ID: 1130065284

View in Genome Browser
Species Human (GRCh38)
Location 15:80597623-80597645
Sequence CCTCCATTTTGCCACTTTCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130065284_1130065289 1 Left 1130065284 15:80597623-80597645 CCTTGAAAGTGGCAAAATGGAGG 0: 1
1: 0
2: 0
3: 23
4: 209
Right 1130065289 15:80597647-80597669 TTCACAGGCTGTGCGGGAGCAGG 0: 1
1: 0
2: 1
3: 15
4: 180
1130065284_1130065288 -5 Left 1130065284 15:80597623-80597645 CCTTGAAAGTGGCAAAATGGAGG 0: 1
1: 0
2: 0
3: 23
4: 209
Right 1130065288 15:80597641-80597663 GGAGGTTTCACAGGCTGTGCGGG 0: 1
1: 0
2: 1
3: 29
4: 280
1130065284_1130065287 -6 Left 1130065284 15:80597623-80597645 CCTTGAAAGTGGCAAAATGGAGG 0: 1
1: 0
2: 0
3: 23
4: 209
Right 1130065287 15:80597640-80597662 TGGAGGTTTCACAGGCTGTGCGG 0: 1
1: 0
2: 1
3: 20
4: 533
1130065284_1130065290 5 Left 1130065284 15:80597623-80597645 CCTTGAAAGTGGCAAAATGGAGG 0: 1
1: 0
2: 0
3: 23
4: 209
Right 1130065290 15:80597651-80597673 CAGGCTGTGCGGGAGCAGGACGG 0: 1
1: 0
2: 3
3: 60
4: 532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130065284 Original CRISPR CCTCCATTTTGCCACTTTCA AGG (reversed) Exonic
902743546 1:18457525-18457547 TCTTGGTTTTGCCACTTTCAGGG + Intergenic
904329673 1:29750239-29750261 CCAGCTTTTTGCCACTTACATGG - Intergenic
905109343 1:35583833-35583855 CATCCCTCTTGCCATTTTCAAGG + Intronic
905723564 1:40228622-40228644 CCTGCCTTTTACCACTTTAATGG + Intronic
907582470 1:55584391-55584413 CCCCCACTCTGCCACTTTCAGGG - Intergenic
907800378 1:57759176-57759198 CTTCCATTTTGTCAATTCCAGGG + Intronic
907911265 1:58828669-58828691 TCTCCATTTCTCCACTTACAAGG + Intergenic
908301623 1:62766908-62766930 CTTAAATTTTGCCACTTCCATGG - Intergenic
908301657 1:62767771-62767793 CTTAAATTTTGCCACTTCCATGG + Intergenic
910006915 1:82408565-82408587 CCTTCATTTTCCCACTTTATAGG - Intergenic
914963449 1:152228428-152228450 TCTCCATTTGTCCACTTTAATGG - Intergenic
915937953 1:160099812-160099834 CCTCCATTCTCCCACCTCCAGGG - Intergenic
919212679 1:194509186-194509208 CCTGCATTTTCCCCCTTCCATGG - Intergenic
919591742 1:199511972-199511994 CCTCCCATTTTCCACTTTTATGG + Intergenic
920988244 1:210910889-210910911 CCTCTTTTATGCCACATTCATGG + Intronic
921593109 1:217026250-217026272 CCTCCATTTGGCCAATTGGATGG - Intronic
1062919282 10:1266828-1266850 CCTCCATTCTTCCTTTTTCAAGG - Intronic
1065526289 10:26624667-26624689 TCTTTTTTTTGCCACTTTCATGG - Intergenic
1065563908 10:26990034-26990056 CCCCCATTTTGCTACTCTCTAGG + Intergenic
1065667165 10:28074810-28074832 CCTTCATGTTTCCACTTTCACGG + Intronic
1066293996 10:34038398-34038420 CCCCAATTTTTCTACTTTCAAGG + Intergenic
1069687316 10:70326528-70326550 CTTCCATTTTTCCATCTTCAGGG + Intronic
1069892493 10:71661063-71661085 CCTCCGTTATGCCCCTTTCATGG - Intronic
1069967038 10:72128272-72128294 TCTTCATTATGCCACTTTCCAGG - Intronic
1070025951 10:72632212-72632234 CCACCATTTTGCAACTATCATGG + Intergenic
