ID: 1130059607

View in Genome Browser
Species Human (GRCh38)
Location 15:80560008-80560030
Sequence ATGTGTGGGGAGGGCTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 244}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130059607 Original CRISPR ATGTGTGGGGAGGGCTCTCC TGG (reversed) Intronic
900150628 1:1177846-1177868 CTGGGTGGGGAGGGGTCTCAGGG + Intronic
900347575 1:2216932-2216954 ATGGTGGGCGAGGGCTCTCCTGG + Intergenic
900354174 1:2252046-2252068 ACCTGTGGGGAGGCCTCTCGGGG + Intronic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
901194749 1:7434060-7434082 ATGTGGGGGAGGGACTCTCCAGG - Intronic
905212197 1:36382004-36382026 ATGTGTGGCTGGGGCTCTGCTGG - Intronic
905402865 1:37716158-37716180 ATGTGGGGCGATGGCTCTCTGGG - Exonic
905513657 1:38544766-38544788 ATGTGGGGAGAGTGCTGTCCTGG + Intergenic
906667496 1:47631987-47632009 TGGTGAGGGGTGGGCTCTCCAGG + Intergenic
907549183 1:55289628-55289650 ATGTGAGGCCAGGTCTCTCCTGG + Intergenic
908052824 1:60251267-60251289 ATATGAGGGGAGGGCACTCAAGG - Intergenic
908338594 1:63152863-63152885 ATATGTGGGGAAGGCTTTCTGGG - Intergenic
910803527 1:91167807-91167829 ATGTGTGGAAGGTGCTCTCCAGG - Intergenic
912212796 1:107573040-107573062 ATGTGTTTGCAGGGCTCTTCTGG + Exonic
912698926 1:111861695-111861717 AGGTGCAGGGAGGGCTCTGCAGG + Intronic
914506067 1:148290014-148290036 ATGTCAGGGGAGGGGTCTACTGG - Intergenic
915906043 1:159877995-159878017 AAATGTTGTGAGGGCTCTCCAGG - Intronic
916191154 1:162179683-162179705 ATGAGTGGGGAGGGAAATCCTGG + Intronic
918130962 1:181629081-181629103 CTGTCTGGGGAGGGCTTCCCAGG + Intronic
920148403 1:203883177-203883199 GTGTGTTGGGAGGGTTCTTCTGG + Intergenic
920684940 1:208102187-208102209 AGGTGTTGGGAGGGCTCTGGAGG - Intronic
923391223 1:233515622-233515644 AGGTGTGGCGAGGTCACTCCAGG + Intergenic
1062820661 10:532252-532274 AGGTGGGGGCAGGGCTTTCCGGG - Intronic
1067449021 10:46369950-46369972 ATGTGTGGGGAGGCCCAGCCAGG + Intronic
1067468311 10:46517746-46517768 ATGTGAGGGGAGGCCTGTCTGGG - Intergenic
1067518246 10:46973784-46973806 GTGTGTGGGGTGGGCTCCCAAGG + Intronic
1067588348 10:47490815-47490837 ATGTGTGGGGAGGCCCAGCCAGG - Intronic
1067635473 10:47998906-47998928 ATGTGTGGGGAGGCCCAGCCAGG - Intergenic
1067644003 10:48078044-48078066 GTGTGTGGGGTGGGCTCCCAAGG - Intergenic
1070132035 10:73662914-73662936 ATGTGTGGGGAGGCCCAGCCAGG - Intronic
1070321939 10:75360949-75360971 GGGTGTGGGGAGACCTCTCCTGG + Intergenic
1070349878 10:75581999-75582021 ATGTGAGGGGTGGGCTCCCAAGG + Intronic
1070533798 10:77360538-77360560 ATGTGGAGGGAGTGCTCTCCTGG - Intronic
1071513718 10:86283205-86283227 CTATGTGGGGAGGAATCTCCAGG - Intronic
1071609650 10:87021162-87021184 ATGTGTGGGGAGGCCCAGCCAGG + Intronic
1075441046 10:122479681-122479703 AGGTGTGGGGAGAGGTCTGCAGG + Intronic
