ID: 1130061624

View in Genome Browser
Species Human (GRCh38)
Location 15:80574551-80574573
Sequence GGGAAATGGCCAAGAAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 300}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130061624 Original CRISPR GGGAAATGGCCAAGAAGCCA AGG (reversed) Intronic
901292494 1:8135063-8135085 GGGAAATGGGAAAGCAGACAGGG - Intergenic
902724044 1:18323526-18323548 AGGAAATGGCCAAGGAGCTAAGG + Intronic
903777277 1:25800770-25800792 GGAACAGGGCCAAGCAGCCAGGG + Intronic
904968834 1:34402970-34402992 GGGAAATAGGCAAGAAGACAAGG + Intergenic
905477847 1:38241557-38241579 AGGACATGGACAAGAGGCCATGG - Intergenic
905805021 1:40870095-40870117 GGGAATTGGTCAAGCAGACATGG + Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
905875335 1:41428454-41428476 GAGAAACAGCAAAGAAGCCAGGG - Intergenic
907353749 1:53855065-53855087 AGGAAATTGCCAAGTAGACAAGG + Intronic
907368199 1:53979908-53979930 GGGAGAGTCCCAAGAAGCCAAGG + Intergenic
907604832 1:55806044-55806066 GTGAAATAGGCAGGAAGCCATGG + Intergenic
908083647 1:60607624-60607646 GGGAAATGTGCAGGAAGGCAGGG - Intergenic
909780723 1:79543104-79543126 GGGGAAAGGCCAAAAAACCAAGG - Intergenic
910302033 1:85716925-85716947 GGGAGTTGGCCAGGAAGACAGGG + Intergenic
913575739 1:120172589-120172611 TGGAAATGCTCAAGAAACCATGG + Intronic
914558053 1:148788161-148788183 TGGAAATGCTCAAGAAACCATGG + Intergenic
914614781 1:149342069-149342091 TGGAAATGCTCAAGAAACCATGG - Intergenic
917008009 1:170437066-170437088 GGAACATGGCCATGAACCCAAGG + Intergenic
917850350 1:179057846-179057868 GGGAGGTGGCCAAGAAGTTATGG + Intronic
917871152 1:179243178-179243200 GAGAAATGGGCAAGAAGAAAGGG - Intergenic
918314593 1:183312643-183312665 GGCAAATGGCCTAGAAGTCTGGG + Intronic
919184040 1:194120915-194120937 AAGAAATGGGCAAGAAGACAGGG - Intergenic
920383327 1:205548632-205548654 GGCAAAGGGACAAGAAGACAAGG + Intergenic
920966310 1:210704258-210704280 CTGAAATGGCCAGGAAGTCAAGG - Intronic
921352776 1:214254550-214254572 GCCAAAAGGCCGAGAAGCCATGG + Intergenic
922660991 1:227430190-227430212 GGGAAAAAGACAAGTAGCCAAGG + Intergenic
922698015 1:227741372-227741394 GGGTAGTGGCCAGGGAGCCAGGG + Intronic
924174704 1:241378652-241378674 GGGAAATGGAAGAGAAGCAAGGG + Intergenic
1063254681 10:4313714-4313736 GGGAATTGACAAAAAAGCCATGG + Intergenic
1064485358 10:15783006-15783028 CGGATATGGCCAGGAAGACAAGG - Intronic
1065141472 10:22722706-22722728 GCCAAAAGGCCAAGAAGCAAAGG + Intergenic
1066232420 10:33449293-33449315 AGGAAATGGCCAAGGAGGTAGGG - Intergenic
1070365442 10:75732569-75732591 GGGGGATGGTCAAGAACCCAGGG - Intronic
1070748131 10:78947480-78947502 GGGAAATAGCCAAGCAGCCCTGG - Intergenic
1071568874 10:86685648-86685670 GGAAAAGGGCAAAGAAGACAGGG - Intronic
1071673877 10:87637108-87637130 GGGAAATCCCCATGAAGCCATGG + Intergenic
1072201096 10:93159500-93159522 GGGATATGAGCAAAAAGCCATGG + Intergenic
1072895030 10:99359425-99359447 ATGAAAAGGCCCAGAAGCCAGGG + Intronic
