ID: 1130062194

View in Genome Browser
Species Human (GRCh38)
Location 15:80578105-80578127
Sequence CCCCATGAACATGAGCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130062194_1130062200 21 Left 1130062194 15:80578105-80578127 CCTGGGTGCTCATGTTCATGGGG 0: 1
1: 0
2: 1
3: 10
4: 145
Right 1130062200 15:80578149-80578171 GTCCTCCACTCTGGACAAAGGGG 0: 1
1: 0
2: 0
3: 11
4: 200
1130062194_1130062199 20 Left 1130062194 15:80578105-80578127 CCTGGGTGCTCATGTTCATGGGG 0: 1
1: 0
2: 1
3: 10
4: 145
Right 1130062199 15:80578148-80578170 TGTCCTCCACTCTGGACAAAGGG 0: 1
1: 0
2: 0
3: 21
4: 255
1130062194_1130062203 27 Left 1130062194 15:80578105-80578127 CCTGGGTGCTCATGTTCATGGGG 0: 1
1: 0
2: 1
3: 10
4: 145
Right 1130062203 15:80578155-80578177 CACTCTGGACAAAGGGGATCAGG 0: 1
1: 0
2: 0
3: 15
4: 132
1130062194_1130062197 12 Left 1130062194 15:80578105-80578127 CCTGGGTGCTCATGTTCATGGGG 0: 1
1: 0
2: 1
3: 10
4: 145
Right 1130062197 15:80578140-80578162 TTGCTGCTTGTCCTCCACTCTGG 0: 1
1: 0
2: 1
3: 17
4: 175
1130062194_1130062204 28 Left 1130062194 15:80578105-80578127 CCTGGGTGCTCATGTTCATGGGG 0: 1
1: 0
2: 1
3: 10
4: 145
Right 1130062204 15:80578156-80578178 ACTCTGGACAAAGGGGATCAGGG 0: 1
1: 0
2: 0
3: 20
4: 175
1130062194_1130062198 19 Left 1130062194 15:80578105-80578127 CCTGGGTGCTCATGTTCATGGGG 0: 1
1: 0
2: 1
3: 10
4: 145
Right 1130062198 15:80578147-80578169 TTGTCCTCCACTCTGGACAAAGG 0: 1
1: 0
2: 0
3: 18
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130062194 Original CRISPR CCCCATGAACATGAGCACCC AGG (reversed) Intronic
900982327 1:6053328-6053350 CTGCATGAACAAGAGCAACCAGG + Intronic
901003778 1:6161804-6161826 CGCCATGAACTTCAGCACCACGG + Intronic
902536383 1:17121292-17121314 CCCCAGGAAGGTGAGAACCCTGG - Intergenic
903677716 1:25074958-25074980 CTCCATGCACCTGAGCACGCAGG - Intergenic
916944003 1:169705954-169705976 CACCATTTACATGGGCACCCTGG - Intronic
921163649 1:212490777-212490799 CCCCATGAACAACAGGACCCTGG - Intergenic
922550554 1:226491103-226491125 CCCCATCAACCTGACCACTCAGG - Intergenic
922961174 1:229646870-229646892 CCCCAGGAACATGCTAACCCAGG - Intronic
922987171 1:229874784-229874806 CCACATGCTGATGAGCACCCAGG + Intergenic
923307883 1:232704783-232704805 ACCCAGCAACATGAACACCCAGG - Intergenic
1063857072 10:10266820-10266842 CACCAGGAACATGAACACCAAGG - Intergenic
1063857111 10:10267120-10267142 CACCAGGAACATGAACACCAAGG - Intergenic
1063857124 10:10267225-10267247 CACCAGGAACATGAACACCAAGG - Intergenic
1067701997 10:48580461-48580483 CCTCAGGGTCATGAGCACCCGGG + Intronic
1070351266 10:75594147-75594169 GCCCATCAACAGGGGCACCCGGG - Intronic
1072993987 10:100227110-100227132 CTCCATTAACATGAGCATTCAGG - Intronic
1075870312 10:125767978-125768000 CCCCATGAACATCATCCTCCCGG + Intronic
1076297124 10:129394866-129394888 CCCGAGGAAAATGAGCAGCCGGG + Intergenic
1077957736 11:7038993-7039015 CCCCATGCACAAGACCACCATGG - Intronic
1080833505 11:35918428-35918450 CTCCAAGAACAAGAGCAGCCAGG - Intergenic
1080974391 11:37319759-37319781 CCCCATAAACCTGAACTCCCAGG + Intergenic
1084754037 11:71223280-71223302 CCCCATGAGAATGCACACCCTGG - Intronic