1076486682 10:130824788-130824810 AGGAGTGGGGAGGCCTCCCCTGG - Intergenic
1077223184 11:1426320-1426342 GTGTGTGGGGCGTGCTCTGCTGG + Intronic
1077227313 11:1444030-1444052 ACGTGTGGGGAGGTGTGTCCAGG + Intronic
1082758297 11:57100059-57100081 AGGTTTGGGCAGGGTTCTCCAGG - Intergenic
1082921334 11:58497961-58497983 CTGTGTGCAGATGGCTCTCCAGG + Intergenic
1084413676 11:69018142-69018164 GTGTGTGGGAAGGACTCTGCTGG - Intergenic
1084594852 11:70110830-70110852 ATGTGTGGGGAAGGGTTTCCTGG - Intronic
1084995509 11:72973611-72973633 ATGTTTTGGGAGGGGTCACCTGG + Intronic
1085165853 11:74398556-74398578 AGGCGTGGGGAGCGCGCTCCCGG - Intergenic
1089084511 11:115805737-115805759 ATGGGTGGGGAGGGATGCCCAGG - Intergenic
1092578913 12:9819008-9819030 CTGGGTGGGGAAGGCTCCCCTGG - Intergenic
1096848041 12:54418700-54418722 AAGTCTGGGCAGGGGTCTCCGGG - Intronic
1097848699 12:64390736-64390758 AGGGCTGGGGAGGGCGCTCCAGG - Exonic
1098820509 12:75221911-75221933 ATGTTGGGGGAGGGATCTCGTGG + Intergenic
1099966711 12:89454575-89454597 CTATCTGGGAAGGGCTCTCCAGG - Intronic
1101259163 12:103011846-103011868 ATCTGGGGGCAGGGCTTTCCAGG + Intergenic
1102063397 12:109952432-109952454 ATGTCTGGGGAGGACTCTTCTGG - Intronic
1102567105 12:113803912-113803934 ATGTGTGGGGATGACTCCCATGG + Intergenic
1103275072 12:119704574-119704596 TGGTGGGGGGAGGGCTGTCCTGG + Intronic
1104714052 12:131005061-131005083 ATGTCTGATGAGGGCTGTCCTGG - Intronic
1105973644 13:25453961-25453983 ATGAGTGGGGAGGGCTGTGGCGG + Intronic
1106111479 13:26781458-26781480 ATGTCTGTGGAGTGCTCTCCTGG - Intergenic
1107060814 13:36157763-36157785 ATTTGTGGGGAGGAATCTCCTGG + Intergenic
1107091420 13:36485389-36485411 ATGTTGGGGGAGGGCTCTCATGG + Intergenic
1110464958 13:75789973-75789995 ATGTGTGGGGAGGGCTGGCTTGG + Intronic
1112030587 13:95453210-95453232 ATGTTTAGGGAGGGGACTCCTGG - Intronic
1113347940 13:109499047-109499069 ATGGGACGGGAGGGCACTCCTGG - Intergenic
1113446799 13:110375139-110375161 AGGTGTGAGGATGGCTCACCGGG + Intronic
1114051241 14:18920958-18920980 ATGTGTTGGGTGTGCTATCCCGG + Intergenic
1114111321 14:19480967-19480989 ATGTGTTGGGTGTGCTATCCCGG - Intergenic
1118751698 14:68812530-68812552 AAGTGTGGGGAGGGCTGTGTAGG - Intergenic
1119325874 14:73759402-73759424 CCGGGTGGGGAGGGCTTTCCTGG + Intronic
1119531802 14:75366859-75366881 GTGTGTGGGGAGGGTTTTCAGGG + Intergenic
1121182656 14:91941408-91941430 ATGTGTTGGGTGGACTCTTCAGG + Intronic
1121597871 14:95179670-95179692 ATGTGTTGTGAGGGTTCTTCTGG + Intergenic
1123701045 15:22915011-22915033 ATGAGTGGGGAGGGGTCACCGGG + Intronic
1124464225 15:29921548-29921570 ATGTGTGGGCACAGCTCTCACGG + Intronic
1124645274 15:31433949-31433971 ATGTGAGGGGTGGTGTCTCCTGG - Intronic
1127311328 15:57754511-57754533 ATGTATGCTGAGGGCTCTCAGGG + Intronic
