ID: 1130056437

View in Genome Browser
Species Human (GRCh38)
Location 15:80530355-80530377
Sequence TACTGCTTGCTGGGACTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130056429_1130056437 10 Left 1130056429 15:80530322-80530344 CCCCCTGTAGTGAGCGCAGACAT 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1130056437 15:80530355-80530377 TACTGCTTGCTGGGACTTACTGG 0: 1
1: 0
2: 0
3: 7
4: 78
1130056431_1130056437 8 Left 1130056431 15:80530324-80530346 CCCTGTAGTGAGCGCAGACATTC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1130056437 15:80530355-80530377 TACTGCTTGCTGGGACTTACTGG 0: 1
1: 0
2: 0
3: 7
4: 78
1130056432_1130056437 7 Left 1130056432 15:80530325-80530347 CCTGTAGTGAGCGCAGACATTCT 0: 1
1: 0
2: 1
3: 3
4: 38
Right 1130056437 15:80530355-80530377 TACTGCTTGCTGGGACTTACTGG 0: 1
1: 0
2: 0
3: 7
4: 78
1130056430_1130056437 9 Left 1130056430 15:80530323-80530345 CCCCTGTAGTGAGCGCAGACATT 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1130056437 15:80530355-80530377 TACTGCTTGCTGGGACTTACTGG 0: 1
1: 0
2: 0
3: 7
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130056437 Original CRISPR TACTGCTTGCTGGGACTTAC TGG Intronic
913266617 1:117051444-117051466 TGGTGCTTGCTGAGACCTACAGG + Intergenic
918236425 1:182584791-182584813 TATTGCTTCCTGGGACTTTACGG + Intronic
1063777248 10:9277805-9277827 TAATGCTTGCTTAGACTAACTGG + Intergenic
1067178613 10:43968496-43968518 TACTCCTTGCTGGGACCACCAGG + Intergenic
1069756960 10:70779390-70779412 TTCTGCTGGCTAGGACTTGCTGG + Intronic
1070935654 10:80292956-80292978 AACTGCTCAGTGGGACTTACAGG - Intergenic
1072446345 10:95501930-95501952 AACAGCCTGCTGGGACTTGCAGG - Intronic
1076265201 10:129104135-129104157 TCCTGCTCGCTAGGACTTTCAGG + Intergenic
1079016757 11:16875569-16875591 TCCAACTAGCTGGGACTTACAGG + Intronic
1080751837 11:35157875-35157897 TACTTCTTGCTGGGGCTGAGGGG + Intronic
1088830738 11:113534326-113534348 GACAACTTGCAGGGACTTACTGG - Intergenic
1089022616 11:115232158-115232180 TACTGCTTTCTGGGGTTTCCTGG - Intronic
1092489372 12:8931244-8931266 TACTGTTTTCTAGGAATTACTGG + Intronic
1094172158 12:27504897-27504919 TACTTCTTTTTGGGATTTACGGG - Intergenic
1098756743 12:74373435-74373457 GACTTCTAGCTGGGACTTACAGG - Intergenic
1102316609 12:111893513-111893535 GACTGCTTGCTGGAACTCACAGG + Intronic
1107527283 13:41245822-41245844 ACCTGCTTTCTGGGACTTCCTGG + Intronic
1108360191 13:49662115-49662137 TCCCGATAGCTGGGACTTACAGG + Intronic
1115441331 14:33439687-33439709 TACTGCTTTCTGTCACTAACTGG - Intronic
1117018858 14:51549055-51549077 TGCTTCTTTCTGGGACTTTCTGG - Intronic
1119863040 14:77950740-77950762 TACTGCCTCCAGGGACTTTCTGG + Intergenic
1121996353 14:98606478-98606500 TTCTCCCTGCTGGGTCTTACTGG + Intergenic
1127741766 15:61914822-61914844 AAGTGCTGGCTGGGATTTACAGG + Intronic
1130056437 15:80530355-80530377 TACTGCTTGCTGGGACTTACTGG + Intronic
1134136937 16:11683233-11683255 TCCTGCTTGCAGGGGCTTCCGGG + Intronic
1136241220 16:28945498-28945520 TCCTAGTAGCTGGGACTTACAGG + Intergenic
1137823899 16:51472726-51472748 TACTGCTTGCCAGGAGTTGCAGG - Intergenic
1141864376 16:86740231-86740253 TACTGATCTCTGTGACTTACTGG - Intergenic
1144270983 17:13615810-13615832 TACTGAGGGCTGGGACTTAAAGG + Intergenic
1144711345 17:17403632-17403654 TCCTGCTGGGTGGGAATTACTGG - Intergenic
1145188732 17:20820079-20820101 TGCTTGTAGCTGGGACTTACAGG + Intergenic
1153924522 18:9824113-9824135 TACAGTTTTCTGGGAATTACAGG - Intronic
1154138306 18:11800479-11800501 AACTGCTTCTTGGCACTTACAGG - Intronic
1158422777 18:57310908-57310930 GACTGCTTCCTGGAAGTTACTGG + Intergenic