1086437112 11:86792326-86792348 CCCAGTGAGCATGAGCACCTTGG - Intronic
1090654165 11:128830015-128830037 CCCCAAGAATATGAGCTCCATGG + Intergenic
1095848606 12:46775474-46775496 CCCCTTCAACAAGAGCACCTTGG - Intronic
1097040877 12:56155160-56155182 CCCCAGGACCTTGAGCACCTCGG - Exonic
1097041685 12:56159692-56159714 CCCCAGGACCTTGAGCACCTCGG - Exonic
1097516777 12:60616911-60616933 CCCCATGGACATAAGCTCCAGGG + Intergenic
1100356308 12:93834046-93834068 CCACATTAACATGAGCACCCAGG - Intronic
1105420567 13:20248330-20248352 CCCACTTAAGATGAGCACCCAGG + Intergenic
1107456404 13:40559765-40559787 CCCCATGCAGATGAGTGCCCTGG - Exonic
1108181264 13:47842047-47842069 GCCCATGCACAGGAGCAACCAGG - Intergenic
1108558962 13:51624556-51624578 CCCCAAGAACATAAGCTCCATGG - Intronic
1108567958 13:51719920-51719942 CACCATGAGCATGAGGACCCTGG - Intronic
1111877708 13:93917729-93917751 CCCCAGCCACATGAGAACCCTGG + Intronic
1113579438 13:111418644-111418666 CCCCGTGAAGATGAGCCCCCAGG - Intergenic
1113617563 13:111691800-111691822 CCCCTTGAACAGGAGCACAGAGG - Intergenic
1113623093 13:111777060-111777082 CCCCTTGAACAGGAGCACAGAGG - Intergenic
1113807168 13:113116627-113116649 CCCCAGGAGCAGGAGCTCCCAGG - Intronic
1117647940 14:57871811-57871833 CCCCATGACCATCAGCATTCAGG + Intronic
1119173073 14:72549399-72549421 CCCCACGCACATGGCCACCCTGG - Intronic
1124022594 15:25938294-25938316 CCCTGTGCACATGGGCACCCGGG + Intergenic
1125805249 15:42488538-42488560 CCCAATGAATAAGAGCACCTGGG - Intronic
1127062317 15:55199494-55199516 TCCCATATACATGAACACCCAGG + Intergenic
1127999470 15:64177354-64177376 TCCCATGAAAATGATCAACCAGG + Intronic
1128660560 15:69497890-69497912 CCCCATCAGCATGAGGCCCCAGG + Intergenic
1129596323 15:76967258-76967280 CCCCATAAACATCACCACCTTGG - Intergenic
1130062194 15:80578105-80578127 CCCCATGAACATGAGCACCCAGG - Intronic
1130883569 15:88075186-88075208 TGCCATGAACTTGACCACCCTGG + Intronic
1134856141 16:17521072-17521094 CACCATGAACACCAGCAGCCTGG - Intergenic
1139562272 16:67750500-67750522 CCCCAAGATCATGAGCTCCTTGG + Intronic
1141885993 16:86892765-86892787 ACCCATGAGCATGAGCAGCTGGG - Intergenic
1142918532 17:3163714-3163736 CCCAGTGAACATGAGCTCCAGGG + Intergenic
1144954735 17:19013357-19013379 CCTCATAGACATGAGCACCTGGG - Exonic
1146051231 17:29555163-29555185 CCCCATGCAGTTGTGCACCCCGG + Intergenic
1146079107 17:29761259-29761281 CCCCATGACCCTGAGCACGTTGG - Intronic
1146475968 17:33163064-33163086 CCCCACCAGAATGAGCACCCTGG - Intronic
1147999180 17:44377697-44377719 CCCCATGAAGAAGAACGCCCAGG - Exonic
1151349313 17:73522323-73522345 CACCAGGCACATGAGCAGCCAGG - Intronic
1151473625 17:74332812-74332834 ACCCAGGAACCAGAGCACCCAGG + Intronic
1152942100 17:83178173-83178195 CCCCATGGACCTGGGCCCCCGGG + Intergenic
1153811959 18:8759911-8759933 CCCCATGAGCATGAGCCCCTGGG - Intronic
1154174948 18:12080259-12080281 CCCCATGATCATGATCTCCTGGG + Intergenic
1155370774 18:25097993-25098015 CCCCATAAACATCAGCAGCTTGG + Intronic
1157375120 18:47156501-47156523 CCCCAAGAACATGAGTGCACTGG + Intronic
1157489689 18:48114051-48114073 CCCCATGAAGATGACCACGGTGG - Intronic
1157495130 18:48151619-48151641 GCCCATGAACAAGAACTCCCTGG - Intronic