1071104042 10:82073604-82073626 TCTCTTTTTTGCCATTTTCATGG + Intronic
1072650846 10:97294035-97294057 CGTCCATTTTTCCACTTTTTTGG + Intergenic
1073066598 10:100763647-100763669 AGTCCATTTTGCCATTTTAAGGG + Intronic
1074163238 10:110851871-110851893 CCTCGATTTTGCCACTTGCCTGG + Intergenic
1074736716 10:116442370-116442392 CCTCCATTTTGCCATGTTTTTGG + Intronic
1075271473 10:121055529-121055551 CCTCCAACTTACCTCTTTCAAGG - Intergenic
1075627778 10:123974983-123975005 CCTGCAGTCTGCCACTTACAAGG + Intergenic
1076476550 10:130757717-130757739 CCTCCTTCTTCCCAGTTTCAGGG + Intergenic
1076518227 10:131062114-131062136 TGTCCCCTTTGCCACTTTCAGGG + Intergenic
1078462510 11:11525311-11525333 CCTCCATTCTACCACTTCTAGGG - Intronic
1080228669 11:29990455-29990477 GGCCCATTTTGCCACTTTGATGG - Intergenic
1081438180 11:43051409-43051431 CCTCCATGTGGGCACTTACAAGG + Intergenic
1081709177 11:45206024-45206046 CCTCCCTGGGGCCACTTTCAGGG - Intronic
1082765582 11:57164944-57164966 CAGCCAATTTGTCACTTTCATGG + Intergenic
1086766934 11:90707093-90707115 ACTCCATTTTTCACCTTTCAAGG - Intergenic
1087335347 11:96837239-96837261 CCTTCATTTTGAGTCTTTCAAGG + Intergenic
1087630059 11:100639396-100639418 CATCCATTTTCCCACTGCCAAGG + Intergenic
1087993725 11:104778089-104778111 CCTGCACTTTGCCACCTACATGG + Intergenic
1089820512 11:121221508-121221530 GCTCCATTTTGCCTATGTCATGG - Intergenic
1090985315 11:131761137-131761159 CCTGCCTCTTGCCACTTTCACGG - Intronic
1091594965 12:1872063-1872085 CCTCCCATTTGCCACTTTGATGG - Intronic
1092259593 12:6945931-6945953 CCTCCCTTGTGCCACTGCCAGGG + Exonic
1094365522 12:29675836-29675858 TTTCCATTTTGTTACTTTCATGG - Intronic
1096080292 12:48828254-48828276 CCACCCTTTTGTCACTTTAATGG - Exonic
1096549621 12:52363617-52363639 CCTCAGTTTTCCCACTTTTAAGG - Intronic
1097722576 12:63039350-63039372 TCTGCTTTTTGCCATTTTCATGG + Intergenic
1098816371 12:75170240-75170262 CCTCCATTTTGCTATCTTAAAGG - Intronic
1099967537 12:89465401-89465423 TATCCATTTGGCCACTTTCCAGG - Intronic
1101417720 12:104522878-104522900 CCACCATTTTGCCTTTATCAAGG - Intronic
1101660416 12:106760098-106760120 CCTCCACTTTCCAACTGTCAGGG + Intronic
1105409893 13:20162146-20162168 CTTGCATTTTGCCACATTCCTGG - Intergenic
1106063964 13:26325796-26325818 CCTCCTTTTGGCCAGATTCAGGG + Intronic
1106358116 13:29004013-29004035 CCCTCATTTTGCTACTTTTATGG + Intronic
1106437086 13:29732672-29732694 CCTCCATATTGCCAACTTCAAGG + Intergenic
1107139876 13:36987087-36987109 CCTCCTCTTTGCCAGTTTAATGG + Intronic
1107549427 13:41461084-41461106 CCTTCCTGTTCCCACTTTCAGGG + Intronic
1110124943 13:71931204-71931226 CTTCCATATTACCACTATCATGG - Intergenic
1113090658 13:106614520-106614542 CCTCATTTTTGTCACTTTAATGG - Intergenic
1113433056 13:110266825-110266847 CTTACATTTTGCCACATTCGTGG - Intronic
1113678446 13:112224581-112224603 CACCCAACTTGCCACTTTCATGG + Intergenic
1114166414 14:20223207-20223229 CCTTCCTTTTGCTACTCTCAGGG - Intergenic
