ID: 1130063274

View in Genome Browser
Species Human (GRCh38)
Location 15:80584671-80584693
Sequence CACTCAGATGTGCCCACGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 118}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130063274_1130063288 30 Left 1130063274 15:80584671-80584693 CCCAGCGTGGGCACATCTGAGTG 0: 1
1: 0
2: 1
3: 8
4: 118
Right 1130063288 15:80584724-80584746 GCCTATTGGTGTGGCACTGATGG 0: 1
1: 0
2: 0
3: 2
4: 79
1130063274_1130063280 7 Left 1130063274 15:80584671-80584693 CCCAGCGTGGGCACATCTGAGTG 0: 1
1: 0
2: 1
3: 8
4: 118
Right 1130063280 15:80584701-80584723 AGTGCCCTCTGTGCAGCCCTGGG 0: 1
1: 0
2: 4
3: 27
4: 262
1130063274_1130063284 16 Left 1130063274 15:80584671-80584693 CCCAGCGTGGGCACATCTGAGTG 0: 1
1: 0
2: 1
3: 8
4: 118
Right 1130063284 15:80584710-80584732 TGTGCAGCCCTGGGGCCTATTGG 0: 1
1: 0
2: 1
3: 15
4: 180
1130063274_1130063281 8 Left 1130063274 15:80584671-80584693 CCCAGCGTGGGCACATCTGAGTG 0: 1
1: 0
2: 1
3: 8
4: 118
Right 1130063281 15:80584702-80584724 GTGCCCTCTGTGCAGCCCTGGGG 0: 1
1: 0
2: 4
3: 39
4: 373
1130063274_1130063285 21 Left 1130063274 15:80584671-80584693 CCCAGCGTGGGCACATCTGAGTG 0: 1
1: 0
2: 1
3: 8
4: 118
Right 1130063285 15:80584715-80584737 AGCCCTGGGGCCTATTGGTGTGG 0: 1
1: 0
2: 1
3: 11
4: 206
1130063274_1130063279 6 Left 1130063274 15:80584671-80584693 CCCAGCGTGGGCACATCTGAGTG 0: 1
1: 0
2: 1
3: 8
4: 118
Right 1130063279 15:80584700-80584722 CAGTGCCCTCTGTGCAGCCCTGG 0: 1
1: 0
2: 7
3: 36
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130063274 Original CRISPR CACTCAGATGTGCCCACGCT GGG (reversed) Intronic
900779135 1:4606174-4606196 GACTCTGATGGGCCCACGATGGG - Intergenic
901140227 1:7024308-7024330 CACCCTGATGTGCCCACACATGG - Intronic
902376842 1:16033863-16033885 CACTCAGCTCTGCCCAAGGTGGG - Exonic
902382010 1:16057121-16057143 CACTCAGCTCTGCCCAAGGTGGG - Exonic
905102983 1:35541756-35541778 AACTGATATGTGCCCATGCTTGG - Intronic
920341539 1:205278206-205278228 CACTCAGGTCTTCCCACCCTTGG - Intergenic
922533761 1:226364678-226364700 CACTCAGAGGTGGCCCGGCTGGG + Intronic
1066092789 10:32042213-32042235 CACTTAGTTGTGCCCATGTTGGG - Intronic
1067297009 10:44980421-44980443 CATTCAGATGCGGCCAAGCTGGG + Intronic
1069152669 10:64984737-64984759 CACCCTGATGTGCCCACAGTTGG + Intergenic
1069418413 10:68223661-68223683 CACTCAGGTGTGCCCATGAGAGG + Intergenic
1069898824 10:71695508-71695530 GACTCTGATGTGACCACGGTAGG + Intronic
1077088213 11:765284-765306 CATCCACATCTGCCCACGCTTGG - Intergenic
1077183868 11:1227975-1227997 CACACAGATGGGCACACGCGTGG - Intronic
1077424137 11:2466552-2466574 CACTGACATCTGCCCAGGCTCGG + Intronic
