ID: 1130060905

View in Genome Browser
Species Human (GRCh38)
Location 15:80569305-80569327
Sequence GTTGTAGCCCAGCTAATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130060900_1130060905 12 Left 1130060900 15:80569270-80569292 CCGCACTTGATGCATTCACTTTC 0: 1
1: 0
2: 0
3: 15
4: 218
Right 1130060905 15:80569305-80569327 GTTGTAGCCCAGCTAATGGAGGG 0: 1
1: 0
2: 3
3: 6
4: 87
1130060899_1130060905 23 Left 1130060899 15:80569259-80569281 CCGGCAGGAAGCCGCACTTGATG 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1130060905 15:80569305-80569327 GTTGTAGCCCAGCTAATGGAGGG 0: 1
1: 0
2: 3
3: 6
4: 87
1130060898_1130060905 28 Left 1130060898 15:80569254-80569276 CCTCGCCGGCAGGAAGCCGCACT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1130060905 15:80569305-80569327 GTTGTAGCCCAGCTAATGGAGGG 0: 1
1: 0
2: 3
3: 6
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130060905 Original CRISPR GTTGTAGCCCAGCTAATGGA GGG Intronic
903705113 1:25279986-25280008 GCGGGAGCCCAGATAATGGATGG + Intronic
903722112 1:25413335-25413357 GCGGGAGCCCAGATAATGGACGG - Intronic
905792569 1:40798013-40798035 GATTTGGCCCAGATAATGGAGGG + Intronic
911869751 1:103081039-103081061 TTATTAGCCCAGCCAATGGATGG - Intronic
912552608 1:110494015-110494037 GTTCTAGGCCAGCTAGGGGAGGG - Intergenic
917989678 1:180361061-180361083 GTTTTAGCCCAGCAAATGGGGGG - Intronic
919523760 1:198621747-198621769 GATGTAAAACAGCTAATGGAGGG - Intergenic
922991241 1:229913682-229913704 GTTGGAGCCCTGCCAATGGTGGG + Intergenic
923317346 1:232793685-232793707 CTTGTAGCCATCCTAATGGATGG + Intergenic
923562475 1:235051704-235051726 ATCGTAGCCCAGCACATGGAAGG - Intergenic
1063519540 10:6728396-6728418 GTTGTAACCCAGGTAAGAGATGG + Intergenic
1072806274 10:98425674-98425696 GTTCTGTCCCAGCTGATGGATGG - Exonic
1073816991 10:107218440-107218462 GTTGTTGCCCAGCTGCTGGGAGG + Intergenic
1074531883 10:114303907-114303929 ATTGTAGCCCAGCGATTGGCTGG + Intronic
1074717925 10:116236737-116236759 GTTGTACCCCAGCTTTTGGGGGG - Intronic
1078630524 11:12999660-12999682 GTTGTTACCCAACTAATGAAAGG - Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1089539646 11:119182122-119182144 GGTGTTGCCGTGCTAATGGAGGG + Exonic
1089598062 11:119594653-119594675 GTTGGGGCCCTGCAAATGGATGG + Intergenic
1099671235 12:85695712-85695734 GCTGCAGGCCAGCAAATGGAGGG + Intergenic
1103124701 12:118411334-118411356 GTTGTAGTCAAGCGAATGTAAGG - Intronic
1103233541 12:119352497-119352519 GATGTTGCACTGCTAATGGATGG + Intronic
1104283940 12:127405805-127405827 GTTCCAGCCCAGCTCATGAAGGG + Intergenic
1106185858 13:27408988-27409010 TTTGTAGCCCAGCCAAAGGGTGG - Intergenic
1107654227 13:42574798-42574820 GTTGTTTCCCAGCGAAGGGACGG - Intronic
1114560071 14:23583363-23583385 AATGTTGCCCAGCTAATAGATGG + Intergenic
1118461280 14:65989345-65989367 GATGTTGCCCAGCAAATGGCTGG - Intronic
1120292003 14:82587005-82587027 CTTGTAGCTCAGTTTATGGATGG + Intergenic
1124625254 15:31304097-31304119 TTTCTAGCCCAGCTAAGGGATGG + Intergenic
1130060905 15:80569305-80569327 GTTGTAGCCCAGCTAATGGAGGG + Intronic
1132366674 15:101262783-101262805 GTAGTAGCCCAATGAATGGATGG - Intergenic
1141933978 16:87224288-87224310 GTTGTAGCACAATTATTGGATGG - Intronic
1142785448 17:2218423-2218445 CCTGTAGCCCAGCTACTCGAAGG + Intronic
1146677609 17:34784330-34784352 GGTGTAGACCAGATAATAGATGG + Intergenic
1147820125 17:43236541-43236563 GTTGTAGCTGAGATAATGTAGGG - Intergenic
1147821436 17:43243938-43243960 GTTGTAGCTGAGATAATGTAGGG - Intergenic
1147822235 17:43248423-43248445 GTTGTAGCTGAGATAATGTAGGG - Intergenic
1147823159 17:43253869-43253891 GTTGTAGCTGAGATAATGTAGGG - Intergenic
1147823528 17:43256012-43256034 GTTGTAGCTGAGATAATGTAGGG - Intergenic
1147823930 17:43258469-43258491 GTTGTAGCTGAGATAATGTAGGG - Intergenic
1147824201 17:43260070-43260092 GTTGTAGCTGAGATAATGTAGGG - Intergenic
1147824688 17:43262908-43262930 GTTGTAGCTGAGATAATGTAGGG - Intergenic
