ID: 1130065284

View in Genome Browser
Species Human (GRCh38)
Location 15:80597623-80597645
Sequence CCTCCATTTTGCCACTTTCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130065284_1130065289 1 Left 1130065284 15:80597623-80597645 CCTTGAAAGTGGCAAAATGGAGG 0: 1
1: 0
2: 0
3: 23
4: 209
Right 1130065289 15:80597647-80597669 TTCACAGGCTGTGCGGGAGCAGG 0: 1
1: 0
2: 1
3: 15
4: 180
1130065284_1130065288 -5 Left 1130065284 15:80597623-80597645 CCTTGAAAGTGGCAAAATGGAGG 0: 1
1: 0
2: 0
3: 23
4: 209
Right 1130065288 15:80597641-80597663 GGAGGTTTCACAGGCTGTGCGGG 0: 1
1: 0
2: 1
3: 29
4: 280
1130065284_1130065290 5 Left 1130065284 15:80597623-80597645 CCTTGAAAGTGGCAAAATGGAGG 0: 1
1: 0
2: 0
3: 23
4: 209
Right 1130065290 15:80597651-80597673 CAGGCTGTGCGGGAGCAGGACGG 0: 1
1: 0
2: 3
3: 60
4: 532
1130065284_1130065287 -6 Left 1130065284 15:80597623-80597645 CCTTGAAAGTGGCAAAATGGAGG 0: 1
1: 0
2: 0
3: 23
4: 209
Right 1130065287 15:80597640-80597662 TGGAGGTTTCACAGGCTGTGCGG 0: 1
1: 0
2: 1
3: 20
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130065284 Original CRISPR CCTCCATTTTGCCACTTTCA AGG (reversed) Exonic