1077548255 11:3186329-3186351 CACACAGAGGTGCCCTCTCTCGG - Intergenic
1078316723 11:10299616-10299638 CTCTCAGAAGAGCCCACACTTGG - Intergenic
1084957336 11:72698283-72698305 CACTCAGATGTGCCCGCCTCTGG + Intronic
1085849054 11:80098741-80098763 AACTCAGATGTGTCCTCTCTCGG + Intergenic
1087409806 11:97777285-97777307 TACTCAGGTGTGCAGACGCTGGG + Intergenic
1089168765 11:116498310-116498332 CACTCTGATGAGCCCACGCTGGG - Intergenic
1089561210 11:119344131-119344153 TACCCAGATGTTCCCACACTGGG - Intronic
1089921552 11:122213683-122213705 CTCTCAGAGGTTCCCACCCTGGG + Intergenic
1094833644 12:34312189-34312211 CACTTAGATGTGCCCACTGTGGG + Intergenic
1099713815 12:86264850-86264872 CAGTCGGCTGTGCCCACTCTTGG + Intronic
1102349218 12:112179699-112179721 CACTGAGGTGTGCCCACCCTCGG - Intronic
1104491057 12:129193819-129193841 CTATCAGATGTGCCCACTCATGG + Intronic
1104810838 12:131619428-131619450 CACACAGATGTGCACACACATGG + Intergenic
1104959752 12:132483090-132483112 CACTGAGATTTGCCATCGCTGGG + Intergenic
1107886098 13:44875212-44875234 CACACAGATGTGGCAAAGCTGGG - Intergenic
1113843778 13:113374663-113374685 CACTCAGCTGTGCCATCACTGGG + Intergenic
1113875975 13:113594628-113594650 TCCTCAGCTGTGCCCAGGCTTGG + Intronic
1129719829 15:77871976-77871998 CACTCAGAGATGCCCACCCTCGG - Intergenic
1130063274 15:80584671-80584693 CACTCAGATGTGCCCACGCTGGG - Intronic
1130333535 15:82939701-82939723 CTCTCAGATATGCTCAAGCTTGG + Intronic
1132303706 15:100793011-100793033 GACTCTGATGTGCCCTGGCTTGG - Intergenic
1132692860 16:1189312-1189334 CCCTCAGAAGTGCACAGGCTTGG + Intronic
1141170451 16:81687396-81687418 CCCTCAGAGGTGCCCAGGCCTGG + Intronic
1141551671 16:84810525-84810547 GACTCAGCAGTACCCACGCTGGG - Intergenic
1141659610 16:85435002-85435024 CACTCAGGAGGGCCTACGCTTGG + Intergenic
1141874682 16:86815181-86815203 AGCTGAGATGTGCCCATGCTAGG + Intergenic
1145123621 17:20282144-20282166 CACTCAGAAGTCCCCACCCACGG - Intronic
1145235962 17:21208640-21208662 CACTCAGATTTGCCTCTGCTGGG - Intronic
1149522141 17:57325582-57325604 CACCCAGTGGTGCCCAGGCTTGG - Intronic
1150496166 17:65609461-65609483 CAGCCAGATGTCCCCACACTGGG - Intronic
1153177010 18:2386882-2386904 CACTAAGATATGCCTAGGCTTGG - Intergenic
1153725206 18:7947185-7947207 CACTCAGGTGTTCCGGCGCTTGG + Intronic
1157556090 18:48613734-48613756 GACACAGATGTGGCCAAGCTTGG + Intronic
1161943338 19:7419320-7419342 CACCCGGGTGTGCCCACACTTGG + Intronic
1166326712 19:42055314-42055336 CAGTCAGATGTGTCCACACAGGG - Intronic
1167423111 19:49415308-49415330 CACGCACATGCGCCCACACTCGG + Intronic
926051478 2:9747582-9747604 CACTGGGATGTCCCCCCGCTTGG + Intergenic