1115635347 14:35285692-35285714 CCTCCCTTTCCCCACCTTCAGGG + Intronic
1115989497 14:39137765-39137787 GCTTCATTTTCCCACTTTCCTGG - Intergenic
1117814560 14:59583467-59583489 CCTCCCTTTTCCCACCTTCAAGG - Intergenic
1117901331 14:60536625-60536647 CCTACATGTTCCCACTTTCTGGG + Intergenic
1118552640 14:66972566-66972588 GCCCCATTTTGTCACATTCAAGG + Intronic
1121070163 14:91011787-91011809 ACTCCTATTTGCCACTATCAAGG + Intronic
1121452859 14:94020454-94020476 CCTCCCTCTTGCCCCTTCCATGG + Intergenic
1126432572 15:48601885-48601907 CCTCCATCTCTCCACATTCACGG + Intronic
1127654254 15:61041316-61041338 CCTCCAGTTTGCTTGTTTCATGG - Intronic
1128118428 15:65127944-65127966 CCTCCATTGTGGTACTCTCAGGG - Intronic
1128592439 15:68912592-68912614 CTTACATTTTGCCACTTTAGTGG + Intronic
1128872454 15:71171983-71172005 GCTTCATTTTGTCACTTTGATGG - Intronic
1130065284 15:80597623-80597645 CCTCCATTTTGCCACTTTCAAGG - Exonic
1131830481 15:96351934-96351956 CCTGCTTTTTTCCACTCTCACGG + Intergenic
1131861480 15:96658434-96658456 CCTTCATTTTGCAACTGCCAAGG - Intergenic
1132143134 15:99410895-99410917 CCACCATTTTGCCACCATGAAGG + Intergenic
1133217981 16:4304994-4305016 CCTCACTTTTGCCTCTTCCACGG + Intergenic
1133821340 16:9239236-9239258 CCTCTATGTTGCCAACTTCAAGG + Intergenic
1134868171 16:17627649-17627671 CCTCCTTGTTGCCACACTCATGG - Intergenic
1138129927 16:54471036-54471058 CCTCCATTTTGACCCTCTCCTGG + Intergenic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1144192391 17:12858528-12858550 GCCCCCTTTTGCTACTTTCAAGG - Intronic
1147548306 17:41420139-41420161 ACTCCAGTTGGCCCCTTTCATGG - Intergenic
1149012033 17:51866692-51866714 CCTTCATTATACCACTTTTAGGG + Intronic
1149432867 17:56608349-56608371 CCTTGGTTTTGCCACTGTCAGGG - Intergenic
1150020852 17:61611180-61611202 CCTCCTTGTTGCCCCTTTCCTGG - Intergenic
1150849104 17:68687454-68687476 CCTGCAGTTTGCCATTTGCAAGG - Intergenic
1153385067 18:4483760-4483782 CCTCCAATTTGCCACTGCCAAGG + Intergenic
1153655264 18:7276711-7276733 CCTCCATCCAGCCACTGTCATGG - Intergenic
1155190388 18:23424124-23424146 CATCCATCTTGCCCCTTTCTGGG - Intronic
1156142278 18:34129280-34129302 CTTCCATTTTTAAACTTTCAAGG + Intronic
1157521434 18:48348146-48348168 CTTCCACTTTGCCACCTGCAGGG + Intronic
1163626190 19:18391230-18391252 CCTCCCTTCTGCCCCTCTCAGGG - Exonic
1167138727 19:47634409-47634431 CCTCTACCTGGCCACTTTCAAGG - Intronic
1167598045 19:50437573-50437595 CCTCCCTTTTTCCCCTTCCAAGG - Intronic
1168666378 19:58208146-58208168 CCTCCATTTTCCACATTTCACGG + Intronic
927337337 2:21940508-21940530 CCTGCATCTTCCCACCTTCATGG - Intergenic
930362081 2:50393915-50393937 TCTCCATGTTGCCATTTTCTAGG + Intronic
930383921 2:50668140-50668162 CCTCCATTTTACTGCTTTCCAGG + Intronic
931538077 2:63300406-63300428 CCTCCATTTTAGACCTTTCATGG + Intronic
932029673 2:68170791-68170813 CCTCCATTTCACCCTTTTCAGGG + Intronic
933402981 2:81822226-81822248 CCTCCCTTCTGCCACATTAAGGG + Intergenic
