105626 CATTTGCTGCAGTGGGAGGTGGG - Intergenic
1091201439 11:133783913-133783935 CATGTGGGGCAGTGGTTCGCAGG - Intergenic
1095928613 12:47604361-47604383 CATTTGAAGCAGTGGTGTGCTGG - Intergenic
1097598414 12:61663373-61663395 CATTTGGAGAAGAGGCACTCTGG + Intergenic
1102955732 12:117057529-117057551 TATTTAGAGCAGTGGGGTGCTGG + Intronic
1106068247 13:26380045-26380067 CAGCAGGAGCAGTGGGATGCAGG + Intronic
1106890015 13:34235281-34235303 CATTTGGAGAAGAGGCACTCTGG + Intergenic
1107396992 13:40028170-40028192 CATGTGCAACAGTGGGAGGCTGG - Intergenic
1108815528 13:54286390-54286412 CATTTGGAGAAGAGGCACCCTGG + Intergenic
1109307804 13:60660822-60660844 CATTTGGAGAAGAGGCACTCTGG + Intergenic
1109577634 13:64283062-64283084 TATATGGAGTAGTGGGACTCAGG - Intergenic
1111183153 13:84694650-84694672 CATTTGGAGAAGAGGCACCCTGG - Intergenic
1115928711 14:38467054-38467076 CATTTGGAGAAGAGGTACTCTGG + Intergenic
1121057105 14:90865685-90865707 TGTTTGGAGCAGTGGGCAGCAGG + Exonic
1121178216 14:91906797-91906819 CATTGGGGGCAGTGGGACTCGGG - Intronic
1121477998 14:94230713-94230735 CATCTGGAGCACAGGGACACAGG + Exonic
1121706914 14:96003036-96003058 CATTTGGAGAAGAGGCACCCTGG - Intergenic
1121774102 14:96578821-96578843 CATGTGGAGCAGTGCGTCACTGG - Intergenic
1128476189 15:67998755-67998777 CATTTGCAGCTCTGGGAAGCTGG + Intergenic
1130053601 15:80504101-80504123 CATTTGGAGCAGTGGGACGCAGG + Intronic
1132307753 15:100829594-100829616 CATCTGGACCAGTGGCAGGCTGG - Intergenic
1132674811 16:1117177-1117199 CACATGGAGCTGTGGGAGGCTGG - Intergenic
1133157482 16:3885286-3885308 TATTTGGGGCAGTGGGAAGCAGG + Intergenic
1135078640 16:19415330-19415352 CATTTAGAGCAGTGGTTCTCAGG + Intronic
1136659892 16:31748654-31748676 CATTTGGAGAAGAGGCACTCTGG + Intronic
1136726530 16:32361955-32361977 GATTTGAAACAGTGGGACCCTGG - Intergenic
1140801060 16:78488723-78488745 CATTAGGAACTGTGTGACGCTGG + Intronic
1202999904 16_KI270728v1_random:155802-155824 GATTTGAAACAGTGGGACCCTGG + Intergenic
1203131502 16_KI270728v1_random:1692203-1692225 GATTTGAAACAGTGGGACCCTGG + Intergenic
1143301408 17:5913282-5913304 CATTTGGAGCAGTGTGGAGAGGG + Intronic
1152063259 17:78095070-78095092 GATGTGGAGAAGTGGGATGCAGG + Intronic
1153125457 18:1785130-1785152 CATTTGGAGAAGAGGTACTCTGG - Intergenic
1153334838 18:3912687-3912709 CATATGGAACTGTGGGAGGCTGG + Intronic
1161116406 19:2499302-2499324 CATCTGGAGCAGAGGGAGGGAGG - Intergenic
1162756179 19:12861501-12861523 GATTTGGAGGAGTGGCAAGCAGG + Intronic
1163112596 19:15170507-15170529 CAGTGGCAGCAGCGGGACGCTGG + Exonic
1164013324 19:21228956-21228978 CATTTGGAGAAGAGGGGCTCTGG - Intronic
1164608674 19:29617813-29617835 CTCTTTGAGCAGTGGGTCGCTGG - Intergenic
1165242200 19:34477832-34477854 CCTTTGGAACAGTGGGACTCAGG + Intergenic
928212090 2:29330780-29330802 CGTTTGGAGTAGTGGGAGGAAGG + Intronic
928803822 2:35126305-35126327 CATTTGGAGAAGAGGCACTCTGG - Intergenic
929151031 2:38749605-38749627 CATTTGGATCAAAGGGACGTCGG + Exonic
931872603 2:66477166-66477188 GAATTGGAGCAGGGGGAGGCTGG + Intronic
931989496 2:67775924-67775946 CATTTGTAGCAGAGGCACACTGG - Intergenic
934508364 2:94915777-94915799 CATTTGAAGCTGTGGGCAGCAGG + Intergenic
934754435 2:96815949-96815971 CATCGGGAGGAGTGGGACTCCGG + Intergenic
