ID: 1130060741

View in Genome Browser
Species Human (GRCh38)
Location 15:80568131-80568153
Sequence GTTCCATCAAATATGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130060736_1130060741 20 Left 1130060736 15:80568088-80568110 CCACTACAAAGAAGACCTCTTTA 0: 1
1: 0
2: 0
3: 23
4: 160
Right 1130060741 15:80568131-80568153 GTTCCATCAAATATGGAATGAGG 0: 1
1: 0
2: 0
3: 8
4: 217
1130060737_1130060741 5 Left 1130060737 15:80568103-80568125 CCTCTTTATCATCCTTGCTTTTT 0: 1
1: 0
2: 7
3: 61
4: 845
Right 1130060741 15:80568131-80568153 GTTCCATCAAATATGGAATGAGG 0: 1
1: 0
2: 0
3: 8
4: 217
1130060738_1130060741 -7 Left 1130060738 15:80568115-80568137 CCTTGCTTTTTTTCCTGTTCCAT 0: 1
1: 0
2: 10
3: 453
4: 6188
Right 1130060741 15:80568131-80568153 GTTCCATCAAATATGGAATGAGG 0: 1
1: 0
2: 0
3: 8
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130060741 Original CRISPR GTTCCATCAAATATGGAATG AGG Intronic
901160132 1:7170897-7170919 GTTCCAGCAAATATGGAACATGG + Intronic
901732627 1:11291305-11291327 ATGCTATGAAATATGGAATGGGG + Intronic
902936904 1:19771023-19771045 GTTTCCTCAACTATGAAATGGGG + Intronic
904640231 1:31921201-31921223 GTTACAACATATAAGGAATGAGG + Intronic
904885256 1:33732930-33732952 GTTCCCTCAGCTATGAAATGAGG - Intronic
905291862 1:36927248-36927270 GTTGCATCAAAAATGAAACGTGG - Intronic
905649589 1:39647339-39647361 GTTCCAGAAAACATGGAAAGTGG - Intergenic
908643284 1:66248905-66248927 GTTTCATCATCTATGGAGTGGGG - Intronic
911392371 1:97262293-97262315 GTTTCCTCATATATGAAATGAGG + Intronic
914577081 1:148982688-148982710 GTTACTTTAAATATGGAATTTGG + Intronic
917474114 1:175353586-175353608 GTTTCATCACCTGTGGAATGGGG + Intronic
918160760 1:181897137-181897159 GTTTCATCAAATGTAAAATGGGG - Intergenic
918191443 1:182178697-182178719 GGTCCTTAAAATATGGAAGGTGG + Intergenic
919148781 1:193668571-193668593 ATTCCATAAAATATGGAACCAGG + Intergenic
920405995 1:205711499-205711521 GTTACATCAAAGATTTAATGGGG - Intergenic
921986468 1:221317953-221317975 GTTCCATCATAGATGGGAAGTGG + Intergenic
922489331 1:226002941-226002963 CTTCCATCCAATAAGGAAGGAGG - Intergenic
923169542 1:231401268-231401290 GTTACCTCAATTATAGAATGAGG + Intronic
1064127745 10:12678558-12678580 GTTCCATCCATTATTGAAAGTGG + Intronic
1064358351 10:14640222-14640244 GTTCCATCACATATGCTTTGTGG - Intronic
1067707206 10:48616444-48616466 CTTTCATCAAATTTGGAAAGTGG - Intronic
1067982609 10:51104010-51104032 GTTCTATGAAATATCAAATGTGG - Intronic
1068128513 10:52869232-52869254 GTTACTTCACATATAGAATGGGG - Intergenic
1071544677 10:86520859-86520881 CTTCCATTAAAGATGGAAAGCGG + Intronic
1072777533 10:98214319-98214341 ATTCCATGAGATATGGCATGTGG + Intronic
1074595645 10:114863946-114863968 GTTCTATCAAGTAAAGAATGCGG - Exonic
1076662750 10:132066341-132066363 GTTCCATCCCATATGTAAAGCGG + Intergenic