1128642427 15:69349413-69349435 ATGTGTGGGGATGGCTATCAGGG + Intronic
1128694073 15:69747348-69747370 GGGTGTGGGAAGGGCCCTCCAGG - Intergenic
1129066778 15:72911784-72911806 ATGTGTAGTCAGGGTTCTCCTGG + Intergenic
1129759441 15:78120986-78121008 AACAGTGGAGAGGGCTCTCCTGG + Intronic
1130059607 15:80560008-80560030 ATGTGTGGGGAGGGCTCTCCTGG - Intronic
1130148391 15:81292824-81292846 CTGGGAGGGGTGGGCTCTCCTGG - Exonic
1131091974 15:89630222-89630244 ACGTGTGGGGAGGTGTCTCATGG - Intronic
1131298333 15:91172300-91172322 AAGGGTGAGGAGGGCTTTCCTGG - Intronic
1132500908 16:284324-284346 AGGTGTGGAGAGGGTGCTCCTGG + Intronic
1133906965 16:10031296-10031318 ATCTGGGGGAAGGGCTTTCCAGG - Intronic
1134093821 16:11405751-11405773 CTGTGTGGGGAGGGACCTACAGG - Intronic
1136143155 16:28299951-28299973 TTGTGGTGGGCGGGCTCTCCTGG - Intronic
1137648108 16:50093559-50093581 ATGTGTGCGCAGGGGTCTCCTGG - Intronic
1137707733 16:50547600-50547622 TTGTCTGGGGAGGTCTCTGCGGG - Intergenic
1137773733 16:51039165-51039187 ACGAGAGGAGAGGGCTCTCCAGG - Intergenic
1138421455 16:56901943-56901965 ATGGGTGGGGAAGGCCCTTCTGG - Intronic
1138463181 16:57165920-57165942 ATGCCAAGGGAGGGCTCTCCAGG - Intronic
1140254415 16:73322644-73322666 ATGTGTGGTGAGAGCTATGCTGG + Intergenic
1141629381 16:85278307-85278329 ATGTGTGGAGAGGGACCTCCAGG - Intergenic
1142754823 17:2009964-2009986 CTCCCTGGGGAGGGCTCTCCTGG - Intronic
1142785138 17:2215660-2215682 GTGTGTGGGGGGGGATCTCACGG + Intronic
1143462731 17:7114485-7114507 GAGCGTGGGGAGGGGTCTCCTGG - Intronic
1143532214 17:7512115-7512137 CTGTGTGTGGAGGGGTCTCATGG + Intronic
1144599177 17:16597975-16597997 ATCTGTGGCTAGGGCCCTCCAGG + Intergenic
1144764393 17:17724879-17724901 GGGAGTGGGGAGGGGTCTCCAGG - Intronic
1144781965 17:17812901-17812923 GTGTGTGGGCAGGGCTCCCGCGG - Intronic
1145017001 17:19405769-19405791 ATGTTGGGGGAGGGCTGACCAGG + Intergenic
1146649616 17:34598552-34598574 AGGGGTGGGCAGGGCTGTCCTGG - Intronic
1147444002 17:40463873-40463895 ATGAGTGGGGAAGGCCCTGCAGG + Intergenic
1147452113 17:40512228-40512250 GTGAGTGGGGAGGGGGCTCCAGG - Intergenic
1148395339 17:47303836-47303858 ATGTGGGGGAAGGGGTCTACTGG - Intronic
1149595132 17:57860858-57860880 ATGGGTGGGGAGGCCCCTGCAGG + Intergenic
1151468808 17:74305054-74305076 AAGAGTGGGGACTGCTCTCCAGG + Intronic
1151893260 17:76963673-76963695 ATGCGGAGGGAGGGCTCTCCAGG - Intergenic
1153732541 18:8029243-8029265 AGGTGTGGGGGAGGCACTCCAGG - Intronic
1155030717 18:21981229-21981251 ATGTGTGGGGCCAGCTCACCTGG + Intergenic
1155745876 18:29356012-29356034 ATGAAAGGGGTGGGCTCTCCAGG - Intergenic
1156560359 18:38118331-38118353 AGTTGTGGTGAGGCCTCTCCTGG - Intergenic
1157331299 18:46705648-46705670 CTGTGAGGAGAGGGCTCACCGGG - Intronic
1160122678 18:76144909-76144931 ATGTGAGGGAAGGACTCACCAGG + Intergenic
