ID: 1130065870

View in Genome Browser
Species Human (GRCh38)
Location 15:80604594-80604616
Sequence TTAAGCAAGAGGTCCCAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130065867_1130065870 20 Left 1130065867 15:80604551-80604573 CCAGGAAGGGCTGAGTATCTCAT No data
Right 1130065870 15:80604594-80604616 TTAAGCAAGAGGTCCCAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130065870 Original CRISPR TTAAGCAAGAGGTCCCAGTT GGG Intergenic
No off target data available for this crispr