939419006 2:141941654-141941676 CACGTGGAACAGTGGGAAGCTGG + Intronic
943200491 2:184817486-184817508 CATTTGGAGGAGAGGTACTCTGG - Intronic
943661163 2:190561064-190561086 GATATGGAGCAGTGGGAAGGAGG + Intergenic
944911305 2:204313127-204313149 CATTTGGCGCAGTGGGATCCAGG + Intergenic
1170193415 20:13666205-13666227 CATTTGGAGCAGTCGTAAACCGG - Intergenic
1172427831 20:34867780-34867802 CATGTGGAGCAATGGGAAGGAGG - Intronic
1172634188 20:36398731-36398753 CATTTGGAGCTGTGTGACCTTGG - Intronic
1174487957 20:50873033-50873055 CATTTGGACAAGGGGGTCGCAGG - Intronic
1179438748 21:41379200-41379222 CATTTGGGGCAGTGAGACTACGG + Intronic
1181149773 22:20874935-20874957 CCCTTGGAGGAGTGGGAAGCTGG + Intronic
1182213015 22:28692357-28692379 GATTTGAAACAGTGGGACCCTGG - Intronic
1182449542 22:30410787-30410809 GTTTGGGAGCAGTGGGACCCAGG + Intronic
1184078742 22:42202486-42202508 CATATGAAGCAGTGTGACTCTGG + Intronic
952679304 3:36073336-36073358 CATTTGGAGAAGAGGCACTCTGG + Intergenic
954854896 3:53635556-53635578 CATTTGGAGCACCTGGAGGCAGG - Intronic
956691223 3:71879296-71879318 AGTATGGAGCAGTGGGACGCCGG + Intergenic
956699974 3:71950380-71950402 CACTTGGAGCTGTGTGACCCTGG + Intergenic
956848962 3:73210868-73210890 CATTAGGAGCAGAGAGAGGCAGG + Intergenic
958503635 3:94945958-94945980 CATTTGGAGAAGAGGCACTCTGG + Intergenic
959694599 3:109235246-109235268 CATTTGGAGAAGAGGCACTCTGG - Intergenic
960622293 3:119648437-119648459 CATCTGCAGCAGTGGGACCCAGG + Exonic
960680033 3:120238373-120238395 CATTTGGAGAAGAGGCACTCTGG + Intronic
961869768 3:129978857-129978879 CTTTTGGGGCAGAGGGAGGCAGG + Intergenic
965493797 3:169372924-169372946 CATGCGGAGCAGTGGGAAACAGG - Intronic
970369926 4:15396226-15396248 AATTTGGAGCAGTGAGGCCCAGG - Intronic
977868025 4:102053226-102053248 TCTTTGGAGAAGTGGGAAGCTGG + Intronic
982807443 4:159783992-159784014 TATTTGGAGCAGTGAGAGGAAGG + Intergenic
983774795 4:171594088-171594110 CATTTGGAGAAGAGGCACTCTGG + Intergenic
983821093 4:172193917-172193939 CATTTGGAGAAGAGGCACTCTGG - Intronic
983854235 4:172621974-172621996 CATATGGAGGAGTGGGACCCTGG - Intronic
983957709 4:173716657-173716679 CATTTGGAGAAGAGGCACTCTGG - Intergenic
984335132 4:178380058-178380080 CATTTGGAGAAGAGGCACTCTGG - Intergenic
984417360 4:179478353-179478375 CATTAAGGGCAGTGGGAAGCAGG + Intergenic
985023185 4:185712992-185713014 CTTTGGGAACAGTGGAACGCAGG - Intronic
985172115 4:187162352-187162374 CATTTGGAACAGTGAGATGCTGG + Intergenic
987115209 5:14721025-14721047 CCTTTGGAGCAGTGGGTGGGGGG + Intronic
987399715 5:17463065-17463087 CATTTGGAGAAGAGGCACTCTGG + Intergenic
992391499 5:76335346-76335368 CATCTGGAGGAGTGGAAAGCTGG - Intronic
994110508 5:95997890-95997912 CATTTACAGCAGTGAGACGTGGG - Intergenic
996893955 5:128456881-128456903 CATTTGGAGAAGAGGCACTCTGG - Intronic
998177817 5:139912551-139912573 GATTTGGGGCAGTGGGAAGGAGG - Intronic
998277876 5:140775963-140775985 CATTTGGAGAAGAGGCACTCTGG + Intergenic
998755508 5:145375043-145375065 CATTTGGAGAAGAGGCACTCTGG + Intergenic
1001278259 5:170366626-170366648 CATTTGGAGGAGTCTCACGCTGG - Intronic
1002402228 5:178997113-178997135 CGTTTAAAGCCGTGGGACGCAGG + Intergenic
1004760232 6:18657473-18657495 CATTTGGAGAAGAGGCACTCTGG - Intergenic
1006683843 6:35815788-35815810 CTTATGGAGCAGTGGGCCCCGGG - Intronic