1147825845 17:43269392-43269414 GTTGTAGCTGAGATAATGTAGGG - Intergenic
1147827017 17:43276174-43276196 GTTGTAGCTGAGATAATGTAGGG - Intergenic
1147827865 17:43280734-43280756 GTTGTAGCTGAGATAATGTAGGG - Intergenic
1147828973 17:43286894-43286916 GTTGTAGCTGAGATAATGTAGGG - Intergenic
1147830069 17:43293037-43293059 GTTGTAGCTGAGATAATGTAGGG - Intergenic
1147831012 17:43298235-43298257 GTTGTAGCTGAGATAATGTAGGG - Intergenic
1147834904 17:43323102-43323124 GTTGTAGCTGAGATAATGTAGGG + Intergenic
1148223682 17:45883086-45883108 GATGTAACCCAGTTAATGAAGGG + Intergenic
1152072015 17:78138678-78138700 GTGGGAGCCCAGGTAGTGGAGGG - Exonic
1155516799 18:26631728-26631750 GTTGTAGTGCATTTAATGGAGGG - Intronic
1155735871 18:29221622-29221644 GTTGTAGCCCAGGGAGTGAATGG + Intergenic
1158624088 18:59056819-59056841 GGTGTGGCACAACTAATGGATGG + Intergenic
928031877 2:27786956-27786978 GTTGTAGCCCTGAGAATGAAGGG - Intronic
934110560 2:88738393-88738415 GCTGTAGTCCAGCTCCTGGAAGG - Intronic
935305336 2:101731626-101731648 GGTGTACACCAGCTACTGGAGGG + Intronic
1169105868 20:2994011-2994033 TTTGCAGGCCAGCTGATGGAAGG - Intronic
1172906972 20:38377682-38377704 GTTGTCGCCCAGCTGGTGGCAGG + Intergenic
1178833693 21:36078123-36078145 TAAGTAGCCCAGCTAATGGAAGG - Intronic
1180585074 22:16880958-16880980 CTTGTAGCCCAGCTACTTGGAGG + Intergenic
1182487482 22:30648032-30648054 ATGGTAGCCCAGCCAGTGGAGGG - Intronic
1185153397 22:49179302-49179324 GACGCAGCCGAGCTAATGGATGG - Intergenic
952659970 3:35833729-35833751 GTTGTTGCCCATCTGATGAATGG + Intergenic
955960433 3:64335037-64335059 GTTGTGCTCTAGCTAATGGAAGG - Intronic
960381095 3:116962751-116962773 GTTGGAGAACAGCTAATAGATGG + Intronic
976011096 4:80489516-80489538 GATGTAGCCCAGATAGAGGAAGG - Intronic
982576915 4:157123906-157123928 GTTTTAGGTCAGCTAATGCAAGG + Intronic
982738789 4:159036296-159036318 CTTGTAGCCCAGCTGGAGGAAGG + Intronic
986730148 5:10629243-10629265 GTGGTAGCCCAGGTCAGGGATGG + Intronic
987824798 5:23016739-23016761 ACTGTAGCCCATCTATTGGAGGG - Intergenic
990546987 5:56832562-56832584 GTGGTAGCACAGCTAGTGGGTGG + Intronic
996453522 5:123655107-123655129 ATTGAGGCCCAGCTCATGGACGG + Intergenic
1000130650 5:158294670-158294692 GTTGTTGCCATGCTAATGAATGG - Intergenic
1007722634 6:43894366-43894388 GTTGTACCCCAACCGATGGAGGG + Intergenic
1009542740 6:64984138-64984160 ATTGTAGACCAACTAATGAAAGG + Intronic
1011733372 6:90289302-90289324 GGTGTCGCTCAGCTAATGAATGG - Intronic
1016864398 6:148750825-148750847 GTTGTTGTCCAGCTCAGGGAGGG - Intronic
1017039328 6:150295150-150295172 GTTGGAGCCCAGCTATGGGAAGG + Intergenic
1020698092 7:11441402-11441424 GAGGTAGCCCAGCTTATGCAAGG - Intronic
1021378667 7:19939974-19939996 GTTGTAGCCCTCCCACTGGAGGG - Intergenic
1022325810 7:29331230-29331252 GTTGAAGAGCAGTTAATGGAGGG + Intronic
1033681839 7:143602870-143602892 GTTGCGGCCCAGCTCATGGACGG - Intergenic
1033686125 7:143642859-143642881 GTTGTGGCCCAGCTCATGGATGG + Intronic
1033689613 7:143724456-143724478 GTTGTGGCCCAGCTCATGGATGG - Exonic
1033698488 7:143814762-143814784 GTTGTGGCCCAGCTCATGGATGG - Intergenic
1033703050 7:143859043-143859065 GTTGCGGCCCAGCTCATGGACGG + Exonic
1042816480 8:72882993-72883015 GGTGTAGCCCCGGGAATGGAGGG - Intronic
1048978323 8:139688202-139688224 GCTGTACCCCAGCTAATAAAAGG + Intronic
1055471660 9:76617836-76617858 GTGGAAGCCCAGCCAATGGCTGG - Intronic
1055682006 9:78724872-78724894 GTGGTAGCCCTGCCACTGGAGGG - Intergenic
1060377948 9:123135117-123135139 GTGGTAACACAGCTAATTGATGG - Intronic
1190959857 X:55235134-55235156 GGTGCAGCCCAGCCCATGGAGGG - Intronic
1194369197 X:93049732-93049754 ATTGAAGCCCAGCTAATGAGGGG - Intergenic
1195654384 X:107321007-107321029 GCTGCAGCCCCGCAAATGGATGG + Intergenic
1200677401 Y:6166063-6166085 ATTGAAGCCCAGCTAATGAGGGG - Intergenic
1200906241 Y:8485565-8485587 GTTGCAGGTGAGCTAATGGAAGG - Intergenic