1082699648 11:56411572-56411594 TTTGCATCAACTATGGATTGAGG + Intergenic
1082907953 11:58333281-58333303 GTGACATCAAATATGGAGGGTGG - Intergenic
1087688251 11:101289663-101289685 GTTCCATCCATTATCGAAAGTGG + Intergenic
1088574743 11:111259615-111259637 TTCCCTTTAAATATGGAATGTGG - Intronic
1089098802 11:115942496-115942518 ATTCCATCAAAAGTGGAATAGGG + Intergenic
1089339597 11:117748581-117748603 GTTCCAGCAGGTGTGGAATGCGG + Intronic
1090247293 11:125225444-125225466 GTTTCTTCAAATGTGAAATGAGG + Intronic
1090704072 11:129320801-129320823 GTTGCCTCAACTATGAAATGAGG + Intergenic
1091164801 11:133465750-133465772 GTTACCTCAACTATGAAATGGGG + Intronic
1091631595 12:2165097-2165119 GTTCCATAATTTATGGAATTGGG + Intronic
1093047324 12:14463477-14463499 TTACAATCAAATAGGGAATGTGG + Intronic
1097822849 12:64145170-64145192 CTTCCATCAAACAAGGAATATGG - Exonic
1098825917 12:75297151-75297173 CTTCAAAGAAATATGGAATGAGG + Intronic
1099672525 12:85712624-85712646 GTTCCATCAAATAGTGGCTGAGG - Intergenic
1102326708 12:111991908-111991930 GCTACATCACATATGAAATGAGG - Intronic
1104410429 12:128553390-128553412 GTTACATAAGATATGGAATATGG - Intronic
1105703070 13:22948338-22948360 GTTCCACCAAATAGGCAATCTGG + Intergenic
1105849264 13:24319873-24319895 GTTCCCTCACATATGGAACTAGG - Intronic
1105855768 13:24370820-24370842 GTTCCACCAAATAGGCAATCTGG + Intergenic
1106481091 13:30137315-30137337 GTTTGCTCAAATGTGGAATGAGG + Intergenic
1107194666 13:37635345-37635367 GTTTCATCATATGTGAAATGGGG + Intergenic
1107276176 13:38681860-38681882 GTTTCCTCTAATATGAAATGAGG + Intergenic
1108426152 13:50302805-50302827 GTTCCATCAAATATTGAGAAAGG - Intronic
1110313933 13:74083210-74083232 ATTCCATCAAAGATGTATTGAGG + Intronic
1110884097 13:80611040-80611062 CCTCCATCAGATCTGGAATGAGG - Intergenic
1111349433 13:87006961-87006983 GTTCTCTCAAAAGTGGAATGTGG + Intergenic
1111694192 13:91602947-91602969 ATTCAAACAAATATGGATTGAGG - Intronic
1113117925 13:106893289-106893311 GTTCCATAAATTAAGGAATATGG - Intergenic
1115587287 14:34827342-34827364 GTTCCATCCATTATGGAAGATGG + Intronic
1118425460 14:65655706-65655728 CTTCCATCAATTATTGAAAGAGG - Intronic
1118545968 14:66889165-66889187 GTTCTATCCATTATTGAATGTGG - Intronic
1120531336 14:85635225-85635247 GTTTCCTCATATATGAAATGAGG + Exonic
1121022341 14:90587904-90587926 GTTTCTTCACCTATGGAATGGGG + Intronic
1125468125 15:39975189-39975211 GTTCCCTCATCTAGGGAATGAGG - Intronic
1125588646 15:40840389-40840411 CTGTCATCAAATATGGTATGTGG + Intergenic
1129647237 15:77447614-77447636 GTACCATCACATAAGGAATTTGG + Intronic
1130060741 15:80568131-80568153 GTTCCATCAAATATGGAATGAGG + Intronic
1131140600 15:89973988-89974010 GTTAAATAAAACATGGAATGTGG - Intergenic
1131865558 15:96704943-96704965 CTGCCATCAAATATGGAGTCGGG + Intergenic