1073453851 10:103624884-103624906 GGGAAATGCCCAAGATGTGACGG + Intronic
1074548353 10:114419693-114419715 GGGAAGTGGGCAGGAAGCCTGGG - Intergenic
1075848001 10:125562128-125562150 GCCAAATGGCCAAGAAGCATAGG - Intergenic
1075962437 10:126580930-126580952 GAAAAATGGCCAAGAACACAGGG - Intronic
1076011264 10:126990821-126990843 GGGATAGAGTCAAGAAGCCAGGG + Intronic
1077072811 11:684806-684828 GGGAAACAGCCGAGAGGCCAAGG + Intronic
1078094428 11:8288030-8288052 GGGAAGTAGCAAATAAGCCAGGG - Intergenic
1078101812 11:8334494-8334516 GGGAGCTGGCCCAGGAGCCAAGG - Intergenic
1078451831 11:11446324-11446346 GGAAAATGGAAAGGAAGCCAAGG - Intronic
1078678294 11:13448556-13448578 GGGAAATGAAAAAGAAGTCAAGG - Intronic
1079569233 11:21922047-21922069 TGGTTATGGCCAAGAAGACAAGG - Intergenic
1080262965 11:30369794-30369816 GGGAAAATGTCAAGAAGTCACGG + Intergenic
1080324833 11:31058536-31058558 CAGAAAAGGCCATGAAGCCAGGG + Intronic
1081606037 11:44527583-44527605 AAGAAATTGCCAAGAAGCAATGG - Intergenic
1081667304 11:44924003-44924025 GGGAAACTGGCAAGAAGCCGGGG - Intronic
1083731890 11:64656715-64656737 GGGATAGGGCAAAGAATCCAGGG + Intronic
1084054582 11:66624361-66624383 GGGACAAGACCAAGAAACCAGGG + Exonic
1084321725 11:68377116-68377138 GGGGAGTGGCCATGCAGCCATGG + Intronic
1085472412 11:76766752-76766774 AGGAAATGCACAAGCAGCCAGGG + Intergenic
1086843261 11:91716120-91716142 GGGAAGAGGCCAAAAAGTCAAGG - Intergenic
1086927156 11:92652807-92652829 GGGAAATGAGGAAGAAGCCAGGG - Intronic
1088597142 11:111449212-111449234 TGGAAATGGGCCAGAAGACAAGG - Intronic
1088885359 11:114001674-114001696 GGGAAATGGGGAGGGAGCCAAGG - Intergenic
1089525229 11:119092821-119092843 GGGAAATGGGCGGGAAGCCAGGG + Intronic
1090319284 11:125828182-125828204 GAGGAATGGGCAATAAGCCAAGG + Intergenic
1091556574 12:1577997-1578019 GGGAAATGCCCCTGAATCCACGG - Intronic
1091806719 12:3362164-3362186 GGGACATGTACAAGAAGCAAAGG + Intergenic
1091918651 12:4287175-4287197 GGGCAATGGAGAAAAAGCCAAGG + Intronic
1091989895 12:4946825-4946847 TGGAAAAGGCCAAGAAGGCCTGG + Intergenic
1093420586 12:18969674-18969696 GGGAAATGGAACAGAAGGCAAGG + Intergenic
1093532360 12:20182293-20182315 TGGAAATGAGTAAGAAGCCAAGG - Intergenic
1093605414 12:21082905-21082927 AGGAAACGGCCCAGAAGCCAAGG + Intronic
1094614310 12:32022538-32022560 GGGGAAAGGGCAAGAAGGCAGGG - Intergenic
1098594028 12:72250142-72250164 GGGAAAAGAGCAAGAGGCCAAGG + Intronic
1101250520 12:102929697-102929719 GAGAAATGGCCATGATGCCTTGG + Intronic
1102606999 12:114075527-114075549 TGAAAATGGCAAAGAACCCAAGG + Intergenic
1103061738 12:117863824-117863846 GGGGAAGGGGCCAGAAGCCAAGG - Intronic
1105284917 13:18995846-18995868 GGCAAAAGGCCAGAAAGCCAGGG + Intergenic
1105783638 13:23725977-23725999 GGGCAGTGGACAAGGAGCCAAGG + Intergenic
1109390527 13:61685565-61685587 GTGAAGTGGCCATGGAGCCAAGG - Intergenic
1111028391 13:82565226-82565248 GTGAAAGGGCCAAGAAGCCCTGG + Intergenic
1111783884 13:92763695-92763717 GTAAAATGTCCAAAAAGCCAAGG + Intronic