934588005 2:95522001-95522023 CCTGCTTTTTACCACTGTCAAGG + Intergenic
935575484 2:104705379-104705401 TCTCCATTTTTCTACTTTAAAGG + Intergenic
936563106 2:113559166-113559188 CTTCCATATTGCCGGTTTCATGG + Intergenic
937040037 2:118813963-118813985 CATCCAATTTGCCCCCTTCACGG - Intergenic
941079542 2:161044560-161044582 CCTCCAGTTTTCCATTATCAGGG + Intergenic
941141797 2:161792499-161792521 CCTTCACTATGCCACCTTCATGG - Intronic
942242932 2:173980275-173980297 CCTCCATTTTAGAACTTTTAAGG + Intergenic
942734853 2:179097641-179097663 TCACCTTGTTGCCACTTTCAGGG + Intergenic
945167800 2:206964721-206964743 GCTCCTTTTTCCCAGTTTCAGGG + Intronic
946498497 2:220220341-220220363 GTTCCATCTTTCCACTTTCAAGG - Intergenic
947476990 2:230459161-230459183 CCTCCATTTTTCCTATTTCTTGG - Intronic
948324516 2:237102746-237102768 CCTCCTTTTTTCCACTTTGAAGG + Intergenic
948936465 2:241168365-241168387 CTTTCATTTTGCCAGTTTCTGGG + Intronic
1170539659 20:17375040-17375062 CATCCATTTTGCCCATTTCACGG - Intronic
1171440738 20:25160435-25160457 CCTCCATTCTTCCTCTTTAATGG + Intergenic
1171502387 20:25603850-25603872 CCTCCCATTGGGCACTTTCAGGG - Intergenic
1171703581 20:28290284-28290306 GCTCCAATTGGCCACTTCCAGGG - Intergenic
1181935842 22:26437805-26437827 CCTCCTTCCTGCCTCTTTCAGGG + Intronic
1182289947 22:29268999-29269021 CCCCCAGTTTGCCGCTTTCTTGG + Intronic
1184578267 22:45392669-45392691 CCTCCATATCCACACTTTCATGG - Intronic
950006357 3:9693991-9694013 CAGCCATTTTGCCACCATCAGGG - Intronic
950681352 3:14587315-14587337 CCTCCTGTTGGCCAGTTTCATGG - Intergenic
952713170 3:36452816-36452838 CCTCCTTTCTGCCACTTTCTAGG - Intronic
953420085 3:42747540-42747562 CCTCCATTTTGCATCTATAAGGG - Intronic
955159626 3:56451522-56451544 CCTCCAATGTGACTCTTTCATGG - Intronic
955875633 3:63487752-63487774 TCTCCATTCTGTCACTTTGAGGG - Intronic
956321906 3:68007276-68007298 CCTCTCTTTTGGCAGTTTCAGGG + Intronic
956626237 3:71269631-71269653 GCTCTATTTTGCAAATTTCACGG + Intronic
959006178 3:101022450-101022472 CCTCCATTCTCCCCCTTTCTGGG + Intergenic
959616659 3:108356376-108356398 CCTCCATTTTCCCCCTATAAGGG - Intronic
959832006 3:110875281-110875303 CCTCTTTGTTGCCACTTTCTTGG + Intergenic
960920466 3:122741846-122741868 GCCCCTTTTTGCCAATTTCATGG - Intronic
962345756 3:134618091-134618113 CTTCCCTTTTCTCACTTTCAAGG - Intronic
963892201 3:150648285-150648307 CCTCCATTTTGCACCTCGCAAGG + Intergenic
964641935 3:158917734-158917756 CCTCCACATTGGCACTTTCCTGG + Intergenic
965737585 3:171837933-171837955 TCTCCCTTTTGCCTCTTACATGG + Intergenic
968533870 4:1112203-1112225 CCTTCTCTTTGCCTCTTTCAAGG - Intronic
968623912 4:1618039-1618061 CCTCCATCTTCCCATCTTCACGG - Intronic
971889311 4:32496824-32496846 CCCACATTTTGCCTCTTCCATGG - Intergenic
973214075 4:47649194-47649216 CCTTCATCCTGCCTCTTTCACGG - Intronic
974782132 4:66565891-66565913 CTTCCTTTTTTCCACTTCCAAGG - Intergenic
975199662 4:71571706-71571728 CCTCTTTTTAGCCATTTTCATGG + Exonic