1160914074 19:1488395-1488417 CCCCAGGCACATGGGGACCCTGG - Intronic
1161074931 19:2280919-2280941 CCCCAGCAACATGAGCAGCCCGG - Exonic
1161291173 19:3494119-3494141 CCCCACCAACATGAGCTCTCCGG - Intronic
1161495160 19:4582339-4582361 CCCCATGAATTTGAGACCCCAGG + Intergenic
1161708014 19:5831296-5831318 CCCCAGGAAAGTGAGGACCCAGG + Exonic
1162001041 19:7745241-7745263 CCCCATCCCCATGAGAACCCAGG + Intronic
1166718625 19:44985017-44985039 CCCCATGATCATGAGGAACTGGG + Intronic
925408737 2:3626576-3626598 TCCCATGAACAAAAGCACCAGGG - Intronic
934772197 2:96914137-96914159 CCCCATGAGTATGAGCTCCCTGG - Intronic
936460912 2:112713234-112713256 GCCCATGTCCTTGAGCACCCAGG - Intergenic
938201831 2:129378396-129378418 CCCCATGAACCTTCACACCCTGG + Intergenic
945260467 2:207838180-207838202 CCACATTCACATGAGAACCCTGG - Intronic
1169180545 20:3562304-3562326 CCCCTTGCACAAGGGCACCCTGG - Exonic
1170399017 20:15960026-15960048 CCCCATGAACTGGATCACCCAGG + Intronic
1170967947 20:21092984-21093006 CCACATGACCTTGAGCACACTGG - Intergenic
1171038986 20:21742510-21742532 CCCCAAGAACATGCACATCCTGG - Intergenic
1179049360 21:37875469-37875491 CCCCAGGAAGATTAGCGCCCTGG - Intronic
1179077165 21:38133381-38133403 TCCCGTGAACATGATCACACTGG + Intronic
1180940557 22:19657571-19657593 CCCCATGAACACCAGGTCCCAGG - Intergenic
1181407897 22:22697833-22697855 CTCCATGAAAATCAGCATCCTGG - Intergenic
1183190861 22:36321341-36321363 CCCCTTGAAGGTGAGAACCCAGG - Intronic
1183515653 22:38264377-38264399 GCCCATGAAGATGAGCAGGCAGG + Intronic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1185370809 22:50460079-50460101 CCGCATGACCATGAGCAGCCTGG - Exonic
950714322 3:14836971-14836993 CCACATGCACAGAAGCACCCGGG + Intronic
951666643 3:25132225-25132247 TCCCATGATTATGAGCACCTTGG - Intergenic
952759216 3:36899029-36899051 CCCCATGAGCCTGAGTCCCCAGG + Intronic
953931062 3:47005881-47005903 CCCCATGATCTTCAGAACCCCGG - Intronic
954071015 3:48142844-48142866 GCCCAAGAACCTGAGTACCCAGG + Intergenic
954400345 3:50316334-50316356 CACCATGGCCATGAGCACCTGGG + Intergenic
954615346 3:51966573-51966595 CAGCACGAACATGAGCATCCTGG + Intronic
955920499 3:63949697-63949719 CCCTATGAAACTGAGCTCCCTGG - Intronic
957593006 3:82225089-82225111 GCCCATGAAAATGATCATCCGGG + Intergenic
961360483 3:126364301-126364323 CCCCTAGACCATGAGCACCATGG + Intergenic
967045787 3:185735675-185735697 CCCCAGGAACCTGAAGACCCAGG + Intronic
968634698 4:1672033-1672055 ACCCATGAACCTCAGAACCCAGG + Intronic
971974839 4:33671334-33671356 CCCCATGAACATGACCAGTAGGG - Intergenic
972817312 4:42657716-42657738 CCCCATGGACAAGAGCACCATGG - Intergenic
981038655 4:140198653-140198675 CCCAATGAACATAAGCGCCTTGG - Intergenic
985319692 4:188696810-188696832 CCCAATGAGGATGAGCAGCCTGG - Intergenic
985722454 5:1496872-1496894 GCCCAGGCACCTGAGCACCCTGG - Intronic
987187588 5:15440966-15440988 CCAGAAGAACATGAGCCCCCCGG - Intergenic
994740568 5:103612625-103612647 GTTAATGAACATGAGCACCCAGG + Intergenic
998162719 5:139822514-139822536 CCCCAGGAGCCTGACCACCCTGG - Intronic
998405868 5:141874433-141874455 CCCCAGTGACATGGGCACCCAGG + Intronic
