ID: 1130064710

View in Genome Browser
Species Human (GRCh38)
Location 15:80594128-80594150
Sequence CTGGGGGAATGCTGGGAAAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 423}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130064710 Original CRISPR CTGGGGGAATGCTGGGAAAA TGG Exonic
900244242 1:1630232-1630254 GTGGGGGAATGCGGGGAGCAGGG - Intronic
901402829 1:9026071-9026093 CTGAGCGAATGCTGGGAGAGCGG - Intronic
901466591 1:9425624-9425646 TTGGGGGGATGTTGGGAGAAGGG - Intergenic
902214381 1:14924874-14924896 CTGGGGGAAGCGTGGGAAAGGGG + Intronic
902658029 1:17882955-17882977 CTGGCAGGATGCTGGGATAAAGG + Intergenic
902956462 1:19927410-19927432 AGGGGGGCATGTTGGGAAAAGGG - Intergenic
904486074 1:30825156-30825178 CAGGAGGACTGCTGGGAGAAAGG + Intergenic
904797860 1:33070970-33070992 CTGGAGAAAGGCTGGGAAAATGG + Intronic
905484497 1:38285909-38285931 CTGGGGGAGGGCTGGGGAAGAGG - Intergenic
908681209 1:66663393-66663415 CTTGGGAAATGATGGGAGAAAGG + Intronic
911136065 1:94442255-94442277 CAGACGGAATTCTGGGAAAACGG - Intronic
912951152 1:114121355-114121377 TTGGAGGAATGCTGGAAAGAAGG - Intronic
912972147 1:114293672-114293694 CTGGAGGAAGGCTGGGAAACTGG - Intergenic
913120770 1:115738458-115738480 CTGGGGGATTGTGGGGAGAATGG - Intronic
915409878 1:155692360-155692382 AGGGGGGCATGTTGGGAAAAAGG - Intronic
915923889 1:160001654-160001676 TTGGGGGAACACTGGGAAGATGG - Intergenic
916885464 1:169063588-169063610 CAGGAGGTATGGTGGGAAAAAGG - Intergenic
917047011 1:170872183-170872205 CTATGGAAGTGCTGGGAAAAGGG + Intergenic
918646763 1:186915091-186915113 CTGGGGCCATGTTTGGAAAATGG - Intronic
920729363 1:208468369-208468391 CTCGGCGATTGCTGGGAAATAGG + Intergenic
920920123 1:210291974-210291996 GTGGGGGGAGGATGGGAAAAAGG + Intergenic
921075034 1:211693844-211693866 CTGGGGCCATGTTTGGAAAATGG + Intergenic
921134691 1:212249569-212249591 CTGGGTTGAGGCTGGGAAAATGG + Intergenic
922639317 1:227211271-227211293 CTGGGGGGATGCAGATAAAAAGG + Intronic
922731692 1:227951905-227951927 TTTGGGGAAGGCTGGGAGAAAGG - Intergenic
922936472 1:229426664-229426686 CAGGTGGCATGCTGGGAACACGG - Intergenic
1062861937 10:816983-817005 CTGGGGCACAGCTGGGGAAAGGG + Intronic
1065225525 10:23539612-23539634 CTAGGGCAATGCTGGGGACATGG + Intergenic
1066795139 10:39111920-39111942 ATGGGGGCATGTTGGGAAAAAGG + Intergenic
1067216908 10:44310932-44310954 CTGGGGGACTGCATGGAGAAGGG + Intergenic
1067579667 10:47434263-47434285 CTGGAGGATTGCTGGCAAGATGG - Intergenic
1069597982 10:69684973-69684995 CTGGGGGAATGCTGGAAACAAGG + Exonic
1069864540 10:71493517-71493539 CTGGGGAAATGCTGGGCCAGGGG - Intronic
1069914749 10:71780553-71780575 CTGGGGGAAAGTTGAGCAAAGGG + Intronic
1071282636 10:84116452-84116474 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1072335223 10:94391869-94391891 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1072667693 10:97406260-97406282 CAGTGGGAAGGCTGAGAAAAGGG + Intronic
1072756513 10:98025003-98025025 CTGGGGGAATCTGGGTAAAACGG + Intronic
1072872192 10:99132436-99132458 ATGGGGGATTGCTGGCAAGATGG + Intronic
1074015473 10:109529902-109529924 CTGGGGAAGTGCAGGGAACAGGG + Intergenic
1074291509 10:112141069-112141091 CTGGAAGAAGGCTGTGAAAATGG + Intergenic
1074575181 10:114662350-114662372 CAGTGGGAAGGCTGTGAAAAAGG + Intronic
1075069080 10:119308866-119308888 TTGGGGGAATGCTGGCAGGATGG + Intronic
1076504870 10:130964980-130965002 CTAGAGGACTCCTGGGAAAATGG + Intergenic
1076809490 10:132879161-132879183 CTTGGGGAGTGCTGGGAATGTGG + Intronic
1077485420 11:2836261-2836283 CTTGGGGAAAGCAGGGAGAAGGG + Intronic
1077959078 11:7053932-7053954 GTGGGGGAATGAGGGGAAGAGGG - Intronic
1077997194 11:7464205-7464227 CTGGGGGAATCCAGAGAAATGGG + Intronic
1078510680 11:11982037-11982059 CGGGGGCAATGCTGGGAATGGGG - Intronic
1080300553 11:30779962-30779984 TTAGGGGAATGTTGGGAATATGG - Intergenic
1081748952 11:45494121-45494143 CTGGGGAAATTCTGGAAAATCGG + Intergenic
1083090301 11:60192460-60192482 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1083197591 11:61098116-61098138 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1083369178 11:62164905-62164927 CTGCGGGAATGGTAGGGAAAGGG + Intergenic