1161812137 19:6477051-6477073 GTGAGTGGGGAGGGGTCTCTGGG - Intronic
1161931879 19:7346027-7346049 GTTTGTGGTGAGGGCTTTCCGGG + Intergenic
1162520689 19:11177861-11177883 GGGTGTGGGGAGGGCTCTTCTGG - Intronic
1163688462 19:18725496-18725518 GTGTGTGGGGACGGCTGGCCAGG - Intronic
1164621428 19:29697945-29697967 CTGTGGGTGGAGGGGTCTCCAGG - Intergenic
1165095471 19:33407510-33407532 GTGAGTGGGGAGGGGTCTTCTGG + Intronic
1165885285 19:39073742-39073764 AAGTGTGGGGTGGGCTGTCCTGG + Intergenic
1166194256 19:41195673-41195695 ATGAGTGGGGAGGGTGTTCCAGG + Intronic
1166255261 19:41599796-41599818 AGGTGAGGGGAGGGCTCCCTGGG + Intronic
1166259303 19:41626879-41626901 AGGTGAGGGGAGGACTCTCTGGG - Exonic
1167328151 19:48837462-48837484 ATCTGGGGGGAGGGGTCTCCTGG + Exonic
1167357914 19:49015447-49015469 ATGTGAGGGGAGGGCATTCTGGG - Intronic
1167565221 19:50251994-50252016 AAGGGTGGGAAGGGCTCTCCAGG + Intronic
1167611013 19:50507736-50507758 TTTTGTGGGGAGGCCTTTCCAGG - Intronic
1168153471 19:54461023-54461045 ATTTGTGGGGAGTGCGCTCCAGG + Exonic
925786277 2:7434214-7434236 ATTTATGGGGAGGGATGTCCCGG - Intergenic
926231169 2:11005319-11005341 ATGCCTGGGGAGGGGTCTCTGGG + Intergenic
927060944 2:19418850-19418872 AGGGGTGGGGATGGCTCTCTGGG - Intergenic
929776344 2:44933204-44933226 AAGAGTGGCCAGGGCTCTCCTGG + Intergenic
930716298 2:54596750-54596772 CTGTGCCGGGAGGGCTCCCCAGG - Intronic
931712107 2:64997177-64997199 ATCTCTGGGAAGGGCTCTCCTGG - Intronic
935708156 2:105873934-105873956 CTGTGTGGTCAGGGCACTCCCGG - Intronic
936378976 2:111967609-111967631 ATGTGTAGGGGGAGCTTTCCAGG - Intronic
937701643 2:124868943-124868965 ATGAATGGGGAGGGCTCCCTAGG + Intronic
938116695 2:128607183-128607205 GTGTCTGGGGAAGGCTGTCCGGG - Intergenic
939269602 2:139920854-139920876 ATATGTGGGAAGAGCTCTTCAGG - Intergenic
946392510 2:219425297-219425319 AAATGTGTGCAGGGCTCTCCTGG + Intronic
947599791 2:231439693-231439715 GTGTGTGGGGAGCCTTCTCCTGG - Intergenic
947765370 2:232634089-232634111 TTGTGTGGGGAGGGGTCCCGGGG + Intronic
948909156 2:240994377-240994399 TTGTGTGGGGGAGGGTCTCCTGG - Intergenic
949055239 2:241924543-241924565 ATGTGGTGGGGGGGATCTCCTGG - Intergenic
1168856466 20:1012773-1012795 AGGTCTGGGGAGGGCATTCCAGG + Intergenic
1172135019 20:32681078-32681100 ATCTCTGGGGAGAGCGCTCCAGG + Intergenic
1172640389 20:36437048-36437070 ATCTGTGGGCTGGGATCTCCGGG - Intronic
1173500012 20:43546251-43546273 AGGTGTGAGGAGGGCTCACTTGG + Intronic
1175165123 20:57038108-57038130 ATCTGTGGTGGGGGCTGTCCTGG + Intergenic
1175401286 20:58701278-58701300 AGGTGTGGGCCCGGCTCTCCAGG + Intronic
1175572710 20:60036457-60036479 ATGTGTGGCGGGGGATCTTCTGG - Intergenic
1175917468 20:62433360-62433382 ATGTGTGGGGTGGAGGCTCCGGG + Intergenic
1175953480 20:62596185-62596207 GTGTGTGGGGCGGCCTCTCCTGG - Intergenic