1111903592 13:94229963-94229985 GGGAAATGAACAGGAAGCCAGGG + Intronic
1112245520 13:97729973-97729995 GGGAAAGGGGCAACAAGGCAGGG - Intergenic
1112569712 13:100582642-100582664 AGGAAAGGGCCAATAAGCCAAGG + Intronic
1113205103 13:107907847-107907869 AGGAAAAGGCTAAGAAACCATGG - Intergenic
1113750370 13:112772826-112772848 TGCAAATGGCCAACAAGCCCAGG - Intronic
1114302931 14:21394313-21394335 GGCACATGGCCACAAAGCCATGG + Exonic
1116118025 14:40682340-40682362 GGGACATGGCCTGAAAGCCACGG - Intergenic
1117743610 14:58844884-58844906 GGGAAACTGCCAAGACCCCAGGG + Intergenic
1118818539 14:69329409-69329431 TAGAAATGGCCAATAAGCCTAGG + Intronic
1119169938 14:72527145-72527167 TGGTAATGGCCAAGACACCAGGG - Intronic
1119351202 14:73967186-73967208 GGGCAATGGCCAATGGGCCATGG - Intronic
1120275164 14:82363963-82363985 GGGAAGTGGCCAAAAATTCAGGG + Intergenic
1120324363 14:83006492-83006514 GGCCAGTAGCCAAGAAGCCAAGG + Intergenic
1121382879 14:93489794-93489816 GGGCAATGCCCAGCAAGCCATGG - Intronic
1121564107 14:94895797-94895819 GGTCACTGGCCAAGAAGCCACGG - Intergenic
1121912315 14:97802785-97802807 GGGAAATAGTCAAGAACCCTTGG + Intergenic
1121916876 14:97843525-97843547 GAGAAATGGCCAAGCAGCGTGGG - Intergenic
1122277562 14:100603012-100603034 GGGAAATGCCAAAGAAGGCTCGG - Intergenic
1122444861 14:101761221-101761243 GGGGCAAGGCCAAGAGGCCACGG + Intergenic
1125184390 15:36913985-36914007 AGGAAGTGGCCAAGAAACTATGG - Intronic
1125821205 15:42633395-42633417 GAAAAATGGGCAAGAAGGCATGG + Intronic
1126066094 15:44827512-44827534 GGGAAAAGGCAGAGAAGCCGTGG + Intergenic
1126093741 15:45073052-45073074 GGGAAAAGGCAGAGAAGCCGTGG - Intronic
1126136817 15:45400728-45400750 CAGAAATGGCCAAGAAGTAAAGG - Intronic
1126226364 15:46274833-46274855 GGGAAAAGGCTAAGAATCAAAGG + Intergenic
1127512352 15:59655487-59655509 GGGCAGTGTCCCAGAAGCCAAGG - Intronic
1128251169 15:66165297-66165319 GGGAAATGGAGGTGAAGCCACGG + Intronic
1128505849 15:68272121-68272143 GGGAAATGGCCTCAAGGCCAGGG + Intergenic
1128567720 15:68712089-68712111 GGGAAATGGCTAGGGTGCCAAGG + Intronic
1129343662 15:74902871-74902893 GGGACATGGACAGGAAGCCCTGG - Intronic
1130061624 15:80574551-80574573 GGGAAATGGCCAAGAAGCCAAGG - Intronic
1131417885 15:92276661-92276683 GGAAAGTGGGCAAGAGGCCATGG - Intergenic
1132288150 15:100680772-100680794 GGGAAATGGCTGAGACGCCAAGG - Intergenic
1132844577 16:1993904-1993926 GGGACTGGGCCAGGAAGCCAAGG - Exonic
1133576788 16:7099278-7099300 GGGAAATGGCTCAAAAACCAAGG + Intronic
1134588775 16:15434979-15435001 GGGAGATGGCCAGGCAGCTAAGG + Intronic
1135267428 16:21039650-21039672 GGGAAATGGCCCAGATTCCCAGG - Intronic
1135960559 16:26991422-26991444 CAGAAATGACCAAGTAGCCAAGG + Intergenic
1137932408 16:52601610-52601632 GGGACATGACACAGAAGCCACGG + Intergenic
1137961124 16:52883260-52883282 GGAAGATGGCCATGAAGCGAAGG + Intergenic
1137970007 16:52975543-52975565 TGGAAATGGGGCAGAAGCCAGGG - Intergenic