1083573350 11:63771702-63771724 CTGGGAGAACGCTGGGGAGAGGG + Intergenic
1084171763 11:67404375-67404397 CTGGCGGAATGCTGGGACAGAGG + Intronic
1084786803 11:71447298-71447320 CTGGGAGAATGTTGTCAAAAGGG + Intronic
1084928693 11:72535978-72536000 AGGGAGGAATGTTGGGAAAAAGG + Intergenic
1085305147 11:75481653-75481675 CTGCGGGAAGGCTGGGAATGTGG - Intronic
1085483407 11:76841592-76841614 CTGGTGGGATGCTGTGAGAAAGG - Intergenic
1085503304 11:77041269-77041291 CTGGGGTAGTGGTGGGAAGAAGG - Exonic
1085656383 11:78318953-78318975 CTGGGATAATGCTGTGAGAAGGG - Intronic
1087832786 11:102837819-102837841 CTGGTGGCCTCCTGGGAAAAGGG + Intronic
1088212247 11:107469699-107469721 CTGGGGGTGAGCTGGGATAAGGG - Intergenic
1088270480 11:108029089-108029111 ATGGGGGAATACCTGGAAAAAGG - Intronic
1088270501 11:108029209-108029231 ATGGGGGAATACCTGGAAAAAGG - Intronic
1088824697 11:113483820-113483842 CTGAGGGAAGGCTGGGAACATGG - Intergenic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089136616 11:116254364-116254386 CTTGGGGATTTCTGAGAAAATGG + Intergenic
1089251742 11:117168416-117168438 CGGGGGGAATGAAGGGGAAAGGG - Exonic
1089339877 11:117750113-117750135 CTCGGGAAATGTTGGGTAAAGGG + Intronic
1089589190 11:119529622-119529644 CTGGGGAAAATCTGGGAAAAGGG + Intergenic
1090755577 11:129787356-129787378 CATGGGGAATGCTAGGAAGAGGG + Intergenic
1090837322 11:130462803-130462825 CTCGGGGACTGCTGGGAGGAGGG + Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091337443 11:134783029-134783051 CTTGGGGAGTGATGGGAAGAAGG - Intergenic
1091346826 11:134859776-134859798 CTGGGGTAAGGCTGAGAAACTGG + Intergenic
1092122298 12:6052959-6052981 CTTGGGGAAAACTGGGTAAAGGG - Intronic
1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG + Intronic
1093593690 12:20937753-20937775 CTGGGGCCATGTTTGGAAAATGG - Intergenic
1094441712 12:30485427-30485449 CTGTGGCAGGGCTGGGAAAATGG - Intergenic
1095374469 12:41509590-41509612 CTGAGAGAATGCTAGGAATAAGG - Intronic
1095495259 12:42777338-42777360 CTGGGAGAATGTGGGGAAAATGG + Intergenic
1095781993 12:46070786-46070808 GTGGTAGAATGCTGGGACAATGG - Intergenic
1095949238 12:47773058-47773080 TTGGGGGAATGCTGCTAAAAAGG - Intronic
1096123314 12:49102625-49102647 CTGGGGGAAGCCTGGGACTACGG - Intronic
1096716991 12:53497615-53497637 CTGAGGTGATGCTGGGAAGAAGG - Intronic
1096814005 12:54190148-54190170 ATGGGGGAATGGTGGGGGAATGG - Intergenic
1097261092 12:57720691-57720713 CTGGGGGAAGGCAGGGAATGAGG - Intronic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1098740941 12:74172272-74172294 TTGGTGGAAAGCAGGGAAAATGG + Intergenic
1098749059 12:74272312-74272334 CTGGGGCCCTGTTGGGAAAATGG + Intergenic
1099492971 12:83308504-83308526 CTGAGGGAATGCAGTGAAAAGGG - Intergenic
1100536540 12:95516033-95516055 ATGGGGGGAGGCTTGGAAAAGGG - Intergenic
1102415908 12:112762489-112762511 TTGGGGGAAGGCAGAGAAAATGG - Intronic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1102864221 12:116361305-116361327 CTGGTGCAATGCAGGGACAATGG + Intergenic
1103247877 12:119473600-119473622 CTGGGGGAAGGGTGGGAGGAGGG - Intronic
1103427238 12:120846721-120846743 CTTGTGGAAAGCTGGCAAAATGG + Intronic
1103562584 12:121800248-121800270 GTGGGGGAAGCCTGGGAAAGCGG - Intronic
1103988195 12:124780981-124781003 CTGGAGGAATCCTGGGAGAGAGG + Intronic
1104881178 12:132071628-132071650 CTGGGGGACGGATGGCAAAAAGG - Intronic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1106013628 13:25847905-25847927 CTGGGGTGCTGCTGGGCAAAGGG - Intronic
1106386242 13:29288729-29288751 CTGGGGGAGTTTTGGCAAAATGG + Intronic
1107889381 13:44900934-44900956 CTCAGGGAAAGCTGAGAAAAAGG - Intergenic
1107958096 13:45536756-45536778 TTGGGGGGAAGCTGGGCAAAGGG - Intronic
1109018733 13:57056280-57056302 CTGGGGATAGGCTGGGAGAAAGG + Intergenic
1109803404 13:67405175-67405197 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1109847723 13:68018740-68018762 TTGGGGAAATGCTGGTCAAAGGG - Intergenic
1109924920 13:69124155-69124177 TTGGGGGAATGGTGGGAGGAGGG + Intergenic
1110407145 13:75163130-75163152 CTGGGGGCATTCTATGAAAAGGG + Intergenic
1112253835 13:97809165-97809187 CTGGGGAAATGTTGGTCAAAAGG + Intergenic
1112300724 13:98227328-98227350 CTGAGTGAATGCTAGGATAATGG - Intronic