975728678 4:77317029-77317051 TCTGTATTTTGCCACTTGCATGG + Intronic
976263765 4:83171167-83171189 CCACCATTTTGCCCCTTACTGGG + Intergenic
979096117 4:116553404-116553426 CCTCCCTTGTGCCACTTTGCTGG - Intergenic
979465876 4:121037995-121038017 CAGCCATTTTGCTAATTTCACGG + Intronic
982704544 4:158693177-158693199 CCTCCATTTTGCCAATCTGGTGG + Intronic
983028333 4:162765818-162765840 CCTCTCTTTTTCCCCTTTCAAGG - Intergenic
984247074 4:177287488-177287510 CCTCGATTCTGCCAGTTTCTTGG + Intergenic
985577646 5:681169-681191 CCTCCACTTTCCCAGTTTCTGGG + Intronic
985592572 5:773267-773289 CCTCCACTTTCCCAGTTTCTGGG + Intergenic
985882575 5:2650409-2650431 CCTCCAATGTTCCCCTTTCAGGG - Intergenic
988150014 5:27364975-27364997 CCTCCTTCTGGCTACTTTCATGG - Intergenic
990115480 5:52385089-52385111 TGTCCATTATGCCACTTTCTGGG - Intergenic
990737332 5:58878540-58878562 CCTTCACTTTTCCACTTTCTAGG - Intergenic
990780062 5:59350498-59350520 GCTTCCTTTTGCCACATTCATGG - Intronic
991172658 5:63646570-63646592 CAACCTTTTTGGCACTTTCATGG + Intergenic
992010025 5:72516692-72516714 CCTCCTTTTTTACACTTTCTTGG + Intergenic
996365135 5:122693095-122693117 CCTCCACCTTGTCAGTTTCAAGG + Intergenic
997395639 5:133557699-133557721 CCTCCATTTTGCCCCTCTCTGGG - Intronic
999550980 5:152686996-152687018 CCTTTATTGTGCCCCTTTCAGGG - Intergenic
1000073988 5:157767729-157767751 CCTCCATTTGGCCACCCTCAAGG - Intergenic
1003078880 6:3005093-3005115 CCTCATTTTAGCCACTTTTAAGG + Intronic
1003833352 6:10039839-10039861 CCTACATTCTGTCACCTTCACGG + Intronic
1003885871 6:10520956-10520978 CCTCCATTTTGCCCCCTTAGAGG - Intronic
1006082140 6:31573752-31573774 CCTCCATTCTGACCATTTCAGGG + Exonic
1007520049 6:42444967-42444989 ATTCCATTTTGCCAAATTCAGGG + Intronic
1009844489 6:69119095-69119117 CCTCCAGTTTTTCACTGTCATGG + Intronic
1011215750 6:85004007-85004029 ACTCCCTTTTCCCACTTTCCAGG + Intergenic
1011466413 6:87661852-87661874 CCTCCAATTTGCCACCCTCCAGG + Intronic
1011784526 6:90829132-90829154 CCTCCATTTTCCTTCTTGCAAGG - Intergenic
1013057030 6:106592943-106592965 CCTCAAATTTAGCACTTTCAAGG + Intronic
1014281713 6:119449034-119449056 CATCCATTTTGACACATTTAAGG + Intergenic
1015238474 6:130996901-130996923 CCTACATTTTTCCATTTTAATGG - Intronic
1015348341 6:132186557-132186579 TTTAAATTTTGCCACTTTCAAGG + Intergenic
1017353299 6:153471050-153471072 TTTCCATTTTGCCCCTTTCGAGG + Intergenic
1019839003 7:3420057-3420079 TCTCCAGTTTGCCACTGACAAGG - Intronic
1020363805 7:7358064-7358086 TCTCCCTATTACCACTTTCAGGG + Exonic
1020975332 7:14999334-14999356 CCTCCATTTTGCCAAATCCAAGG + Intergenic
1021877198 7:25059953-25059975 CCTCCTTTTTGTCCCTTGCATGG + Intergenic
1022746363 7:33176332-33176354 CCACCATTTAACAACTTTCAGGG - Intronic
1027601169 7:80243363-80243385 TCTCAATTTTACCACTTTAAGGG - Intergenic
1028835019 7:95365402-95365424 CCTTCATTTTCCCACATTCTTGG - Intronic
1028881172 7:95881641-95881663 CCTCCAGTATGCCACCCTCATGG - Intronic