1138649904 16:58453979-58454001 GAGAAAGGGCCACAAAGCCAAGG - Intergenic
1139504408 16:67391905-67391927 GGCAAGGGGCCAGGAAGCCACGG - Exonic
1139955348 16:70690532-70690554 GGGGAGTGGCCCAGAAGCCAGGG + Intronic
1140927097 16:79593738-79593760 GGGAAACATGCAAGAAGCCAGGG + Intronic
1141093629 16:81147521-81147543 GGGAAAGGGGCCATAAGCCAAGG + Intergenic
1141149203 16:81552523-81552545 AGGAAGGGGCCAAGAAGCCAAGG - Intronic
1141508397 16:84496145-84496167 GGGAAAGGGCAAGAAAGCCATGG - Intronic
1141599018 16:85114095-85114117 GGGAGATGGCCATGCGGCCATGG + Intergenic
1141920887 16:87134609-87134631 GGGAAATGGTGAAGAAGCTCAGG - Intronic
1142746096 17:1959119-1959141 GGGAAGTGGCCAAGAGGCCTGGG - Intronic
1145085914 17:19939366-19939388 AGGCATTGGCCCAGAAGCCATGG - Intronic
1146503351 17:33383340-33383362 GGGATATTTCCAAGAAGACAAGG - Intronic
1149697108 17:58624699-58624721 GCCAAAAGGCCAAGAAGCGATGG - Intronic
1151140012 17:71982573-71982595 GAGAAATGGTAAAGTAGCCAAGG - Intergenic
1151356473 17:73561437-73561459 GAGTTGTGGCCAAGAAGCCATGG + Intronic
1151401190 17:73857101-73857123 GGGAGGAGGCCAGGAAGCCAGGG + Intergenic
1151682988 17:75631428-75631450 GGTAAGGGGCCGAGAAGCCAGGG - Exonic
1152009714 17:77704732-77704754 GGGAAATGGCACAGAGGACAGGG - Intergenic
1152065722 17:78111772-78111794 GGGAAATGGTCAAAGAGCGATGG - Exonic
1152119757 17:78411267-78411289 TGGAAAGGGCCCAGAAGCCATGG + Intronic
1152718257 17:81910269-81910291 AAGAAGTGGCGAAGAAGCCAGGG - Intronic
1152867342 17:82732177-82732199 GGGCAAAGGCCCAGGAGCCATGG + Intergenic
1153545986 18:6205237-6205259 GAGAAAGGGGCCAGAAGCCAAGG + Intronic
1153816771 18:8797525-8797547 AGCAGCTGGCCAAGAAGCCAGGG - Intronic
1156580207 18:38366301-38366323 GGAAAATAACCAAGAAGCTAAGG - Intergenic
1158375234 18:56856037-56856059 GAGGGATGGCGAAGAAGCCAGGG + Intronic
1158914366 18:62106813-62106835 GAGAAATGGCCAAGCTGCAAAGG + Exonic
1158946993 18:62455674-62455696 AGTACATGGCCAAGAACCCAGGG - Intergenic
1160086416 18:75781023-75781045 GAGAAAGGGCCAAGAAGCAAAGG - Intergenic
1160849616 19:1184020-1184042 GGGAAATTCCAGAGAAGCCAGGG + Intronic
1162082198 19:8224901-8224923 GGATCTTGGCCAAGAAGCCAGGG + Intronic
1164840408 19:31388797-31388819 GAAAAATGGCCAAGTGGCCAGGG + Intergenic
1167132477 19:47596107-47596129 AGGAAATGGCCAAGAAACACAGG - Intergenic
1167486892 19:49767843-49767865 GGGAGATTGCCTAGAAGACATGG + Intronic
1167578178 19:50327768-50327790 GGGGAAGGTCCAAGAAACCAAGG + Intronic
1168419211 19:56190264-56190286 CCCAGATGGCCAAGAAGCCAAGG - Exonic
1168427042 19:56247023-56247045 CCCCAATGGCCAAGAAGCCAAGG + Exonic
926573976 2:14560013-14560035 GGGGAATGGCCAGGCACCCATGG - Intergenic
928255415 2:29717944-29717966 GGGAGATGAACTAGAAGCCAGGG + Intronic
928426787 2:31185543-31185565 GGGAAATTACCTAGAAGCAATGG - Intronic
930226642 2:48800857-48800879 TGTAAATAGCCAAGAAGACAGGG + Intergenic
931633172 2:64319571-64319593 GGGAAATGGGAAAGGAGACAGGG + Intergenic
931686823 2:64800879-64800901 GGGAAATGCCTATGAATCCAGGG + Intergenic