1132063252 15:98710027-98710049 GTTTCTTCATATGTGGAATGGGG + Intronic
1134535368 16:15022226-15022248 GTTCCCTCAATTATAAAATGGGG - Intronic
1135264578 16:21011952-21011974 GTTCCCTCAATTATAAAATGGGG - Intronic
1140739620 16:77929742-77929764 GTTTCATCAAATATAAAATGGGG - Intronic
1143007570 17:3846628-3846650 GTTTCCTCATATATGAAATGGGG - Intergenic
1147110987 17:38261325-38261347 GTTTCCTCAAATGTGAAATGGGG - Intergenic
1148418523 17:47527115-47527137 GTTTCCTCAAATGTGAAATGGGG + Intronic
1148861466 17:50606549-50606571 GTTTCTGCAAATATGGAGTGAGG - Intronic
1149058264 17:52390521-52390543 GTTCCCACATATATGGATTGTGG + Intergenic
1149824435 17:59814627-59814649 GTTCCCTCATCTATGAAATGTGG - Intronic
1151755514 17:76073234-76073256 GTTCCTTCATCTATGAAATGGGG + Intronic
1153908651 18:9686955-9686977 GTTCCTTGAATTATGGAATTGGG + Intergenic
1157033924 18:43948125-43948147 GTTCCATCAAATAAGGTATATGG + Intergenic
1158350646 18:56561954-56561976 GTTTGATCAACTGTGGAATGAGG + Intergenic
1163560742 19:18017929-18017951 CTTCTATCAAACATGAAATGAGG + Intergenic
1164761585 19:30732316-30732338 CATCTATTAAATATGGAATGGGG + Intergenic
1167645217 19:50702131-50702153 GTTCCTTCAACCATGCAATGGGG + Intronic
925548184 2:5041127-5041149 GTCCAATAAAATATGGGATGGGG - Intergenic
925626495 2:5846592-5846614 GTTCCATTAGACATGGATTGAGG + Intergenic
929412955 2:41717496-41717518 GTTTCTTCAAATATGGACTGGGG - Intergenic
930288450 2:49464664-49464686 GATCCATCCAATGTGGAAAGTGG + Intergenic
930766487 2:55090612-55090634 ATTCCATGAAATATGGAGTAGGG + Intronic
931144655 2:59504173-59504195 GTACCATTAAAAATGGCATGGGG - Intergenic
931632689 2:64315649-64315671 CTTCCACCAAATGTGGGATGGGG - Intergenic
932006288 2:67930465-67930487 GTTTCCTCATTTATGGAATGTGG - Intergenic
932012171 2:67989444-67989466 GTACCATCACATTTGGAATTGGG + Intergenic
933707287 2:85301323-85301345 GTTCCCTCATCTCTGGAATGGGG + Intronic
935392985 2:102572884-102572906 GTCCTATCAAATATTTAATGAGG - Intergenic
935450855 2:103207397-103207419 TTTCAATCAAATATAGAGTGAGG - Intergenic
938509297 2:131924155-131924177 GTTCTTTCATATATGCAATGGGG - Intergenic
938747868 2:134297358-134297380 CTTCCATGAAATATAGAAGGAGG + Intronic
940006663 2:149014589-149014611 GTTTCCTCATATATGAAATGGGG + Intronic
940016192 2:149107921-149107943 GTTCTATCAATTATTGAAAGAGG + Intronic
940622145 2:156125461-156125483 CTTCCATCATACATGGAAGGAGG + Intergenic
941552132 2:166929646-166929668 ATACTATCAAATATGGAATAAGG - Intronic
941739847 2:169023882-169023904 GTTCCAGCAAGTATGGCATAGGG + Intronic
943171034 2:184400505-184400527 TTTCCATCAAACATTAAATGTGG - Intergenic
943398915 2:187379780-187379802 GTCCCCTCATATATGAAATGAGG - Intronic
944021909 2:195115196-195115218 GTTACATCCAAGATGAAATGGGG - Intergenic
945923403 2:215779114-215779136 CTTCCATCAAAATTGGGATGTGG - Intergenic