927242525 2:20931253-20931275 CAGCCAGATCTGCCCAGGCTAGG - Intergenic
928344410 2:30477741-30477763 CACTCAGAGGTGGCCAGCCTAGG + Intronic
932705763 2:74023623-74023645 CAACCAGATGTGGCCAAGCTAGG - Intronic
938777999 2:134559103-134559125 CACTGAAATCTGCCCACCCTTGG + Intronic
939199725 2:139018570-139018592 CACACAGATGTGGCCAGACTGGG + Intergenic
941896938 2:170638684-170638706 CACACAGATGTTCACACACTGGG + Intronic
945912058 2:215660807-215660829 CCTTCAGATGTGGCCATGCTGGG - Intergenic
947586420 2:231359589-231359611 CACAAAGCTGTGCCCACGCCAGG - Intronic
1169550092 20:6693581-6693603 CACGCAGCTTTGCCTACGCTGGG - Intergenic
1170151036 20:13226535-13226557 CACTCAGCTGAGCCCAAGCAAGG - Intronic
1173292511 20:41727109-41727131 CAAGCAGATGTGGCCAGGCTAGG + Intergenic
1174811090 20:53646554-53646576 TAATTAGAAGTGCCCACGCTGGG - Intergenic
1175694809 20:61094047-61094069 CACTCTGATGTGGCCAGGCCTGG - Intergenic
1175999229 20:62824673-62824695 CACGCTGATGTGGCCAGGCTGGG + Intronic
1179137847 21:38696379-38696401 CATCCAGCTGTGCCCTCGCTGGG + Intergenic
1179222869 21:39425236-39425258 ATCTCAGATGTGTCCACACTTGG - Intronic
1180798665 22:18620908-18620930 CACTCAGAAGGGTCCAGGCTAGG + Intergenic
1181439124 22:22926779-22926801 CACCCATATGTGCCCAGCCTGGG + Intergenic
1182935929 22:34221546-34221568 GACTCAGGTGGGCCCACACTGGG - Intergenic
950550398 3:13662645-13662667 CCCACGGCTGTGCCCACGCTAGG + Intergenic
953020548 3:39110320-39110342 CACTCAGTTGGGCCCAGGCATGG - Intronic
954493519 3:50930668-50930690 CTCCCAGAGGTGCCCACCCTGGG - Intronic
954636817 3:52075402-52075424 GACTCAGATGGGCCCACTTTGGG + Exonic
954663575 3:52238834-52238856 CCCCCAGATGTGCCCACCCCAGG + Intronic
954893899 3:53958831-53958853 TACTCAGACGTGCCCAAGCCTGG - Intergenic
955068827 3:55555314-55555336 AGCTCAGATGTGCTCAAGCTGGG - Intronic
956591451 3:70919505-70919527 CGCTCAGAAGGGCCCACACTTGG - Intergenic
956780467 3:72599373-72599395 CATATAGATGTGCCCACCCTGGG + Intergenic
956894744 3:73648513-73648535 CACTCAGACATGCCACCGCTGGG + Intergenic
969216126 4:5723739-5723761 CGCTCAGATAGGCCCACTCTTGG + Intronic
969491543 4:7502057-7502079 CAGTCACATGTGCCCAGGCAGGG + Intronic
979082660 4:116362031-116362053 CACTCACATGAGCTCATGCTTGG + Intergenic
991086639 5:62653719-62653741 GGCTCAGATGTTCCCACTCTGGG - Intergenic
993092981 5:83449997-83450019 CACACATATGTGCCCACACATGG + Intergenic
994943596 5:106356878-106356900 CTCTCAGATGTGTCCACACTGGG + Intergenic
997769318 5:136540141-136540163 CACTCAGATGTACCTACAATCGG + Intergenic
999780518 5:154846095-154846117 CACTAATATGTGTCCAGGCTGGG - Intronic