932059286 2:68479407-68479429 TGGATATGGCCAAAAAGTCAGGG + Intronic
935113569 2:100113938-100113960 GGGAGATGGAAAAGGAGCCAAGG + Intronic
935385787 2:102498952-102498974 GGAAAATGGGGAAGAAGCCCAGG + Intronic
936621797 2:114107847-114107869 GAGAAATGACCAAGAAGAAAAGG + Intergenic
936987380 2:118324248-118324270 GGGAAGTGGAGATGAAGCCATGG + Intergenic
937691827 2:124764600-124764622 GGGAAGTGGCAGAGAAACCATGG - Intronic
937777715 2:125799473-125799495 GAGTAATGTCCAAGAAACCATGG - Intergenic
939882247 2:147643594-147643616 GGGAAAAGGACAGGAGGCCAGGG - Intergenic
944039591 2:195338729-195338751 AGGTCCTGGCCAAGAAGCCAAGG + Intergenic
946469145 2:219940188-219940210 GAGAAATGGGCAAGAAGAAAGGG - Intergenic
947051810 2:226053158-226053180 TGGAAATGAGCAAGAAACCATGG + Intergenic
947152604 2:227130592-227130614 GAGAAAGTGACAAGAAGCCAGGG - Intronic
948007608 2:234623320-234623342 GAGAAATGGGCATGAAGACAAGG + Intergenic
948816515 2:240513026-240513048 GGGAAATGGCTGAGACTCCAAGG + Intronic
948936825 2:241170972-241170994 GGGAGTTGGCAAAGAAGCCAGGG + Intronic
1168809461 20:694759-694781 GGCACAATGCCAAGAAGCCATGG + Intergenic
1170298161 20:14852217-14852239 GCGAGGTGGCCAAGAAACCAAGG + Intronic
1170800096 20:19583606-19583628 GGGAAACGGACATGAACCCAAGG + Intronic
1172293808 20:33793810-33793832 GGAAAGTGGCTAAGAACCCATGG - Intergenic
1172991955 20:39043100-39043122 AGGCCATGGTCAAGAAGCCATGG - Intergenic
1173434882 20:43023655-43023677 GAGCAAGGGCCTAGAAGCCACGG + Intronic
1174563170 20:51445658-51445680 GGGAAAATGCTATGAAGCCAGGG - Intronic
1174607762 20:51773293-51773315 GGTAAGTGGGCAAGAAGTCAAGG + Intergenic
1175526296 20:59636538-59636560 GGGAGATGGCCAGGAAGACCTGG + Intronic
1179152825 21:38822997-38823019 GGAAAGTGGCCAAGAAGCAGTGG + Exonic
1180847790 22:18993838-18993860 TGGGAATTGCCCAGAAGCCAGGG - Intergenic
1181375536 22:22454941-22454963 GGGAAAAGACCAGGGAGCCATGG + Intergenic
1181974467 22:26719112-26719134 TGAAAATGGCACAGAAGCCAGGG - Intergenic
1182946667 22:34330685-34330707 GCCAAAAGGCCAAGAAGCAATGG - Intergenic
1183689042 22:39377763-39377785 CAGAAATGTCCAAGATGCCAGGG + Intronic
1184028416 22:41875750-41875772 GGGAAATGGGAAAGATTCCAGGG - Intronic
1184297952 22:43537769-43537791 TGGAAATAGCCATGTAGCCAAGG + Intronic
1184612589 22:45614340-45614362 GGGCAATGGCACAGACGCCAGGG + Intergenic
950045230 3:9945072-9945094 GGGAAATGTCCTAGAATCCTGGG + Intronic
950670053 3:14520482-14520504 TGGAAATAGTCAAGACGCCAGGG - Exonic
951848466 3:27111146-27111168 TGGAAAAGACCAAGATGCCATGG - Intronic
953772671 3:45790891-45790913 GGGAAATGGCCAGAAACCCCAGG - Intronic
953883333 3:46702513-46702535 GGGAGAAGGCCCAGGAGCCAGGG + Intronic
953929057 3:46996922-46996944 GGGGAATGGGCAGGCAGCCAGGG - Intronic
956706591 3:72004434-72004456 AGGAAAAGGCCAAGGAGCTAAGG + Intergenic
958433484 3:94069858-94069880 GGGAAATGGGTAAGCAGGCAGGG + Intronic
959310438 3:104729348-104729370 GAGAAATAGGCAAGAAGCAAAGG + Intergenic