1112324521 13:98434469-98434491 CTGGGGGAAAGCAGTGAAAGAGG + Intronic
1113739724 13:112702842-112702864 CTGGTGAGACGCTGGGAAAAAGG - Intronic
1113869745 13:113551883-113551905 CTGGGGAAATGCTGAGAGCAGGG - Intronic
1114760659 14:25310155-25310177 CAGGGGGAAAGGTAGGAAAAGGG + Intergenic
1116240646 14:42338464-42338486 CTGGGGCCATGTTTGGAAAATGG - Intergenic
1117003287 14:51393551-51393573 CTGTGGGAATGCTGGGCCATGGG - Intergenic
1118140269 14:63072748-63072770 CTGGGAGAGTGCTGGGAAAATGG - Intronic
1118695323 14:68379389-68379411 CAGAGGGACTGCTGGGAGAAGGG + Intronic
1119095330 14:71824639-71824661 ATAAGGGAATGCTGGGGAAAAGG + Intergenic
1120049621 14:79850024-79850046 ATGGAGGAATTCTGGGAGAATGG - Intronic
1120635394 14:86944116-86944138 CTGGTGGAAGGAAGGGAAAAAGG - Intergenic
1121925497 14:97923595-97923617 TTGGAGCAATGCTGGGAAGAGGG + Intergenic
1122272484 14:100574406-100574428 CCGGGGCACAGCTGGGAAAAGGG - Intronic
1122787130 14:104168939-104168961 CTGGGGGTCTGCGGGGAACAAGG + Intronic
1122970323 14:105149809-105149831 GTGGGGGGAGGCAGGGAAAAAGG + Intronic
1123168335 14:106347737-106347759 CTTGGGGAAGACTGGGAGAAAGG + Intergenic
1202839380 14_GL000009v2_random:107253-107275 CCTGGGGATTGCTGGGAAAAAGG - Intergenic
1202908755 14_GL000194v1_random:97406-97428 CCTGGGGATTGCTGGGAAAAAGG - Intergenic
1123414256 15:20083502-20083524 CTGGCGGAAGGCTGGGAACACGG - Intergenic
1123523598 15:21090613-21090635 CTGGCGGAAGGCTGGGAACACGG - Intergenic
1123952490 15:25294958-25294980 CTGGGGGAATGTAGAGAAAAGGG + Intergenic
1126352510 15:47759229-47759251 CTTGGGTAATGCTGGGAATTTGG + Intronic
1127095809 15:55511414-55511436 CTGGGGCCATGTTTGGAAAATGG - Intergenic
1127258586 15:57311191-57311213 CTGGGGCCATGCTGGGAAACAGG + Intergenic
1127395316 15:58539912-58539934 CTGTGGGAGTGCTGGGATGAAGG - Intronic
1129325503 15:74798413-74798435 CTGACTGAGTGCTGGGAAAAAGG - Intronic
1129814769 15:78541658-78541680 CCGGGGGTAGGGTGGGAAAAGGG - Intronic
1130064710 15:80594128-80594150 CTGGGGGAATGCTGGGAAAATGG + Exonic
1131005639 15:88975484-88975506 CTGTGAGAATTCTGAGAAAAGGG - Intergenic
1133393802 16:5430121-5430143 CTGGGGGGATACAGGGAGAAGGG + Intergenic
1135534178 16:23280124-23280146 CTGGCGGAGTGCTGGGCACACGG - Intronic
1135951013 16:26914116-26914138 CTGAGTGAATGGTGGGAGAACGG + Intergenic
1136096930 16:27963453-27963475 CTGGGGGGAGGCTGTGGAAAGGG - Intronic
1137236149 16:46620355-46620377 ATGGGGAGATGCTGGGCAAAGGG - Intronic
1137880122 16:52037320-52037342 GTGGAGAAATGATGGGAAAAAGG + Intronic
1138191279 16:55016182-55016204 GTGGGGGGGTGTTGGGAAAAGGG + Intergenic
1138758169 16:59514110-59514132 CTGGGGGAAAAATGGCAAAAAGG - Intergenic
1141244936 16:82297104-82297126 CTGTGGGATTGCTGGGTCAAAGG + Intergenic
1142562346 17:817898-817920 CTGGGTGAAGGCTGGGAAGGAGG + Intronic
1142806881 17:2376000-2376022 CTGTGGGGATGCTGAGAAATGGG - Intronic
1143727065 17:8856251-8856273 CTGGGGGGAAACTGGGTAAAGGG - Intronic
1143899542 17:10163709-10163731 TTGGGGGCTTGCTGGGAGAATGG - Intronic
1144328409 17:14203787-14203809 CTGTGGGAATGTTCAGAAAAAGG - Intronic
1146409576 17:32571013-32571035 GAGGGGGAGTGCTGGGCAAAAGG + Intronic
1146596843 17:34176825-34176847 CTGTGGCACTGCTGGGCAAAAGG - Intergenic
1146645163 17:34572376-34572398 CTGGGGCAAAGCTAGGAAAGGGG - Intergenic
1147037482 17:37692554-37692576 CTGGGGTGCTGCTTGGAAAATGG + Intronic
1147163164 17:38579323-38579345 CTGGGCGCCGGCTGGGAAAAGGG + Intronic
1147667812 17:42159851-42159873 GTTGGGGAAGGCTTGGAAAAGGG + Exonic
1148359089 17:46996929-46996951 CTGGGAGAATTCTGGGTACATGG - Intronic
1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG + Intronic
1148739023 17:49881339-49881361 CTGGGAGAATGCTGGGCATGGGG - Intergenic
1149232148 17:54546951-54546973 CTGGGGCAGGGGTGGGAAAATGG - Intergenic
1150735962 17:67739856-67739878 CTGAGGAAATTCTTGGAAAAGGG - Intronic
1151010742 17:70492707-70492729 CTGGGGGACTTGGGGGAAAAGGG + Intergenic
1151224561 17:72638982-72639004 CTGTGGGGATGCTGGGATACAGG + Intergenic
1151730808 17:75910114-75910136 TTCGGGCAATGCTGGGAATAGGG + Intronic
1151922079 17:77164470-77164492 AAGGGGGAGCGCTGGGAAAAAGG - Intronic