1002582333 5:180216289-180216311 CCACAAGGACATGGGCACCCTGG - Intergenic
1002697284 5:181099388-181099410 CCCCATGCAGATGAGTGCCCTGG - Intergenic
1002971526 6:2027110-2027132 CTCCATGAAGAAGAGGACCCTGG + Intronic
1003314738 6:5002279-5002301 TTCCATGAAGATGAACACCCAGG + Intronic
1006873052 6:37270780-37270802 CCCCAGGAAGATGAGAACCTAGG - Intronic
1012780261 6:103548422-103548444 CCCCATGAAAATCGGCACCAGGG - Intergenic
1019276275 7:177632-177654 CTCCATGCACAGGAGCACACAGG - Intergenic
1019276293 7:177709-177731 CTCCATGCACAGGAGCACACAGG - Intergenic
1019276311 7:177786-177808 CTCCATGCACAGGAGCACACAGG - Intergenic
1019276345 7:177940-177962 CTCCATGCACAGGAGCACACAGG - Intergenic
1019276363 7:178017-178039 CTCCATGCACAGGAGCACACAGG - Intergenic
1019276380 7:178094-178116 CTCCATGCACAGGAGCACACAGG - Intergenic
1019890276 7:3940947-3940969 CCCCCTGAACCTGCGCACCTGGG + Intronic
1025681247 7:63683449-63683471 GGCCATGAACCTGAGCACTCAGG + Intergenic
1026914006 7:74108933-74108955 CCCGATGAACTTGAGCACGTTGG - Exonic
1029022232 7:97376985-97377007 ACCCAAGAACATGTTCACCCAGG + Intergenic
1029173016 7:98643968-98643990 CTCCAAGGACAAGAGCACCCAGG - Intergenic
1033227479 7:139573070-139573092 CCCCGTGAGCATGGGCCCCCGGG - Exonic
1035038926 7:155913640-155913662 CCCTGTGAACATGGGCACCATGG - Intergenic
1035764918 8:2098356-2098378 CCCCAGGGACATGGGCAGCCCGG + Intronic
1036228789 8:6982398-6982420 CCCCATGAAACTCAGAACCCGGG + Intergenic
1036231241 8:7001508-7001530 CCCCATGAAACTCAGAACCCGGG + Intronic
1036233690 8:7020607-7020629 CCCCATGAAACTCAGAACCCGGG + Intergenic
1038582690 8:28763595-28763617 TTCCAGGACCATGAGCACCCTGG - Intergenic
1039575510 8:38620593-38620615 CCCTAAGAACATGAGCACTGAGG - Intergenic
1041234114 8:55781610-55781632 CCCCAGGAACATGGGCACTGGGG - Intronic
1046701763 8:117408427-117408449 CTCCATAAACAAGAGCAGCCAGG - Intergenic
1047717956 8:127613157-127613179 CCCCATGGAAATAAGCACTCAGG + Intergenic
1056594769 9:87998020-87998042 CCCCATAATCATGTCCACCCAGG + Intergenic
1056839353 9:89986118-89986140 CACCATGACCATTAGCACCCTGG - Intergenic
1060009227 9:120028785-120028807 CACCATCCACATGAGAACCCAGG + Intergenic
1060524709 9:124313976-124313998 CCTCTTGAAGGTGAGCACCCTGG + Exonic
1061424684 9:130491579-130491601 CCCCTTGATCACGAGCATCCTGG - Intronic
1061617895 9:131792213-131792235 CACTATGAACCTGAGCACCGTGG - Intergenic
1061626895 9:131845906-131845928 CCCTATGATCATTAACACCCCGG - Intergenic
1062129450 9:134884728-134884750 ATCCATGAACAGGAGCACCTGGG + Exonic
1062156717 9:135053219-135053241 CTCCATGACCATGAGCCCTCTGG - Intergenic
1062566643 9:137166629-137166651 CCCCAGGAAGCTGAGCAGCCAGG - Intronic
1190679289 X:52811258-52811280 CCCAATGAACATGCGCACTAAGG - Intergenic
1190706169 X:53030043-53030065 CCCCTTGAGCCTGAGCAGCCAGG - Intergenic
1191627171 X:63281892-63281914 CCCCAGGAATAAGAGCAACCAGG - Intergenic
1191995348 X:67089336-67089358 CACCATGATCACTAGCACCCAGG - Intergenic
1196275790 X:113763919-113763941 TTCCATGAGCATGAGCAGCCTGG - Intergenic
1198113459 X:133522928-133522950 CCCCTTGAAAATCAGCACCTAGG + Intergenic
1199676540 X:150194533-150194555 CCCCAGGAACCTCAGCTCCCAGG + Intergenic