961057606 3:123802376-123802398 AGGAAAGGCCCAGGAAGCCATGG - Intronic
961470446 3:127107940-127107962 AGGAAAAGGCCCAGGAGCCAGGG - Intergenic
963107016 3:141656105-141656127 TGAAAATGCCCAAGAAGCCCTGG - Intergenic
963225867 3:142860944-142860966 GGAAAATGACCTAGAAGCCCTGG - Intronic
967861254 3:194153534-194153556 GGGAAGCCGCTAAGAAGCCATGG - Intergenic
967881955 3:194307796-194307818 GGGAAATGGCTGAGACCCCAAGG + Intergenic
968359751 3:198138722-198138744 GGGGCATGTCCAAGAGGCCAAGG - Intergenic
968469072 4:769593-769615 GGGCAATGGCCACGTGGCCAAGG + Exonic
969878960 4:10157301-10157323 GGGAAAAGGACTAGAAGCCTTGG + Intergenic
970478388 4:16448840-16448862 GGGAAATGGGCTAGAATCCCAGG - Intergenic
971360008 4:25928981-25929003 ATTAAATGGCCAGGAAGCCATGG - Intronic
971374586 4:26046640-26046662 GGGAACTGGCCAAGAACACAGGG + Intergenic
971574117 4:28252280-28252302 AGGAAAGGGCCCATAAGCCAAGG - Intergenic
972263232 4:37432893-37432915 GGGAGATTGCAAAGAAGGCATGG + Intronic
972414387 4:38824120-38824142 GGGAAATGTCCATGAAGTCCTGG - Exonic
976474547 4:85468842-85468864 GTGAATTGGCCAAAAAGCCAAGG - Intergenic
976537212 4:86231878-86231900 GCCAAATGCCCATGAAGCCAGGG + Intronic
978759525 4:112341333-112341355 GGGAAATTGTCAGGAAGGCAAGG - Intronic
980552016 4:134350391-134350413 GGGAAATGCCCAATAGGCAAAGG + Intergenic
980661012 4:135857984-135858006 GGGAGATGGCCATGAAGAAAGGG + Intergenic
981966906 4:150614829-150614851 GGGAAATGGCTACCCAGCCAGGG - Intronic
985726193 5:1516936-1516958 GGCACATGGCTGAGAAGCCAGGG + Intronic
986373826 5:7109824-7109846 AGGAAATGGCGAGGAAGACATGG + Intergenic
986609565 5:9553067-9553089 GAGAAATGGGCAAGAAGAAAGGG + Intergenic
986789998 5:11150213-11150235 GGGCAATGGAAAAGAACCCAGGG + Intronic
987306334 5:16641158-16641180 GTCAAAGGACCAAGAAGCCAGGG + Intergenic
987769700 5:22284867-22284889 AGGAAAAGGGAAAGAAGCCAGGG + Intronic
987957793 5:24763196-24763218 GGAACATGGGCAAGAAGCTATGG + Intergenic
990555832 5:56934801-56934823 GGGAAAAGGCCAAACACCCATGG + Intronic
992823136 5:80518642-80518664 GGGAAAGGGGCTAGAAGCTAAGG + Intronic
995162519 5:108998109-108998131 GGGAAAGGGAGATGAAGCCAGGG - Intronic
995528696 5:113071873-113071895 GGGAAATGGACGAGGAGCTATGG + Intronic
996233194 5:121091928-121091950 GGGAAAGGGTGAATAAGCCAAGG + Intergenic
997039427 5:130234208-130234230 GGGATCTGGCAAAGAAGCCTAGG - Intergenic
997311393 5:132886581-132886603 GGAAGATGGCTAAGAAGCCTAGG + Intronic
1001753618 5:174149830-174149852 GGGAAAGGGTCAAGAGGCCAGGG - Intronic
1002490398 5:179572191-179572213 GGGCAATGGCCTTGAAGTCAGGG - Intronic
1002583716 5:180227721-180227743 GCCAAAAGGCCAAGAAGCAAGGG + Intergenic
1003354026 6:5348411-5348433 GGGAAATGGCCAGTAAGCCAGGG - Intronic
1008562098 6:52733546-52733568 GCCAAAAGGCCAAGAAGCGATGG + Intergenic
1010021900 6:71170215-71170237 AGAAAAGGGCCAAGAAGCTAAGG - Intergenic
1011194036 6:84764164-84764186 GGGGGATGGCCGAGAAGCGAAGG - Exonic