945924790 2:215792155-215792177 GATAAATCAAATATGGAATATGG - Intergenic
947458047 2:230274460-230274482 GGTCCATCAACTAAAGAATGTGG + Intronic
948623181 2:239249473-239249495 GTTCCATCAAATCTGCATTTTGG - Intronic
1168876331 20:1174683-1174705 GTTTCATCATCTATAGAATGGGG - Intronic
1169626885 20:7581086-7581108 GTTCCATTACCTATGGAATGAGG - Intergenic
1170216143 20:13893583-13893605 GTTCTATTTAATATTGAATGTGG - Intronic
1173015034 20:39217083-39217105 GTTTAATCAAATAGGAAATGAGG + Intergenic
1173944886 20:46942695-46942717 GTCCCATCATCTATGAAATGAGG + Intronic
1176784187 21:13234391-13234413 GTTCTCTCATATATGCAATGGGG + Intergenic
1176926504 21:14756403-14756425 GTTCTATCAATTATTGAGTGTGG - Intergenic
1177304109 21:19290175-19290197 GTTCCAGCAAATAAACAATGAGG - Intergenic
1177982228 21:27928238-27928260 GTTCTCTCATATATGCAATGGGG + Intergenic
1179020453 21:37635903-37635925 TTTCCAACAAAAATGGAATTAGG - Intronic
1179996072 21:44975010-44975032 GTTTCATCAAAGATGGAGTTTGG + Intronic
1182963889 22:34503839-34503861 GTTCCCTCAAATACAAAATGAGG + Intergenic
1183896369 22:40972553-40972575 GTTCCATCCAATTTGTAATTAGG - Exonic
949920784 3:8998842-8998864 GTTCCCTCATCTATGAAATGAGG - Intronic
951256868 3:20460045-20460067 ATTTCTTCAACTATGGAATGAGG - Intergenic
952616005 3:35274909-35274931 GTTCTATCAATTATTGAATTAGG - Intergenic
954589336 3:51767939-51767961 GTTCTATCAATTATTGAAAGAGG + Intergenic
954601539 3:51874408-51874430 GGTCCATGGAAAATGGAATGAGG - Intronic
955147306 3:56332574-56332596 TTTCCATCAAATATGGGAGTGGG + Intronic
955691713 3:61597442-61597464 TTTCCATCAAATATGCAGTCAGG - Intronic
956033976 3:65070197-65070219 GTTCCATCAAAAAGGAAGTGAGG + Intergenic
956042229 3:65156505-65156527 GTTCCATCCCATATTGTATGAGG - Intergenic
957409064 3:79814057-79814079 GTTGCATAAAATATGAAATGGGG + Intergenic
959707774 3:109355196-109355218 GTTCCCTTAAATAAGTAATGAGG + Intergenic
966302208 3:178492301-178492323 GTTTCCTCATATGTGGAATGAGG - Intronic
969325715 4:6442712-6442734 GTTCCTTCATCTATGAAATGGGG - Intronic
970322976 4:14893816-14893838 GTTCCTTCAACTATAAAATGAGG - Intergenic
970481084 4:16475881-16475903 GTTCTATCAACTATAGAAAGAGG - Intergenic
973806019 4:54526981-54527003 GTACCTTCATCTATGGAATGGGG - Intergenic
976609815 4:87018882-87018904 GAGCCATCAAATAAGGGATGTGG + Intronic
977125881 4:93167258-93167280 GAGCCATCAAACAAGGAATGGGG - Intronic
978017088 4:103757780-103757802 AAACCATCAAATATAGAATGTGG + Intergenic
979230478 4:118343437-118343459 TTTCCTTCACATATGGAATATGG - Intronic
979960000 4:127007373-127007395 GTTCCAGCATATGTGGCATGTGG - Intergenic
982263749 4:153519545-153519567 TTGCCATCACATATAGAATGTGG + Intronic
982487491 4:155984499-155984521 TTTTCATCATTTATGGAATGGGG + Intergenic
983560709 4:169098680-169098702 GTTTGATCAAGCATGGAATGAGG + Intronic
986535068 5:8778121-8778143 GTTGCATAAAAAATGGAATATGG - Intergenic