1175955363 20:62606276-62606298 AGGTGTGGGGAGGGCCCTTCTGG - Intergenic
1176132909 20:63503772-63503794 CCGTGTGGGGAGGTCCCTCCAGG - Intergenic
1176692165 21:9927787-9927809 GTGTTGGGGGAGGGATCTCCGGG - Intergenic
1178159570 21:29896004-29896026 AGTTGTGGGGAGGGCACTCTGGG - Intronic
1178741373 21:35205351-35205373 GGGTGTGGGGAGCTCTCTCCTGG - Intronic
1180469716 22:15643333-15643355 ATGTGTTGGGTGTGCTATCCCGG + Intergenic
1180691090 22:17716469-17716491 ATGGGAGGGGAGGCTTCTCCTGG - Intronic
1180728171 22:17961612-17961634 GTGTGTGGGAAGGGGACTCCAGG - Intronic
1181863889 22:25840338-25840360 ATGTGGCGGAAGGGCCCTCCAGG - Intronic
1183450507 22:37892072-37892094 ATGTGAGGCAAGAGCTCTCCAGG + Intergenic
1183886477 22:40887481-40887503 ATTTCTGGTGAGGGCTCTCCCGG + Intronic
1184093503 22:42304456-42304478 GTGAGTTGGGAGGGCTCTGCGGG - Intronic
1184751305 22:46488014-46488036 GGGTGTGGGGAGGGATGTCCAGG + Intronic
1184988850 22:48154064-48154086 CTGTGTGGGGTGGGCTTCCCAGG + Intergenic
1185296206 22:50056594-50056616 GTGGGTGTGGAGGGCTCTCCTGG - Intronic
1185343893 22:50303113-50303135 GAGTGTGGGGGGGTCTCTCCTGG - Intronic
950090271 3:10290054-10290076 CTTTGTGGGGAGGTCTCACCTGG + Exonic
951841274 3:27036521-27036543 ATGTGTGGGGAGAGCATTCCAGG - Intergenic
954078327 3:48197233-48197255 ATGTGTGGGGATGTCTTCCCAGG - Intergenic
954425508 3:50440886-50440908 AAGCCTGGGGAGGGCTTTCCAGG + Intronic
954439498 3:50513985-50514007 ATCTCTGGGGAGGGCTTTGCAGG + Intergenic
954748477 3:52800439-52800461 ATGAGTGGGGCCGGCTGTCCCGG + Intronic
958044626 3:88268480-88268502 ATGTGTGTGGCTGGCACTCCTGG + Intergenic
961033811 3:123628621-123628643 ATGTGTAGGGAGAGCTGCCCAGG - Intronic
962752623 3:138444956-138444978 ATGAGTGGACAGGGCTCCCCAGG - Intronic
962932852 3:140053540-140053562 ATGTGTGTGGAGGACTGCCCAGG + Intronic
963044189 3:141090543-141090565 ATCTCTGGGGAGGGTTATCCAGG + Intronic
963274342 3:143315350-143315372 ATGGGTGGTGAGGGCTCTAACGG + Intronic
964400292 3:156291260-156291282 ATGAGTGGGGAGGGGTCTTGAGG + Intronic
964835330 3:160931613-160931635 ATGTGTGGGGAAGGCATTCTTGG + Intronic
965095124 3:164216289-164216311 ATGTGGGAGGACGTCTCTCCTGG - Intergenic
969590309 4:8118271-8118293 ATGAGTGTGGAGTGCTCTTCTGG - Intronic
981503640 4:145477734-145477756 ATCTGTGGGAAGAGCTGTCCAGG + Intergenic
983146108 4:164216764-164216786 ATGTGAGAGCAGGGCTCTACTGG + Intronic
984721430 4:182976801-182976823 GTTTCTGGGGAGGGCTCTCTTGG - Intergenic
985289924 4:188376888-188376910 ATGTGTGGGAAGGGCTCGTATGG + Intergenic
986075778 5:4336854-4336876 GTTTCTGGTGAGGGCTCTCCTGG + Intergenic
986306560 5:6520861-6520883 GTGTGTGGTGAGGGAGCTCCGGG + Intergenic
986797064 5:11222912-11222934 ATGGGTGGGAAGGGCACACCAGG - Intronic
989757219 5:44969961-44969983 ATGTCAGGGGAGGACTCTGCAGG - Intergenic