1152455365 17:80412788-80412810 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1153575112 18:6512169-6512191 CTGGGGGATGAGTGGGAAAAGGG + Intronic
1153830782 18:8920626-8920648 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1155572115 18:27206320-27206342 CTGGAGGAAAGCAGGGAAATTGG - Intergenic
1155738403 18:29253771-29253793 CTTTGGTAATTCTGGGAAAATGG - Intergenic
1155937812 18:31772373-31772395 CCGGGGGAAGGCTGGGAAGGGGG + Intergenic
1157692726 18:49697174-49697196 ATGGGGGAAAGCCTGGAAAAGGG + Intergenic
1159299087 18:66539062-66539084 CTGGGTAAATGCTTGGAAGAGGG + Intronic
1159554230 18:69928498-69928520 CCGGGGGAATGCAGGAAACATGG + Intronic
1160181578 18:76641411-76641433 GTGGGGAGATGCTGGTAAAAGGG - Intergenic
1161266046 19:3365357-3365379 CTGTGGGATTGCTGGGGATAAGG - Intronic
1161326344 19:3665995-3666017 CTGGGAGAATGCAGGGAACATGG - Intronic
1161680129 19:5676018-5676040 CTGGGGGGATGCTGGGCTCAGGG - Intronic
1162289896 19:9771120-9771142 CTGGGGGAAGGGTGGGAGAAGGG - Intronic
1163038145 19:14583460-14583482 CTGGGGGAATACAGGGAATGGGG + Intronic
1163038834 19:14587717-14587739 CTGGGGGAATACAGGGAACGGGG + Intronic
1163039579 19:14592384-14592406 CTGGGGGAATACAGGGAACAGGG + Intronic
1163207955 19:15817711-15817733 CTGGGAGGATGCTGAGAAAAGGG - Intergenic
1164444426 19:28305140-28305162 CTTGGGGAATGCTGGTGAGAAGG - Intergenic
1166827416 19:45617997-45618019 ATGTGGGAATGCTGGGACAAAGG + Intronic
1166875357 19:45893633-45893655 CTGGGGGAAGACAGGGAAGATGG + Intronic
1168360764 19:55738043-55738065 ATGGGGGAAGCCTGGGAACAAGG - Intronic
1202633657 1_KI270706v1_random:23282-23304 CCTGGGGATTGCTGGGAAAAAGG + Intergenic
1202652225 1_KI270707v1_random:16772-16794 CCTGGGGATTGCTGGGGAAAAGG - Intergenic
1202659915 1_KI270708v1_random:58958-58980 CCTGGGGATTGCTGAGAAAAAGG + Intergenic
926635388 2:15173611-15173633 CTGATGGTATGCTGAGAAAATGG - Intronic
926657997 2:15430735-15430757 GAGGGGGAATGGTGGAAAAATGG - Intronic
930202624 2:48559719-48559741 CTGGTGGTATGGTAGGAAAAGGG - Intronic
933099994 2:78243063-78243085 CTGGGTGGAGGCTGGGAAGAAGG - Intergenic
933282666 2:80349328-80349350 CTGAGAGAATGCTAGCAAAAAGG + Intronic
933506845 2:83187466-83187488 CTGGGGGAATGCTGAAAACCAGG - Intergenic
933688718 2:85162888-85162910 AGCGGGGAATGGTGGGAAAAAGG - Intronic
935404709 2:102697075-102697097 CTGAGGGGATGCTAGGGAAAGGG - Intronic
935721075 2:105979822-105979844 CTGGGGCCATGTTTGGAAAATGG - Intergenic
936020905 2:108994127-108994149 TGGGGGGAATCCTGGGCAAATGG - Intergenic
936666085 2:114597265-114597287 ATAGGGGAATGGTGGGAATAAGG + Intronic
937033723 2:118763452-118763474 GTGGGGGCATGCTGTGGAAAAGG + Intergenic
937279225 2:120705892-120705914 ATGGGTAAGTGCTGGGAAAAGGG - Intergenic
937880184 2:126858819-126858841 CTGGAGGAAAGCAGGGAGAATGG - Intergenic
938768380 2:134479261-134479283 CAGGGGGCATGTTGGGAGAAGGG - Intronic
939035566 2:137126913-137126935 ATGGGGGAATGGTGGGTAAGTGG + Intronic
939442801 2:142271745-142271767 TAGAGGGAAAGCTGGGAAAATGG - Intergenic
940166596 2:150780473-150780495 CTGTGGCAAAGCAGGGAAAAAGG - Intergenic
941923286 2:170872511-170872533 CCTGGGGAAAGATGGGAAAAAGG + Intergenic
942189061 2:173453294-173453316 CTGGGGGTGTGATGGGGAAAGGG + Intergenic
942338118 2:174913235-174913257 CTGGAGAAATGCAGGGGAAATGG + Intronic
943326752 2:186508406-186508428 CTGGAGTAATTCTGGGGAAATGG + Intronic
943894767 2:193342218-193342240 CTGAGGGAATAATGGGAGAACGG - Intergenic
944222262 2:197314190-197314212 CTGAGCGAGTACTGGGAAAAAGG + Intergenic
945187838 2:207157631-207157653 CTGGGGTGATGGTGGCAAAAAGG + Intronic
946333213 2:219021998-219022020 CTTGGGGGATGCTCTGAAAATGG - Intronic
946433916 2:219639861-219639883 CTAGGGGAGTGCTGGGAAGCAGG - Intronic
948093795 2:235317285-235317307 ATGGGGGAATATTGGTAAAATGG + Intergenic
948125430 2:235561500-235561522 TTGGAGGGATGCTGGGAGAAGGG + Intronic
948223619 2:236292028-236292050 CTTGGGGAGTGCCGGGAAAGAGG + Intergenic
948326794 2:237128327-237128349 CAGGGGGCATGCAGGGGAAAGGG - Intergenic
1169984488 20:11428164-11428186 ATGCCGGATTGCTGGGAAAAAGG - Intergenic
1170207311 20:13812351-13812373 CTTGGGGTATGCTGGGGAAGGGG - Intronic
1170586587 20:17739429-17739451 CATGGGGAATGCAGGGAGAAGGG - Intergenic