986795383 5:11205651-11205673 TTTCCATAAAATATGAACTGAGG + Intronic
989518552 5:42373791-42373813 CTTCCATCTAAAATGTAATGTGG - Intergenic
990084864 5:51963271-51963293 GTACCATCTAATAAGGAATTAGG + Intergenic
991146220 5:63308188-63308210 GTTCCAACATTTATGAAATGAGG + Intergenic
994165530 5:96604316-96604338 GTTCCATCATGTCTGGAATAAGG + Intronic
994274440 5:97818949-97818971 GTTCCAACAAATAGAGAAAGAGG - Intergenic
996851110 5:127953537-127953559 GTTCCATCAATTGTTGAAAGAGG - Intergenic
997217589 5:132126986-132127008 GATCCATCTAATATTGAAAGTGG + Intergenic
999692613 5:154161656-154161678 GTTCCTGAAAATATGGACTGGGG + Intronic
1000028341 5:157379726-157379748 ATTCCATCAAATATTTAAGGAGG + Intronic
1001061444 5:168493190-168493212 GTTACATCAAATATTTAATTGGG - Intronic
1002884168 6:1279142-1279164 GTTTCATTAAATATGGAACAGGG - Intergenic
1003029598 6:2590180-2590202 GTCCCATCAAAAATGGAGAGAGG - Intergenic
1003842130 6:10132546-10132568 GTTCTATCAATTGTTGAATGTGG - Intronic
1004829439 6:19461760-19461782 CTTCCATCAAATATTAATTGAGG - Intergenic
1005622475 6:27632724-27632746 GTTCCCTGACCTATGGAATGAGG - Intergenic
1006624980 6:35391381-35391403 AATCCAACAGATATGGAATGTGG - Intronic
1009974905 6:70662159-70662181 GTTCCATGAAATATTGAGGGAGG - Intergenic
1011288029 6:85745375-85745397 GTTACTTCAAATATACAATGGGG - Intergenic
1012333678 6:98026751-98026773 ATTGCATCAAATAAAGAATGAGG - Intergenic
1012639620 6:101592933-101592955 GTTCCAGCAAATAATTAATGTGG - Intronic
1012847036 6:104403489-104403511 GTTCCATGAATCAAGGAATGTGG - Intergenic
1014578446 6:123104256-123104278 GTTTCATCCACTATGGAAAGTGG - Intergenic
1014700133 6:124676395-124676417 GTTCTATCCATTATTGAATGTGG + Intronic
1015181067 6:130363546-130363568 GTTCAATCACATATGTATTGAGG + Intronic
1016059554 6:139615594-139615616 GTTCTATCAAATATTGAGAGAGG + Intergenic
1016202101 6:141424275-141424297 GGTCTATCACTTATGGAATGAGG + Intergenic
1020730256 7:11870507-11870529 GTTACTTCAAAGATGCAATGGGG - Intergenic
1023269139 7:38441295-38441317 GTTCTTTCAATTATTGAATGAGG - Intronic
1023910365 7:44551111-44551133 GTTCCATCAATTATTGAAAATGG - Intergenic
1030005675 7:105117316-105117338 TTTCCATTAAATATGGGAGGGGG - Exonic
1030267824 7:107638553-107638575 GCTCCATCAAGTGTGGAATTGGG - Intergenic
1030787223 7:113676691-113676713 ATACCATGAAATATGGAATATGG + Intergenic
1032903258 7:136335249-136335271 AATCCATCAAATATAGTATGTGG - Intergenic
1033501975 7:141960489-141960511 GATCCATCAAATATGGTAAAGGG + Intronic
1034737854 7:153445785-153445807 GATTCATCACAGATGGAATGAGG + Intergenic
1036105909 8:5838794-5838816 TTTCCAGCAAACATTGAATGTGG + Intergenic
1036531001 8:9587291-9587313 GTTCCCTAAACTAAGGAATGGGG + Intronic
1037575072 8:20194808-20194830 GTAACCTCAGATATGGAATGGGG - Intergenic