1163608713 19:18290298-18290320 TACTGTGTGCTGGGACCCACGGG - Intergenic
1163703101 19:18796412-18796434 TCCTGCCTTCTGGGACTTAAGGG - Intergenic
1165002868 19:32779344-32779366 AACCGCTTACTGGTACTTACAGG - Intronic
1166887315 19:45969961-45969983 CACTGCTTGCTGGGACACCCAGG + Intronic
1168138222 19:54366031-54366053 TACTGCATGATGTCACTTACAGG + Intronic
1168159724 19:54502030-54502052 TACTGCATGATGTCACTTACAGG - Intronic
929859154 2:45661100-45661122 TACTCCTTGCTGGCAAATACAGG - Intronic
933978817 2:87533941-87533963 AACTGATTGCTGGGAATTTCAGG - Intergenic
936315013 2:111416865-111416887 AACTGATTGCTGGGAATTTCAGG + Intergenic
941687381 2:168461010-168461032 TCCTGGTTGCTGGTACTTAGGGG + Intronic
949001191 2:241614993-241615015 TTCTGCTTTCTGGAACTTACAGG - Intronic
1171509682 20:25671605-25671627 TAGTGCTGGCTGAGCCTTACAGG + Intergenic
1173525634 20:43730434-43730456 TCCGGATTGCTGGGACTTACAGG + Intergenic
952323904 3:32303194-32303216 TACTGCTTGCTGGGAACTGTAGG + Intronic
960287882 3:115850001-115850023 TCCTGCTTGTTAGGACATACTGG + Intronic
964330154 3:155593257-155593279 TCCTTCTTGCTGGGATTGACTGG - Intronic
966350543 3:179029313-179029335 TAATGCTTGCAGCGACTTAGAGG - Intronic
969226774 4:5803743-5803765 GAGAGCTTGCTGGCACTTACAGG - Intronic
975523792 4:75327854-75327876 TCCTGCCTGCTGGGCCTTTCTGG + Intergenic
977432675 4:96951973-96951995 TACTGCATGATGTGACTTACAGG + Intergenic
980121169 4:128729996-128730018 GTCTGCTTCTTGGGACTTACAGG - Intergenic
985671960 5:1211249-1211271 CACTGCTCGCTGGGACTGTCGGG + Intronic
986374281 5:7114389-7114411 TACTGCATGTTTGCACTTACAGG - Intergenic
987787574 5:22521985-22522007 TATTGCTAGTTGTGACTTACAGG - Intronic
993044255 5:82849330-82849352 TACTCCTTTCTGGGAATTAATGG + Intergenic
996291139 5:121853175-121853197 TACTGCTTCTTGGGACACACTGG - Intergenic
998493257 5:142565195-142565217 TACTGCTTCTGGGCACTTACCGG - Intergenic
1001002237 5:168018579-168018601 TATTCCTTCCTGGGACTTCCTGG - Intronic
1001994699 5:176146965-176146987 TCCTGCTCCCAGGGACTTACAGG - Intergenic
1007145700 6:39627696-39627718 TACTGAATGCTGGCATTTACTGG + Intronic
1007240376 6:40420512-40420534 TACTGGTTGCTGGGACTGTGTGG + Intronic
1007352464 6:41283851-41283873 TGCTTCTTGCTGGGATTCACAGG + Intronic
1013902213 6:115170920-115170942 TACTGGTTGCTGTGTCTTATTGG - Intergenic
1028914593 7:96244150-96244172 AACTGCTTGCTGTGACTTCCAGG - Intronic
1034299380 7:150001836-150001858 TACATCTTCCTGGGACTTCCTGG - Intergenic
1034806631 7:154094937-154094959 TACATCTTCCTGGGACTTCCTGG + Intronic
1042426850 8:68659156-68659178 ATCTGCTGGCTGGGACTTTCAGG - Intronic
1049003984 8:139843335-139843357 CACTGCTCTCTGGGACTTCCAGG + Intronic
1050055794 9:1652568-1652590 TTCTGGTTGCTGGGACCCACAGG - Intergenic
1050057438 9:1670510-1670532 TCCTGCTTGTTGGGACCCACAGG - Intergenic
1052702739 9:31958557-31958579 TACTGCATGATTGCACTTACAGG + Intergenic
1053145266 9:35707557-35707579 GTCTCCTTCCTGGGACTTACAGG + Intronic
1054158696 9:61658893-61658915 TAATGCTTTCTGGGGCTGACAGG + Intergenic
1054450053 9:65398507-65398529 TAATGCTTTCTGGGGCTTACAGG - Intergenic
1054478470 9:65589898-65589920 TAATGCTTTCTGGGGCTGACAGG + Intergenic
1059413262 9:114147391-114147413 TACTGCTTGCGGGTAGTTCCAGG - Intergenic
1060888477 9:127173038-127173060 TACTGCTAGCTGGGAGGTCCAGG + Intronic
1186073451 X:5849470-5849492 TACTGTTTTCTGGGACATTCAGG + Intronic
1188779463 X:34263275-34263297 TTCTGCTTCCTGGGCATTACTGG + Intergenic
1197703541 X:129617388-129617410 CACTGCTTGCTGGGGGTTGCGGG + Intergenic
1198093525 X:133355603-133355625 TGCTGCTTACTGCTACTTACTGG - Intronic
1199788820 X:151130656-151130678 TACAGCTTGGTGGGATTTCCAGG + Intergenic