1170964443 20:21053404-21053426 CTGGGGGCATGCTGAGACAAAGG + Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171467678 20:25342522-25342544 CTGTTGGAATGTTGGAAAAATGG - Intronic
1172413899 20:34748394-34748416 TTGTGGGAAGGCTGGGATAAAGG + Intronic
1172933314 20:38601267-38601289 CTGGGGAAAGGCTGGGTAAGGGG - Intergenic
1172946447 20:38693177-38693199 CTGGGGGCCTGCTGGGAGGAGGG - Intergenic
1173728801 20:45314490-45314512 CTGGGGGACTGCCTGGAAACTGG - Exonic
1173849642 20:46209940-46209962 CTGGGGGAGTCCTGGGCACAGGG + Intronic
1174039268 20:47687447-47687469 CTGGGGAAATGGCGGGAAGATGG + Intronic
1174213737 20:48900193-48900215 CTGCAGGAATAATGGGAAAAGGG - Intergenic
1174599174 20:51710477-51710499 CTGGGAGATTGCAGGGAAGAGGG - Intronic
1174951604 20:55047749-55047771 CTGGGGATATGGTGGTAAAAGGG + Intergenic
1175609898 20:60342179-60342201 CTTGGAGAATGCTGGGATGAAGG - Intergenic
1176599926 21:8782882-8782904 CCTGGGGATTGCTGGGGAAAAGG + Intergenic
1176628117 21:9112069-9112091 CCTGGGGATTGCTGGGAAAAAGG - Intergenic
1176645869 21:9349139-9349161 CCTGGGGATTGCTGGGAAAAAGG + Intergenic
1177354906 21:19995901-19995923 CTGGGGCTATGTTTGGAAAATGG - Intergenic
1178229779 21:30768753-30768775 CTGGCAGAATGCTGGGAGGATGG - Intergenic
1178506188 21:33165121-33165143 CTGGCTGAAAGCTGGGGAAATGG + Intergenic
1179979949 21:44890654-44890676 GTGGGAGAATGCAGGGACAAGGG + Intronic
1180327387 22:11442520-11442542 CCTGGGGATTGCTGAGAAAAAGG + Intergenic
1180367057 22:11950014-11950036 CCTGGGGATTGCTGGGAAAAAGG - Intergenic
1180379027 22:12121337-12121359 CCTGGGGATTGCTGGGAAAAAGG + Intergenic
1180418498 22:12791979-12792001 CCTGGGGATTGCTGGGGAAAAGG - Intergenic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181002284 22:19993495-19993517 CTGGGGGAAGGCTAGGAAGGGGG + Intronic
1181017512 22:20079929-20079951 CGCGGGGAATGCCGGGAACAGGG - Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181547872 22:23613546-23613568 CTGGGGTCCTGCTGGGAAAGAGG - Intronic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181751099 22:24989732-24989754 CTTGGGGAGTGGTGGGGAAAGGG - Intronic
1182426377 22:30275133-30275155 CCGGGAGAATGCATGGAAAAGGG - Intergenic
1182545863 22:31076066-31076088 CTGGCGGAAGGCTGGGAACACGG + Intronic
1183952290 22:41358519-41358541 CTGGGGGAATGCGGAGAAAAGGG + Exonic
1184460202 22:44633529-44633551 CTGGATGAATGCATGGAAAATGG + Intergenic
1185415084 22:50705353-50705375 CTGGGGGAACGCCGGGAAGGAGG - Intergenic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
950336179 3:12195350-12195372 CTGGAGGAGTCCTGGGGAAAGGG - Intergenic
951129422 3:19024111-19024133 ATGGGGGATTGGTGGTAAAATGG + Intergenic
951637195 3:24792543-24792565 CTGGGGAACTTCTGGGAAACAGG - Intergenic
951829922 3:26915048-26915070 CTGAGGGAAGGCTGGGGAGAAGG + Intergenic
953241715 3:41155422-41155444 CTCGGGGTGTGCAGGGAAAAGGG + Intergenic
954229929 3:49209017-49209039 CTGGTTGAATTCTGGGAAGATGG + Intronic
955434488 3:58887928-58887950 ATGGTGGAATACTTGGAAAAGGG + Intronic
956630823 3:71315026-71315048 CTGGGATAAGGCTGGGTAAAAGG + Intronic
957094324 3:75764307-75764329 CCTGGGAACTGCTGGGAAAAAGG - Intronic
957406624 3:79780248-79780270 CTGGGGCCATGTTTGGAAAATGG + Intergenic
957419035 3:79944745-79944767 CAATGGGAATGCTGTGAAAAGGG + Intergenic
959606999 3:108251855-108251877 ATTGGGGTATGCTGGGTAAAGGG - Intergenic
960013756 3:112862049-112862071 GTGGGGGAATGGTGGGAAGGTGG - Intergenic
960089647 3:113626497-113626519 CTGGGGGAATTCTGGGCATGTGG - Intronic
960737716 3:120798907-120798929 CAGAGGGAATGTGGGGAAAAGGG - Intergenic
961439021 3:126940688-126940710 CTTGGGAAGTCCTGGGAAAATGG - Intronic
961511517 3:127406644-127406666 GTGGGGGAATGTTGGGCAGAGGG + Intergenic
962897346 3:139728312-139728334 CTGTGAGAAAGCAGGGAAAATGG + Intergenic
963550836 3:146720850-146720872 ATGGGTGAAGGATGGGAAAAGGG - Intergenic
963708293 3:148716147-148716169 CTGGTGGAGTGCTCTGAAAAGGG - Intronic
963747325 3:149138012-149138034 CTGGGGGAATTTTAGGAAGATGG + Intronic
964015048 3:151934679-151934701 ATGGGGGAGTGCTGAGAAACAGG + Intergenic
964259243 3:154816027-154816049 ATGGGGGTATGTTGGGCAAAGGG + Intergenic