1011441065 6:87387884-87387906 GGGAAATGGGCAAGAAAGGAAGG + Intronic
1012279309 6:97310190-97310212 GGGCCATAGCCAAGAAGCCAAGG - Intergenic
1012400264 6:98836247-98836269 GGGAAAGGGCCAAGGACCGAAGG - Exonic
1013050809 6:106533289-106533311 GGGCAATAGCTAAGAGGCCAAGG + Intronic
1013373927 6:109495907-109495929 AGGAAGTGGCAAAGATGCCAGGG - Intronic
1014557333 6:122850414-122850436 GGGGAAAGGGCAAGAAGGCAGGG - Intergenic
1016622524 6:146128834-146128856 GGGAAATGGCCAAGGATGCTGGG - Intronic
1016635711 6:146287773-146287795 GGGAAAAGGGCCACAAGCCAAGG + Intronic
1017641117 6:156494784-156494806 GGGTGTTGGGCAAGAAGCCAGGG + Intergenic
1017926014 6:158912309-158912331 GGGAGGTGGCAAAGCAGCCAAGG - Intergenic
1018376636 6:163219208-163219230 GGGAAATGGCCAAGAAAGAGTGG - Intronic
1019260237 7:77928-77950 GGGGCATGTCCAAGAGGCCAAGG + Intergenic
1021088053 7:16447184-16447206 GGGAAATGTCCCACAAGCCATGG - Intergenic
1022303287 7:29121756-29121778 GGGAAATTTCAAAGAAGCAATGG + Intronic
1022783709 7:33613772-33613794 GTGACCTGGGCAAGAAGCCAAGG + Intergenic
1022903913 7:34837503-34837525 GGGAAATGGGCAATGGGCCATGG - Intronic
1023059432 7:36314063-36314085 GGGAGAGGGCCAAGTGGCCACGG + Intergenic
1023854121 7:44170934-44170956 GGGAACTGGCCAAGAAGGGAAGG + Intronic
1024666292 7:51550411-51550433 GGGAAATGGGACAGGAGCCATGG + Intergenic
1025721785 7:64022873-64022895 TTGAAATGGTCAAGAAGCAAAGG + Intergenic
1025909872 7:65819753-65819775 GAGAAATGAACATGAAGCCAGGG + Intergenic
1026076565 7:67176447-67176469 GCCAAAAGGCCAAGAAGCGATGG + Intronic
1026235004 7:68519829-68519851 GGGAAAGGTCCAAGTAGACAAGG - Intergenic
1027199456 7:76054046-76054068 GGAAAATGGCAAAAATGCCAAGG + Intronic
1029228526 7:99047039-99047061 AGGAAATGGCCCAAATGCCATGG + Intronic
1029804367 7:102981020-102981042 TTGAAATGGCCAACAAGCCTTGG + Intronic
1031979882 7:128117687-128117709 GGGAAATGACCTCGATGCCATGG + Intergenic
1033189005 7:139259325-139259347 GGGAAAAGGAGAAGAAGCCAAGG + Exonic
1033295854 7:140134445-140134467 GGGAGATGGGGAAAAAGCCAAGG + Intronic
1034760141 7:153664706-153664728 GAGAAATGGCAAGGAGGCCAGGG + Intergenic
1035317008 7:158002662-158002684 GGGAAATGTCCAGGAATCCTGGG + Intronic
1036673335 8:10807833-10807855 GGGAAAAGTCCAGGAGGCCAGGG + Intronic
1037673640 8:21036611-21036633 GGCAAATTGCAAAGAACCCAGGG + Intergenic
1038668943 8:29565835-29565857 AAGAAATGGCCCTGAAGCCAAGG - Intergenic
1039064199 8:33595139-33595161 AGGAGATGGCCATGTAGCCATGG + Intronic
1047596275 8:126380841-126380863 GGGAAATTCCCCAGAAGCCTGGG + Intergenic
1047655246 8:126970291-126970313 GAGAAAGGGACAACAAGCCAAGG - Intergenic
1047700929 8:127448600-127448622 GGGGTATGGGCGAGAAGCCAAGG + Intergenic
1047723866 8:127667849-127667871 GGGAAATTACTAAGAAGTCAGGG + Intergenic
1048221008 8:132541975-132541997 GGGAAATTGCCAAGAAGAGAGGG - Intergenic
1049413530 8:142484553-142484575 AGGAAATGGCCAATAAGAAAAGG + Intronic
1049754549 8:144304022-144304044 TGCACGTGGCCAAGAAGCCAGGG - Intronic