993144527 5:84077468-84077490 ATGGCTGGGGAGGGCTCACATGG + Intronic
996431326 5:123381391-123381413 ATTTGAGGGGATGGCTCTACAGG - Intronic
998424159 5:142012884-142012906 ATGTGTGAGGGCGGCTCCCCGGG + Intronic
999194274 5:149771409-149771431 ATCTGTGGGGAGGGAACTGCTGG + Intronic
999432873 5:151538981-151539003 ATGTGTGGAGATGGTTCCCCAGG + Intronic
999672365 5:153969027-153969049 AAGAGTGGGCAGGACTCTCCAGG - Intergenic
1000262332 5:159599987-159600009 GTGTGAGGGGTGGGCTCCCCAGG + Intergenic
1003546381 6:7062925-7062947 AGGAGTGCTGAGGGCTCTCCTGG + Intergenic
1004206501 6:13596436-13596458 ATGTGTGGGGAGGGCTGGAGTGG - Intronic
1004326405 6:14677530-14677552 ATCTGTGGGGAGGGCTGACCAGG - Intergenic
1006371964 6:33650336-33650358 ATGTGTGGGCAAGGCTCTGAGGG + Intronic
1006399030 6:33805276-33805298 ATGTGTGGGGAAGGTGCTACTGG - Intergenic
1006437358 6:34032948-34032970 AGGTGTGGGAAGGGGCCTCCTGG + Intronic
1007238999 6:40411666-40411688 GTCTGTGGGAAGGGCCCTCCAGG - Intronic
1007292324 6:40797129-40797151 ATGGGTGGGGAGGGCTGTGGAGG - Intergenic
1007384344 6:41510544-41510566 AGGTGTGGGGAGGGCACACCGGG - Intergenic
1007621925 6:43220702-43220724 AGGTGAGGGTATGGCTCTCCAGG - Intronic
1007750322 6:44067227-44067249 ATGTGTGGGCAGGGCCTGCCTGG + Intergenic
1008694253 6:54015560-54015582 ATCTGCGGGGAGAGCACTCCAGG + Intronic
1011640954 6:89415368-89415390 ATGTCTGGGGATGTCTCCCCAGG + Intergenic
1012202067 6:96418977-96418999 ATGTGTGGAGAGGGCTTTCCAGG - Intergenic
1016589553 6:145729441-145729463 ATGTGAGGGGTGGGCTTTCAAGG - Intronic
1017477295 6:154810730-154810752 AGGTGTGGGGAGGGTTCACTTGG + Intronic
1017821176 6:158050022-158050044 AGGTGTGGACAGGGCTCTGCAGG + Intronic
1018902931 6:168060245-168060267 ATGTGTGGGGATGGGATTCCTGG + Intronic
1019038093 6:169078767-169078789 GTGTGTGGGGAGGGTGCCCCAGG + Intergenic
1019216526 6:170447386-170447408 AGGTGTGGAGAGGGCACTCATGG + Intergenic
1019412122 7:911292-911314 GTGAGTGGGGGGGTCTCTCCAGG - Intronic
1019938854 7:4273639-4273661 ACGTGTGCTGAGGGCTCTGCAGG - Intergenic
1024502783 7:50130708-50130730 AGGTGTGGGGAGGCCTCCCCAGG + Intronic
1024710596 7:52010890-52010912 ATGGGTGGGCAGGGCCCTGCAGG - Intergenic
1028437559 7:90821888-90821910 ATGAGTGGGCAGGGGTCTCAAGG - Intronic
1029490360 7:100867229-100867251 CCGAGAGGGGAGGGCTCTCCGGG - Exonic
1031130544 7:117828368-117828390 AACTGTGGGTAGGGCACTCCTGG + Intronic
1032960461 7:137027495-137027517 ATGGGTGAGGAGAGCTTTCCAGG - Intergenic
1035281814 7:157783362-157783384 CTGTGTGGTGAGGACCCTCCCGG - Intronic
1036705094 8:11040632-11040654 GTGTCTGGTGAGGGCTCTCCTGG + Intronic
1041382256 8:57261773-57261795 GTGTGTGGGGCGGGCCGTCCTGG + Intergenic
1043174285 8:77004515-77004537 ATGTGTGTGGAGGGGACTCTGGG + Intergenic
1044951470 8:97439525-97439547 GTGTGGGGAGAGGGCACTCCAGG + Intergenic