964521980 3:157579941-157579963 CTGGGGCCATGTTTGGAAAATGG - Intronic
964653509 3:159040192-159040214 CTGGAGGAATGCTGGAAGAGAGG - Intronic
964932593 3:162045236-162045258 CTGGGGCCATGTTTGGAAAATGG - Intergenic
965226954 3:166002196-166002218 CTTGGGGAAGGATGGGAGAAAGG + Intergenic
967687718 3:192437140-192437162 CAGGGAGAACTCTGGGAAAATGG + Intronic
967926321 3:194651489-194651511 GTGAGGGAAGGCTGGGAACAAGG - Intronic
967997170 3:195175377-195175399 CTGGGGGAATGCGGACAGAAGGG + Intronic
1202741016 3_GL000221v1_random:55924-55946 CCTGGGGATTGCTGGGAAAAAGG - Intergenic
969157658 4:5225634-5225656 CTGGCTAAATGCTGTGAAAATGG - Intronic
969349814 4:6591868-6591890 CAGGGAGAATGCTTGGAACAGGG - Intronic
969435211 4:7185539-7185561 CTGGGGGAGGTCTGGGAAAGTGG - Intergenic
969544593 4:7816986-7817008 CTGGGGGAATCCAGGGCAACAGG + Intronic
971147019 4:23988418-23988440 CTGGGGGAATGTGGAGAAATAGG - Intergenic
971198839 4:24493639-24493661 CTGGGGGACTGCAGTGGAAAAGG + Intergenic
971292393 4:25356237-25356259 CAGGGATAATGATGGGAAAATGG + Intronic
971452152 4:26810239-26810261 CTGGGGGAGTGAGGGGAAATGGG - Intergenic
971666976 4:29499955-29499977 CTGTGGGAATTCTGTGAACATGG - Intergenic
973363289 4:49185300-49185322 CCTGGGGATTGCTGGGGAAAAGG + Intergenic
973397806 4:49611556-49611578 CCTGGGGATTGCTGGGGAAAAGG - Intergenic
974349380 4:60724671-60724693 CTGGGGGAAAGCAGGGAATAAGG - Intergenic
975575159 4:75855224-75855246 CAGGGGGATAGATGGGAAAAGGG + Intergenic
976442455 4:85090663-85090685 CTGGGGAGATGCTGGCAAAAGGG + Intergenic
977692726 4:99933699-99933721 TTGTGGGAATTCTGGAAAAAAGG + Intronic
977972798 4:103230728-103230750 CTGGGGCTATGTTTGGAAAATGG + Intergenic
978635821 4:110804731-110804753 CTGGAGGTCTGCTGGGGAAAGGG + Intergenic
980073417 4:128266961-128266983 CTGGGGCCATGTTTGGAAAATGG + Intergenic
980880673 4:138707208-138707230 CTGGTGTAATGCTGGGAAAAGGG - Intergenic
981940933 4:150280917-150280939 GTGCAGGAGTGCTGGGAAAAAGG + Intronic
982527006 4:156490976-156490998 CTTGGGGAAGGATGGGAGAAAGG - Intergenic
982529816 4:156525408-156525430 CCGGGGGAATGATGGGACTAAGG + Intergenic
983221321 4:165046832-165046854 GTGGGGAGATGCTGGTAAAACGG + Intergenic
983898371 4:173105518-173105540 CTGGGGCCATGTTTGGAAAATGG + Intergenic
984624152 4:181986930-181986952 CTGGAGCAATGATGGGAGAATGG + Intergenic
1202760645 4_GL000008v2_random:106817-106839 CCTGGGGATTGCTGGGAAAAAGG + Intergenic
985961615 5:3307045-3307067 GTTGGGGAATGCTGGGAAAGAGG - Intergenic
986442782 5:7796365-7796387 CTGGAACAATGCTTGGAAAATGG + Intronic
987147475 5:15006263-15006285 CTTGGGGCATTCTGGGAACACGG - Intergenic
988991180 5:36672409-36672431 GTGGGGGAATGCTGAGCAGATGG - Intronic
989134974 5:38144698-38144720 ATGGGAGAATGCTGTGACAAGGG + Intergenic
989995708 5:50827976-50827998 CTGGTGGACTGCTGAGAAGAAGG - Exonic
990887206 5:60608087-60608109 CAAGGGGAAAGCAGGGAAAAAGG + Intronic
991026780 5:62038104-62038126 GTGGGGGATTGCTGGCAAGATGG - Intergenic
991155415 5:63428927-63428949 CAGGGGGAGTCCTGAGAAAAGGG - Intergenic
991675760 5:69088522-69088544 CTGGGGCCATGTTTGGAAAATGG - Intergenic
992001942 5:72444321-72444343 CTGAGGAAATGCTGTGGAAATGG + Intronic
992085158 5:73271586-73271608 ATGGGGGAAGACTGGGAAAGAGG + Intergenic
992862800 5:80929272-80929294 ATGGGGCCATGCTTGGAAAAGGG - Intergenic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
995385563 5:111585092-111585114 CTGTGAGAATGCAGGGAAATAGG + Intergenic
995471125 5:112503286-112503308 CTGGGAGATTGCTGGCAAGATGG + Intergenic
995522581 5:113025013-113025035 CTGGGGGAATTCTCAGAGAAGGG + Intronic
996470636 5:123856077-123856099 CTGGAAGAATGGTGGGAATAAGG - Intergenic
997414345 5:133713608-133713630 CAGGGGGTATCCTGGGAAGATGG - Intergenic
997676295 5:135715482-135715504 AAGGGGCAATGCTGGGAAAGGGG - Intergenic
997797223 5:136822394-136822416 CTTTGGGGATGCTGGGGAAAGGG - Intergenic
998175640 5:139900434-139900456 CTGGAGGAAGACTGGGAAAATGG + Intronic
998778865 5:145633903-145633925 CTATGGGAATGCAGGGAACATGG - Intronic
999238566 5:150114459-150114481 CCGGGGGTATCCTGGGCAAAAGG - Exonic
999338033 5:150740894-150740916 CAGGGGGAAAGCTGGGAAGGGGG + Intronic
1000206253 5:159062377-159062399 CTTGGAGAAGGCTGGGGAAAGGG + Intronic