1049910360 9:260055-260077 GGGACATGGGCAAGAAACCATGG + Intronic
1050802869 9:9637722-9637744 GGGCAATGCCTAAGGAGCCATGG - Intronic
1051121881 9:13760597-13760619 GGGTAATGCCCCATAAGCCAGGG + Intergenic
1051193162 9:14535413-14535435 GGGCACTGTCCGAGAAGCCAGGG + Intergenic
1051588561 9:18752391-18752413 AGGAATTGGCCAAGAAAACATGG - Intronic
1051841693 9:21405063-21405085 GGGACTGGGCCAAGATGCCAGGG + Intergenic
1052484358 9:29077071-29077093 AGGAAATGGCAAACAAACCAAGG + Intergenic
1052679473 9:31670786-31670808 GGGAACTGTCTAACAAGCCAAGG - Intergenic
1053386370 9:37693800-37693822 GGGATATGGCCCAGGAGCCCAGG - Intronic
1055195637 9:73589690-73589712 GGGACATTGCCAGGAAGCCTGGG + Intergenic
1056843978 9:90021687-90021709 TGGAAATAGCCAAGAAGGAAGGG + Intergenic
1057372910 9:94490226-94490248 AAGAAATGGACATGAAGCCACGG + Intergenic
1058773308 9:108260048-108260070 GGGAGCTGGCCAAGAGGCCTTGG - Intergenic
1058840994 9:108908939-108908961 AGGAAATAGCCAGGAGGCCAGGG - Intronic
1059410748 9:114130807-114130829 GGGAACTGGACCAGAATCCAGGG - Intergenic
1059669302 9:116477898-116477920 GAGAGATGGACAGGAAGCCAGGG + Intronic
1061924425 9:133798972-133798994 GAGAAATGGCCCAGAGGCCATGG - Intronic
1062100548 9:134726099-134726121 GGGTAATGGCAAAGGAGGCAGGG + Intronic
1062451761 9:136618717-136618739 GGGAAGTGGTGAAGAAGCCGAGG + Intergenic
1062744454 9:138202543-138202565 GGGGCATGTCCAAGAGGCCAAGG - Intergenic
1185939392 X:4298586-4298608 GGGAAATCACCTTGAAGCCATGG - Intergenic
1186571765 X:10722678-10722700 AGGAAATGGCCAAGAACAAAGGG + Intronic
1187820840 X:23286415-23286437 GGGAAATGGCTAACAAGCAGAGG - Intergenic
1189213920 X:39307118-39307140 GAGAAATGGGCCAGAGGCCATGG + Intergenic
1189842097 X:45091093-45091115 GGGAAATGGGAAAGAAGCACAGG - Intronic
1191253007 X:58268285-58268307 GGGACAGGGCCAGGACGCCAGGG - Intergenic
1191616625 X:63176629-63176651 GGGGCATGGCCTAAAAGCCATGG + Intergenic
1191619672 X:63202294-63202316 GGGGCATGGCCTAAAAGCCATGG - Intergenic
1192351863 X:70362478-70362500 GGGAAAAGGACTAGATGCCATGG - Intronic
1193461043 X:81791127-81791149 GGGCAATGGCCTAAAAGCCATGG - Intergenic
1193759668 X:85449097-85449119 GTCAAATGGCCAAGAAGCTGAGG + Intergenic
1193963993 X:87961196-87961218 GGGACATGGCCTAAAAGTCATGG + Intergenic
1196008311 X:110858450-110858472 GGAAAATGGACAAGACTCCAAGG + Intergenic
1196602043 X:117612788-117612810 GGGAACTGACCAAGATGCCTAGG + Intergenic
1196632386 X:117957079-117957101 GGGAAATGGGGAAGAAGCAAGGG - Intronic
1196937011 X:120740268-120740290 GGGTAATTGGCAAGAAACCAGGG + Intergenic
1197493957 X:127154163-127154185 GGGACGTGGCCTAAAAGCCATGG - Intergenic
1198073854 X:133176182-133176204 GGGCAATGGCAATGAAGCCTTGG + Intergenic
1199690959 X:150308747-150308769 GAGAAGCGGCCCAGAAGCCAGGG - Intergenic
1200136989 X:153880002-153880024 GGGAAAGGGCCAGGGAGGCAAGG + Intronic
1200409540 Y:2847602-2847624 GGAAGATGGCAAAGAAGACAGGG + Intronic
1201149064 Y:11085475-11085497 GGCAAATGGCCCAGATGCCTAGG + Intergenic