1007375352 6:41452523-41452545 CAGGTGGTGCAGTGGGACCCAGG - Intergenic
1008464173 6:51812124-51812146 CCTTTGTAGCTGTGGGACCCAGG + Intronic
1010411821 6:75569394-75569416 CATTTGGAGAAGAGGCACTCTGG - Intergenic
1011410556 6:87061814-87061836 CATTTATTGCAGTGGGAAGCAGG - Intergenic
1012315167 6:97775888-97775910 CATTTGGAGAAGAGGCACTCTGG - Intergenic
1012741052 6:103017584-103017606 CATTTGGAGAAGAGGCACTCTGG + Intergenic
1014127605 6:117794787-117794809 CATGTGGAGCAGTGGGCCAAAGG + Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1023444600 7:40218348-40218370 CATTTGGAGAAGTGGGAGCCAGG - Intronic
1023444723 7:40219483-40219505 CATTTGGAAAAGTGGGAGCCAGG - Intronic
1023955859 7:44885915-44885937 CCTTTGGAGCACTCGGAAGCGGG + Intergenic
1029457331 7:100677876-100677898 CATGTTGAGCACTGGGACGGTGG - Intronic
1029611304 7:101627914-101627936 CCTCTGGAGCTGTGGGACTCTGG + Intronic
1031804708 7:126293439-126293461 CATTTGGAGAAGAGGCACTCTGG - Intergenic
1032255594 7:130294841-130294863 CATTTAGAGCAAGGGGAAGCTGG + Intronic
1039265273 8:35816777-35816799 CATTTGGAGAAGAGGCACTCTGG - Intergenic
1043284974 8:78516816-78516838 GATTTGGAGCAGTAGGTCCCTGG + Intronic
1044505107 8:93007459-93007481 CATTTGGAGAAGAGGCACTCTGG - Intronic
1048496915 8:134943017-134943039 CATGTGGAGCAGTGGGAGCCAGG + Intergenic
1049170481 8:141157621-141157643 CATTGGGAGGAGTGGGAAGGAGG + Intronic
1050152850 9:2634307-2634329 CATTTGCAGCTGTGGCATGCTGG - Intronic
1050183175 9:2942465-2942487 CAGTTGGGGCAGGGGGACGGTGG - Intergenic
1050660862 9:7880965-7880987 CATTTAGAGAAGTGGCACTCTGG - Intronic
1051161533 9:14213925-14213947 AATTTGGAGCAGTGGGAGTTGGG - Intronic
1051321824 9:15913704-15913726 CATTTGGAGAAGAGGGATTCTGG + Intronic
1052756837 9:32550743-32550765 GATTCGGAACAATGGGACGCGGG - Intronic
1053009425 9:34624813-34624835 CAGCTGGAGCGGTGGGAGGCAGG + Intronic
1056983658 9:91341193-91341215 CATTGTGGGCAGTGGGAGGCTGG - Intronic
1057566072 9:96167152-96167174 CATTTCTCGCTGTGGGACGCAGG - Intergenic
1059895250 9:118856677-118856699 CATTTGGAGAAGAGGCACTCTGG - Intergenic
1061580171 9:131531378-131531400 CTTTCGGCGCAATGGGACGCGGG - Intergenic
1062146726 9:134993568-134993590 CTTTGGGAGCAGAGGGACTCTGG + Intergenic
1191650293 X:63529666-63529688 CATTCAGAGCAGTGGGCCCCAGG - Intergenic
1192691971 X:73373791-73373813 CATGTGGAGAAGTGGGACCAGGG + Intergenic
1194286911 X:92021116-92021138 CATTTGGAGAAGAGGTACACTGG - Intronic
1194505644 X:94730252-94730274 TATGTGGAGCAGTGGGGCCCTGG + Intergenic
1194852088 X:98881888-98881910 CATTTGGAGAAGAGGCACTCTGG - Intergenic
1195255899 X:103090671-103090693 CTTTTGGGGCAGGGGGAGGCGGG + Intronic
1196054587 X:111340964-111340986 CATTTGGAGAAGAGGAACTCTGG - Intronic
1197147820 X:123188508-123188530 CATTTGGAGGAGTGGAACCTGGG - Intronic
1197302809 X:124802170-124802192 CATTTGGAGAAGAGGCACTCTGG + Intronic
1199851528 X:151727519-151727541 GATTTGGAGCAGAGGGACGGAGG + Intergenic
1200604453 Y:5245676-5245698 CATTTGGAGAAGAGGTACACTGG - Intronic
1202281869 Y:23198663-23198685 CATTAGGAGCCGTGGCCCGCAGG - Intronic
1202284022 Y:23219856-23219878 CATTAGGAGCCGTGGCCCGCAGG + Intronic
1202433541 Y:24813048-24813070 CATTAGGAGCCGTGGCCCGCAGG - Intronic
1202435698 Y:24834242-24834264 CATTAGGAGCCGTGGCCCGCAGG + Intronic