1001020130 5:168175723-168175745 CTGGGGTTATGCTGGAAAAGAGG + Intronic
1001052027 5:168421285-168421307 CACAGGGAAGGCTGGGAAAATGG + Intronic
1001285259 5:170418447-170418469 CTGGAGAAATGATGGGAAGAGGG - Intronic
1001413772 5:171528921-171528943 CTCGGGGAAGGCTTGGAAGAGGG - Intergenic
1001651352 5:173318339-173318361 CAGGGGCAATGCTGGGAAGGAGG + Intronic
1001770387 5:174291689-174291711 TTGGGGGATAGCTGGGAAAGTGG + Intergenic
1002172833 5:177385002-177385024 CTGGGGCAGTGCGGGGACAAGGG + Intronic
1002189652 5:177472048-177472070 CTGGGGCAGGGCTGGGACAATGG + Intronic
1002915296 6:1524003-1524025 CTGTGTGAATGCAGGGAAAGCGG + Intergenic
1002998707 6:2311118-2311140 CTGGGGCCATGTTTGGAAAATGG - Intergenic
1003013271 6:2446692-2446714 CTGGGGAGATGCTGGTCAAAGGG - Intergenic
1003401099 6:5791656-5791678 ATGGGGAAATGCTGGTCAAAGGG - Intergenic
1004878681 6:19983692-19983714 CTCGGAGAATGCTGGGAGAAAGG + Intergenic
1006089954 6:31622514-31622536 CTGGGGGAAAGGAGGGAACATGG + Intronic
1006308416 6:33239519-33239541 CTGGAGGAATGCAGAGGAAACGG + Intergenic
1007461250 6:42020670-42020692 CTGTGGGAATTCTGAGAGAAGGG - Intronic
1008001163 6:46361209-46361231 CTGGGGGAAGGGTGAGAGAAAGG + Intronic
1008055164 6:46938439-46938461 CTTGGGGGCTGCTGTGAAAAAGG + Intronic
1008409268 6:51154296-51154318 TTGGGGGAAGGGTGGGAAGAGGG - Intergenic
1010725773 6:79331017-79331039 TTGGGGGGATGCCGGGAGAAAGG - Intergenic
1010802581 6:80194311-80194333 ATGGGGGAATGCTGAGTGAAAGG - Intronic
1011913366 6:92470065-92470087 ATTGGGGAATGCAGGGAAGATGG + Intergenic
1012845470 6:104382000-104382022 ATGGGGGAATGTTAGGGAAATGG + Intergenic
1012926082 6:105269269-105269291 CTGGGGAAATGCTGGCAGAGAGG - Intergenic
1012972018 6:105741391-105741413 CTGGGGCAATGCTCAGAATAGGG + Intergenic
1014546482 6:122742227-122742249 CTGGGGCCATGTTTGGAAAATGG - Intergenic
1015546324 6:134365337-134365359 CTGGGGGATTGATGGGGAGATGG + Intergenic
1015937872 6:138420725-138420747 CCAGGGGAACTCTGGGAAAAAGG - Exonic
1017076895 6:150626978-150627000 CATGGGACATGCTGGGAAAAAGG + Intronic
1018176033 6:161180216-161180238 CTTGGGGAATGGTGGGGAAGGGG - Intronic
1018252935 6:161890560-161890582 TTGGGGGAATGCTGGAGAAAAGG + Intronic
1018988824 6:168658086-168658108 CTGGGGGACTGATGGGGAGATGG + Intronic
1020043432 7:5021592-5021614 CTGGGGCCATGTTTGGAAAATGG - Intronic
1021605618 7:22406538-22406560 CTGGGGAAATCCAGGGGAAAAGG - Intergenic
1021888552 7:25164773-25164795 CAGGGGGAAGGTTGGGAAAGGGG - Intronic
1022230223 7:28406871-28406893 CTGGGGGAATTATGGGGTAAAGG + Intronic
1022440442 7:30428733-30428755 CTGGGTGGATGCTGGGAGAGGGG - Intronic
1022596493 7:31718275-31718297 CGGGAGGAAGGCTTGGAAAATGG + Intergenic
1022895792 7:34749233-34749255 ATGGGGGAATGTGTGGAAAAAGG + Intronic
1023321282 7:39000508-39000530 CTGTGGGTATGTTGAGAAAATGG - Intronic
1026982698 7:74536058-74536080 CTGGGGGAATCCCGGGGATAGGG - Intronic
1029074585 7:97925818-97925840 CTTGGGGAAGGCTGAGCAAATGG + Intergenic
1029124676 7:98287885-98287907 CTGGGAGGAGGCTGGGCAAAGGG - Intronic
1030956938 7:115864609-115864631 CTGGGATAATCTTGGGAAAATGG - Intergenic
1031256990 7:119465557-119465579 CTGGTGGAAGGGTGTGAAAAAGG - Intergenic
1031783716 7:126002309-126002331 CTGGGGTAAGGCTGGGAATTGGG + Intergenic
1031783921 7:126004891-126004913 CTGGGCAAATGCTGGAAGAATGG + Intergenic
1031798948 7:126217439-126217461 CTGGGGGAAGGGTGGGAAGGGGG - Intergenic
1032282012 7:130511470-130511492 CTGTGGGAATGCTGTACAAATGG + Intronic
1032529740 7:132610244-132610266 CTGGGGAATTTCTGGGAAGATGG + Intronic
1032911800 7:136440855-136440877 CAGGGGAAATGGTGGGAGAAGGG - Intergenic
1034263487 7:149771199-149771221 CTGGGGGAAATTTGGGAAACTGG + Intronic
1034460033 7:151193095-151193117 GTGGGGGAATGAAGGGAAAAGGG - Intronic
1036409856 8:8489372-8489394 CCGGGTGTATGCTGGGCAAAGGG - Intergenic
1038066852 8:23972344-23972366 CTGGGAGAATGCTAGCAACATGG + Intergenic
1039876593 8:41591693-41591715 CTGGGGCCATGTTTGGAAAATGG - Intronic
1040704942 8:50114534-50114556 CTGGGGAAATGTTGGCCAAAGGG + Intronic
1041058615 8:54014205-54014227 CTGGCGCACTGCTGGGGAAAGGG - Intronic
1041986956 8:63933340-63933362 ATGGGGAATTGCTGGGCAAAGGG - Intergenic