1037693385 8:21202927-21202949 ATTCCAAAAAATAGGGAATGAGG - Intergenic
1038882436 8:31629058-31629080 GTGCCATCATTGATGGAATGGGG + Intergenic
1040770562 8:50970237-50970259 GCTTCATCAAATGAGGAATGAGG - Intergenic
1042166921 8:65954787-65954809 TTTCTATCATACATGGAATGGGG - Intergenic
1043529802 8:81136865-81136887 GTTCCTTAAAATATTTAATGGGG - Intergenic
1044343340 8:91072443-91072465 TTTCTATCAAAGATGGAGTGAGG - Intronic
1046544334 8:115629670-115629692 CTTTAATTAAATATGGAATGTGG + Intronic
1047427056 8:124756085-124756107 GTTTCCTCAATTATAGAATGGGG + Intergenic
1048563997 8:135574931-135574953 GTTTCCTCAACTATGAAATGAGG - Intronic
1048598017 8:135887266-135887288 GGTCCATCAAATAAAGCATGTGG + Intergenic
1048997429 8:139802523-139802545 GTTCCTTCAACTTTGAAATGAGG + Intronic
1048998982 8:139812834-139812856 GTTTCCTCAACTATGGAATGGGG + Intronic
1050983635 9:12054010-12054032 GTGACATCAAAAATAGAATGTGG - Intergenic
1055206871 9:73742088-73742110 CTACCATAAAATATGGAATTTGG - Intergenic
1055598512 9:77890755-77890777 ATTCCATCAAAAATGCATTGAGG + Intronic
1055911427 9:81356790-81356812 GTTCCAAAAAATAGGGAAGGAGG + Intergenic
1056130867 9:83585215-83585237 GCTCCATTTCATATGGAATGAGG - Intergenic
1057056760 9:91968594-91968616 TTTCTATCAATTATTGAATGAGG - Intergenic
1057167496 9:92940480-92940502 GTTCCATCCAAGAGGGAATTGGG - Intergenic
1058006208 9:99918053-99918075 ATTCCATCCAAGCTGGAATGTGG - Intronic
1058151275 9:101466034-101466056 GTTGCATCATCTATGGAAAGAGG + Intergenic
1059229514 9:112705890-112705912 GTTTGATCAAATAGGCAATGGGG + Intronic
1186444154 X:9611830-9611852 GTTCCCTCACATATAAAATGGGG - Intronic
1187193856 X:17062225-17062247 GTTTCATCACATGTGAAATGGGG + Intronic
1187922774 X:24221608-24221630 GTTCCTTCATATTTGGTATGTGG + Intergenic
1188556538 X:31418378-31418400 ATACCATCATATATGGAATTAGG + Intronic
1189175454 X:38952527-38952549 GTTTCTTCATCTATGGAATGGGG + Intergenic
1190377250 X:49800627-49800649 GTTCTATCAATTATTGAAAGAGG - Intergenic
1191925957 X:66310152-66310174 GATCCATCTAATATGGACAGTGG - Intergenic
1193636480 X:83956218-83956240 GATCCATCTAATATTGAAAGTGG - Intergenic
1193732746 X:85120955-85120977 ATGCCGTCAAATATGGAAAGAGG + Intergenic
1193981431 X:88186032-88186054 GTTCCATCCAAGATACAATGTGG - Intergenic
1194374936 X:93120829-93120851 GCTCCATCAAGTATGGAATCAGG + Intergenic
1197040506 X:121930411-121930433 GTTCCTTCCAAGATGCAATGAGG - Intergenic
1197040679 X:121932121-121932143 GTTCCTTCCAATATACAATGGGG + Intergenic
1198134924 X:133739470-133739492 GTTGCTTCAACTATAGAATGGGG - Intronic
1198661496 X:138973505-138973527 GGTCCATTTAATCTGGAATGTGG + Intronic
1199039033 X:143088672-143088694 GGTCCATGAAAAATGGAATTTGG + Intergenic
1201629151 Y:16050245-16050267 GTGCCATCAAATATTTGATGTGG + Intergenic
1201992329 Y:20041628-20041650 CTTGCATAAAATATGGAAGGTGG + Intergenic