1030728668 7:112957514-112957536 TCTTCATTTTGCCATATTCAGGG + Intergenic
1031398500 7:121302640-121302662 CCTCCATTATTGCATTTTCACGG + Intergenic
1031673105 7:124576013-124576035 GGTCAATTTTGCCATTTTCATGG - Intergenic
1032473858 7:132199121-132199143 CCTTCTTTGTGCCACTTACATGG + Intronic
1032593691 7:133217599-133217621 CCTCAGTTTTGCCACTTTATGGG + Intergenic
1033414546 7:141150516-141150538 CGTCCCTTCTGCCACTTTCATGG - Intronic
1035021256 7:155802159-155802181 TCACCATTTTGCCACATTCTTGG - Exonic
1036707543 8:11056443-11056465 CCACCCTTTTGACACTTTCCGGG - Intronic
1038088061 8:24222124-24222146 ACCACATCTTGCCACTTTCAGGG + Intergenic
1038550815 8:28466895-28466917 TCTTCATTTTGTCTCTTTCAAGG - Intronic
1038875723 8:31546669-31546691 CTTCCTTTTTTTCACTTTCATGG - Intergenic
1039679645 8:39717003-39717025 GCTCCATTTTGGCATTTGCATGG + Intronic
1041574023 8:59372344-59372366 CCTCCATTTTGCCCGTTTAAAGG - Intergenic
1042424326 8:68629325-68629347 TCTCCATCTTACCACTTTTAGGG - Intronic
1042964710 8:74337894-74337916 TCTTCATTTTGTCCCTTTCAGGG - Intronic
1045629510 8:104101967-104101989 CCTCCATGTTGACATTTTCCAGG + Intronic
1045629680 8:104103911-104103933 CCTCAAATTTGTCACTTGCAGGG - Intronic
1047087352 8:121532912-121532934 CCTCTATTCTGCCACTTAAAGGG + Intergenic
1049889626 9:56521-56543 CTTCCATATTGCCGGTTTCATGG - Intergenic
1053484673 9:38442778-38442800 GCTCCATTTGGGCACTGTCAGGG - Intergenic
1053731109 9:41057796-41057818 CTTCCATATTGCCGGTTTCATGG - Intergenic
1054697403 9:68374293-68374315 CTTCCATATTGCCAGTTTCATGG + Intronic
1055958388 9:81795739-81795761 ACTCCATTTTCCCAATTACATGG - Intergenic
1056022829 9:82458645-82458667 ACTCCATTTTTACACTTTCTTGG - Intergenic
1057249640 9:93490151-93490173 TCTGCATTTTGGCAATTTCAAGG - Intronic
1060793742 9:126501672-126501694 CCACCAGTTTTCCACTTTAAGGG + Intronic
1061591835 9:131602924-131602946 CCTCCACTGTGACACTTCCAGGG - Intronic
1061858451 9:133455762-133455784 CCTCCCTTTTACTACTATCAAGG + Intronic
1187021558 X:15387777-15387799 CTTCCATTTTGACACTTTCTGGG + Intronic
1188623858 X:32260131-32260153 CCTACACTTTCCCACTTTCCAGG - Intronic
1189011970 X:37054662-37054684 CTTCTATTTTGCCGCTTTCAGGG + Intergenic
1189750507 X:44216196-44216218 CACCCATTTTGCTATTTTCATGG + Intronic
1193358906 X:80556827-80556849 CCTCCATTCAGACACTTTCAGGG - Intergenic
1194656848 X:96583730-96583752 CTTCTATTTTGCCACCTTCTTGG - Intergenic
1194785052 X:98073090-98073112 CCTCCTTTTCTCCACTTTGAAGG - Intergenic
1194961783 X:100244483-100244505 CCTCTATTTAAACACTTTCAGGG + Intergenic
1195810363 X:108822472-108822494 CCTCAATTTTGTTATTTTCAGGG + Intergenic
1197146664 X:123179559-123179581 CAGCCATTTTGCCATCTTCAGGG + Intergenic
1197314956 X:124954365-124954387 CCTCCATTTATCCACTTTTCTGG + Intronic
1197542210 X:127778295-127778317 CCACCACTTTTCCACTTTTAAGG - Intergenic
1197729576 X:129798200-129798222 CCTCCATTTCACTCCTTTCAAGG + Intergenic