1042723614 8:71849188-71849210 CTGGGGGTAGGCTGGGGAGAGGG + Intronic
1043028926 8:75106645-75106667 CTGGGGGAAGGCTGTGGAGATGG + Intergenic
1043517147 8:81005268-81005290 CAGGGGGAATTCTGAGAGAATGG + Intronic
1044616214 8:94145012-94145034 CTGGGAGAATGCTGAGCAACTGG + Intronic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1045407060 8:101877385-101877407 ATAGGGGAATGCTGGGTAATTGG - Intronic
1047057291 8:121180049-121180071 CAGGGGGAATGCGTGGAAAGAGG + Intergenic
1047338053 8:123955001-123955023 CTGGGGGACTGCTGAGAACAGGG - Intronic
1048471011 8:134704133-134704155 CTCAGGTAATGCAGGGAAAAGGG - Intronic
1048475632 8:134740003-134740025 CTGGGGGGATTCTGAGAAATAGG - Intergenic
1052458484 9:28731834-28731856 CTTGGGGGATGCTGGGAAAAGGG + Intergenic
1052508489 9:29383942-29383964 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1052764687 9:32629377-32629399 CAGGGGAAATGGTAGGAAAATGG - Intergenic
1053221675 9:36317978-36318000 CTGGGAGGATGCTGGAGAAACGG - Intergenic
1055442330 9:76348770-76348792 CTGGGGAGATGCTGGTCAAAGGG - Intronic
1057035957 9:91811727-91811749 CTGAGGGAGTGCAGGGAAACAGG - Intronic
1057785658 9:98085642-98085664 CTGCAGGAATCCTGAGAAAAAGG - Exonic
1058753881 9:108066122-108066144 ATGGGGGAATGTTTTGAAAAGGG + Intergenic
1058792440 9:108463858-108463880 CTGGTGGAGTGCTTGTAAAATGG - Intergenic
1058794996 9:108489293-108489315 ATGGGGGAATGCAGCAAAAAGGG - Intergenic
1060492011 9:124091977-124091999 TTGGGGGCATACTGAGAAAATGG + Intergenic
1060601715 9:124882463-124882485 CAGGGGGAGTGCTGGGAAGTGGG + Intronic
1060982281 9:127800296-127800318 CTGGGGGCATCCTGGGAGAGGGG + Intronic
1061176981 9:129003483-129003505 CTGGGGTAATGCTTGGAGACAGG + Intronic
1061180478 9:129022475-129022497 GTGGGGGAGTGGTGGGGAAAGGG + Intronic
1061954939 9:133956387-133956409 CTGGGGGCCTGGTGGGGAAAGGG + Intronic
1062447779 9:136602822-136602844 ATGGTGGGATGCTGGGGAAAAGG - Intergenic
1062453034 9:136623436-136623458 CTGGGTGAATGCTGGGAATGTGG + Intergenic
1203750960 Un_GL000218v1:79749-79771 CCTGGGGATTGCTGGGAAAAAGG - Intergenic
1203709655 Un_KI270742v1:85854-85876 CCTGGGGATTGCTGGGAAAAAGG - Intergenic
1203541415 Un_KI270743v1:91702-91724 CCTGGGGATTGCTGGGAAAAAGG + Intergenic
1185764292 X:2712239-2712261 ATGGGGAAATGATGGGTAAAGGG + Intronic
1185910380 X:3975451-3975473 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1187550486 X:20298288-20298310 TTGGTTGAATGCAGGGAAAAGGG + Intergenic
1187865983 X:23723772-23723794 CTGGGGGAATGATAGGCTAAAGG + Intronic
1188618342 X:32187814-32187836 CTGGAGAAAAGATGGGAAAACGG + Intronic
1189758817 X:44299868-44299890 ATCGGGGAAAGCTGTGAAAAGGG + Intronic
1190270699 X:48861062-48861084 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1190771699 X:53520039-53520061 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1192366074 X:70474457-70474479 CTGGTTGTATGCAGGGAAAAGGG + Intronic
1192478555 X:71464984-71465006 CAGGGGAAATGGTAGGAAAATGG + Exonic
1193966445 X:87992787-87992809 CTGGGAGGATGTAGGGAAAAGGG - Intergenic
1194347369 X:92782817-92782839 CAGGGGGAAGGGTGGGAAAGAGG + Intergenic
1194384799 X:93238914-93238936 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1194504733 X:94719631-94719653 TTGAGGGAGTGCTGGGAAGAGGG - Intergenic
1196018048 X:110960340-110960362 ATGAGGGAATGCTGGGAGAGAGG + Intronic
1196048103 X:111277180-111277202 ATCGGGGAAAGCTGAGAAAAGGG + Intergenic
1196050437 X:111298380-111298402 CCAGGTGAATGCAGGGAAAAGGG + Exonic
1196569559 X:117249433-117249455 CTGTGTTAATGCTTGGAAAAAGG + Intergenic
1198993162 X:142539801-142539823 CTGGGTATATGCTCGGAAAAGGG + Intergenic
1199876977 X:151940566-151940588 TTTGGGGAAGTCTGGGAAAAGGG - Intergenic
1199996372 X:153029101-153029123 CTGGGGCTATGCAGGGAAACTGG - Intergenic
1200222912 X:154400645-154400667 CTGGGGCAAAGGTGGGAGAAGGG - Intronic
1200943761 Y:8810979-8811001 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1201164615 Y:11197374-11197396 CCTGGGGATTGCTGGGAAAAAGG - Intergenic
1201297060 Y:12472936-12472958 CTGGGGCCATGTTTGGAAAATGG - Intergenic
1201346891 Y:12994416-12994438 GGGGGGGCATGTTGGGAAAAAGG - Intergenic
1201556632 Y:15269799-15269821 CTGGGGCCATGTTTGGAAAATGG + Intergenic