1002457822 5:179355789-179355811 CACTGAGCAGTGGCCACGCTAGG + Intergenic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1007602133 6:43089016-43089038 TAGGTAGATGTGCCCACGCTTGG + Intronic
1009651043 6:66478879-66478901 CACCCATATGAGCTCACGCTTGG - Intergenic
1009681276 6:66896665-66896687 CACTCATATGGGCTCATGCTTGG + Intergenic
1011672403 6:89695701-89695723 CACCCAGAGGCTCCCACGCTGGG + Exonic
1012260843 6:97085596-97085618 GACTCAGATGTGACCACGTTAGG - Intronic
1013102333 6:106997528-106997550 GCCTCAGATGTGGCCACCCTGGG + Intergenic
1018240334 6:161767847-161767869 CACTCAGGTGTGACTAGGCTGGG + Intronic
1019171615 6:170136281-170136303 CACTCAGACGTCCCCAGGCCCGG - Intergenic
1019316166 7:387931-387953 CCCTCTGATGTGGCCACCCTGGG - Intergenic
1021078137 7:16330576-16330598 CTCTCAGACTTGCCCACACTAGG - Intronic
1023856152 7:44185555-44185577 CAGTCAGAGGGGCTCACGCTGGG + Intronic
1024220236 7:47281368-47281390 CACTCTGCTGTGTCCAGGCTGGG + Intronic
1026260239 7:68748633-68748655 CCATCAGAGGTGCCCACACTGGG - Intergenic
1032802825 7:135330154-135330176 CACACAGATGTCCCCTCTCTGGG - Intergenic
1032943234 7:136820646-136820668 CACTCCTATATTCCCACGCTTGG - Intergenic
1033755899 7:144398341-144398363 CCCTGCGATGTGCCCCCGCTGGG + Exonic
1035359829 7:158304023-158304045 CACTAAGATGTGCACAGGCTTGG + Intronic
1035359855 7:158304274-158304296 CACTAAGATGTACACAGGCTTGG + Intronic
1035359875 7:158304460-158304482 CACTAAGATGTACACAGGCTTGG + Intronic
1035625271 8:1066648-1066670 CACTCAGACCTGCCCATGGTGGG - Intergenic
1038416905 8:27403710-27403732 CACCCAGACGTGCCCACACAGGG + Intronic
1038494222 8:27990227-27990249 CACTCACATCTGGCCCCGCTCGG - Intronic
1038990273 8:32859882-32859904 CAAGCAGATGTGGCCACGCAGGG - Intergenic
1039102090 8:33951641-33951663 CACTGGGCTGTGCCCACCCTTGG - Intergenic
1040484236 8:47854993-47855015 GCCTCTGATGTCCCCACGCTGGG - Intronic
1040532249 8:48275389-48275411 GAGTAAGATGTGCACACGCTTGG - Intergenic
1043441370 8:80279631-80279653 CACCCAGATGAGTCCCCGCTGGG - Intergenic
1044775733 8:95685637-95685659 CACTCACATGAGCTCATGCTTGG - Intergenic
1046474876 8:114729139-114729161 GACTCATATGTGACCACCCTTGG + Intergenic
1046614759 8:116463786-116463808 CACTAAGCTGTGCCCACACTGGG - Intergenic
1047314257 8:123717871-123717893 CACTCAGATGCGCTCGTGCTTGG + Intronic
1049210120 8:141382181-141382203 CTCTATGATGTGCCCACTCTGGG + Intergenic
1061886094 9:133591761-133591783 CACTCAGAGGAGCCCCTGCTGGG - Intergenic
1062174076 9:135151289-135151311 CACTGAGCTGTGCCCACTCTTGG - Intergenic
1187824172 X:23318261-23318283 CACTCAGCTGGGCCCACACACGG - Intergenic
1191103526 X:56758495-56758517 CACTCATATGTGCCCAGGAATGG + Intergenic
1193554086 X:82932308-82932330 CAGCCAGATGTGCACATGCTTGG + Intergenic