1045352901 8:101358809-101358831 GTGTGTTGGGGAGGCTCTCCTGG - Intergenic
1045951057 8:107852175-107852197 ATGTGTGAGGAGGGCATCCCGGG + Intergenic
1047349545 8:124060513-124060535 ATCTGTGGTGATGGCTCTGCTGG + Intronic
1048552358 8:135445351-135445373 CTGTGTGGGGAGAGCTGTCGTGG - Intergenic
1048973430 8:139657817-139657839 GCGGGTGGGGAGGCCTCTCCAGG + Intronic
1049076511 8:140400706-140400728 GGGGGTGGGGATGGCTCTCCTGG - Intronic
1049419168 8:142509442-142509464 GCGTGTGGGGGTGGCTCTCCAGG + Intronic
1049661837 8:143823059-143823081 TTGCCTGGGGAGGGGTCTCCAGG - Intronic
1049666044 8:143843154-143843176 ATGTTTGGGAAGGGCGTTCCGGG - Intergenic
1049674606 8:143884025-143884047 GTGAGTGGGGAGGGCACTGCCGG - Intergenic
1052273923 9:26656855-26656877 GTGTGTGGGGAGGGCTTTTAAGG + Intergenic
1053397884 9:37791031-37791053 ATTCATGGGGAGGGGTCTCCTGG + Intronic
1053629106 9:39913887-39913909 GTGTTGGGGGAGGGATCTCCGGG - Intergenic
1054214781 9:62336815-62336837 GTGTTGGGGGAGGGATCTCCGGG + Intergenic
1054672700 9:67818534-67818556 GTGTTGGGGGAGGGATCTCCGGG - Intergenic
1055764197 9:79644091-79644113 ATGTGGTGGGAGGGATCTCGTGG + Intronic
1060496825 9:124125493-124125515 GTCTGTGGGCAGGGCTCTGCAGG - Intergenic
1061059659 9:128244132-128244154 GTGTGTGGGGAGGGGGCTCTAGG + Intronic
1061818300 9:133208849-133208871 CTGTGGAGGGAGGGCTCACCTGG - Intronic
1061884608 9:133585282-133585304 GGGTGTGGGGAGGGGGCTCCCGG - Intronic
1061922241 9:133788591-133788613 AGGTGAGGGCAGGGCTCGCCCGG - Intronic
1062173019 9:135145756-135145778 AGGTCTGGGGAGGGCATTCCAGG - Intergenic
1062177262 9:135170663-135170685 ATGTGTGGAGAGCTCTCTGCCGG - Intergenic
1062242152 9:135546509-135546531 CTGTGGAGGGAGGGCTCACCTGG + Intronic
1062278364 9:135741107-135741129 ATCAGTGGGGACGGCTGTCCTGG + Intronic
1062369687 9:136231563-136231585 ATGTGTGGGGATGGGCCGCCAGG - Intronic
1185450221 X:277471-277493 ATGTGAGGGGAGGGCTCAGGAGG + Intronic
1185450270 X:277620-277642 ATGTGAGGGGAGGGCTCAGGAGG + Intronic
1185450342 X:277837-277859 ATGTGAGGGGAGGGCTCAGGAGG + Intronic
1190075877 X:47316845-47316867 AAGCGGTGGGAGGGCTCTCCAGG - Intergenic
1191056068 X:56242503-56242525 ATGAGTGGGGAGGGCTACACTGG + Intronic
1191802195 X:65093519-65093541 ATGTAAGGGGTGGGCTCTCAAGG - Intergenic
1191911846 X:66160112-66160134 AGGTGTTGGGAGGACTCTCAGGG + Intergenic
1192207246 X:69104791-69104813 ATGTGAGGGCAGTGCTCTCAGGG - Intergenic
1192443969 X:71196278-71196300 AAGAGTGGGGAGGGCACTCCAGG + Intergenic
1195619220 X:106936309-106936331 ATGTGTGGGGAGGGTTTTCCAGG - Intronic
1197052440 X:122076539-122076561 AGCTGTGGGGAAGGCTTTCCAGG + Intergenic
1197788419 X:130224208-130224230 AGGGGTGGAGAGGGCTCTCTAGG - Intronic
1199853080 X:151739075-151739097 ATGTGAAGGGAGGCCTCTTCTGG - Intronic
1200122888 X:153799516-153799538 ATGGCTGGGAAGGGCTCACCTGG - Intergenic