ID: 1130078421

View in Genome Browser
Species Human (GRCh38)
Location 15:80710072-80710094
Sequence GGGTTGGCTGCAACTTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130078421 Original CRISPR GGGTTGGCTGCAACTTTTAA AGG Intronic
901018233 1:6243539-6243561 GGGTGGGCTGCATGCTTTAATGG + Intergenic
901114849 1:6835058-6835080 GGGTTGGCAGCATCTGTTCAGGG + Intronic
903475465 1:23616377-23616399 GGGTTGGCTGGAACTTGGGAAGG - Intronic
904119189 1:28185053-28185075 GGGATGGCTGCAACTTATTAGGG - Intronic
909387400 1:75074859-75074881 GGGTGGGGTGCAACATTTGAGGG - Intergenic
912197822 1:107420544-107420566 GAGAAGGCTACAACTTTTAAAGG + Intronic
912442507 1:109710404-109710426 GGGTTGACTGCTTTTTTTAAAGG - Intergenic
916463661 1:165050597-165050619 GGGTTGGGAGCAAGTGTTAAAGG + Intergenic
918897269 1:190363874-190363896 TGATGGGCTGCAACTTTCAATGG + Intronic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
923320932 1:232832184-232832206 GTATAGGCTCCAACTTTTAAAGG + Intergenic
1068379374 10:56230166-56230188 GACTTGGGTGCAAATTTTAAAGG - Intergenic
1068740296 10:60461608-60461630 GGTTTTGCTGCAATTTTTGATGG - Intronic
1089630967 11:119783910-119783932 GAATTGGCTCCATCTTTTAAAGG - Intergenic
1090446813 11:126771528-126771550 GGTTTTGCTGTTACTTTTAATGG - Intronic
1093289320 12:17301781-17301803 GGGGTGGATGCAGCTTTTCAAGG - Intergenic
1098071254 12:66677465-66677487 GTTTTGGCTGAGACTTTTAAAGG - Intronic
1103929779 12:124443939-124443961 GGCTTGGCTGCTCCTTTCAAAGG + Intronic
1104480045 12:129099777-129099799 GGTTTCGCTCCCACTTTTAATGG - Intronic
1105703061 13:22948259-22948281 GGGTTGGTTACTACTTTTGATGG - Intergenic
1107388299 13:39937067-39937089 GGGTAGGCTCTAACATTTAATGG - Intergenic
1116620489 14:47196882-47196904 TGGTTAGCTGCCACTTATAAGGG + Intronic
1118130020 14:62952578-62952600 TGGTTAGCTCAAACTTTTAAAGG + Intronic
1120014840 14:79460270-79460292 TGCTTGGCTGGAACTTTTGATGG - Intronic
1127114389 15:55710224-55710246 GGGCTTTCTGGAACTTTTAAAGG - Intronic
1129997872 15:80022603-80022625 GAGTTGGCTGCATCCTTTTAGGG - Intergenic
1130078421 15:80710072-80710094 GGGTTGGCTGCAACTTTTAAAGG + Intronic
1132561427 16:596348-596370 GGGTAGGCGGCAGCTTTTCAGGG - Intronic
1133915424 16:10105236-10105258 GGGTGGGCTTCATGTTTTAATGG - Intronic
1138121250 16:54402496-54402518 ATGTTGGCTGCAACTTTTCTTGG + Intergenic
1148237004 17:45975768-45975790 GGAATGGCTGCAACTTTGAATGG - Intronic
1149161108 17:53694281-53694303 GGGTTGGCTGCAAACTTTGTAGG + Intergenic
1162532282 19:11242902-11242924 GGGCTGGCTACAGCTTCTAATGG - Intronic
1164961897 19:32439458-32439480 GGGTTTGCTGCAACTATTTAAGG - Intronic
926799936 2:16651446-16651468 GGTTTGTCTGCAACTGTTTAGGG - Intronic
931760832 2:65415645-65415667 GGTTCGGCTGAAACTTTAAAAGG - Intronic
935535368 2:104287047-104287069 GGGTTGGCTGCATTTCTTTACGG - Intergenic
936249162 2:110854188-110854210 GGGCTGGCAGCAACTTCTGAGGG + Intronic
942091466 2:172495637-172495659 GGGTTGGCTACACATTTAAAGGG - Intronic
945755659 2:213843392-213843414 GGGTTAGCTGCTTCTTTTATAGG - Intronic
946576901 2:221085609-221085631 GGCTTGGCTTCTGCTTTTAAAGG + Intergenic
947624619 2:231611937-231611959 AGGGTGGCTGCCACTTTTGAGGG - Intergenic
1172092427 20:32443477-32443499 TGGATGGCACCAACTTTTAAAGG - Exonic
1173702922 20:45088922-45088944 GGGTTGCCTTTAACTTTTTAGGG - Intergenic
1175838826 20:62014077-62014099 GGGTTGGCTGCTGCTGTTAGGGG - Intronic
1175980143 20:62734606-62734628 GGGCTGCCTGCAGCTTTTATGGG - Intronic
949380972 3:3445495-3445517 GGGTATGGTGCAACTCTTAAGGG - Intergenic
951825778 3:26866533-26866555 GGGTTGGCTGAAATTTTTTTTGG - Intergenic
954906805 3:54070111-54070133 GGGTTTGCTGTAACTTGCAATGG - Intergenic
955171772 3:56572980-56573002 GTTTTAGCTACAACTTTTAACGG - Intronic
957970202 3:87374047-87374069 GGTTTGCCTTGAACTTTTAAAGG - Intergenic
961090463 3:124106894-124106916 GGTTTGGGTTCAGCTTTTAAAGG + Intronic
965254653 3:166390238-166390260 GACTTTTCTGCAACTTTTAAAGG + Intergenic
966538587 3:181063463-181063485 GGGTGGGCTGCAGCTTAGAATGG + Intergenic
966613250 3:181889121-181889143 GGGGTGGTTGCAAGTTTTATAGG + Intergenic
982380595 4:154743968-154743990 GGCTTCGCTGCGACTTTTTATGG - Exonic
984574309 4:181429366-181429388 GGGGTGGCCTCAGCTTTTAAAGG - Intergenic
992710133 5:79444602-79444624 GTGTTAGCAGCAACTTATAATGG + Intronic
997596128 5:135108429-135108451 GGGTTGGCTGTTGCTTTTGAAGG + Intronic
999193112 5:149763275-149763297 AGGTTGGCTGCAACTTTAAGAGG - Intronic
1000128615 5:158272860-158272882 GGCTTGGCTGCAGCATTTATAGG + Intergenic
1001136111 5:169103987-169104009 GGGCTGGCTACAACTTGTCAGGG + Intronic
1003785274 6:9478832-9478854 GGGTTGGATTCTACTTTTTATGG - Intergenic
1011366946 6:86593063-86593085 GGGTAGGCTGCAGCTTTTCTTGG - Intergenic
1012223270 6:96677119-96677141 GGGTTGGTTGCAAAATTAAAAGG - Intergenic
1013245575 6:108284054-108284076 GGGTTTGTTGCTATTTTTAAAGG + Intergenic
1013623143 6:111909708-111909730 GTTTTGGCTGTTACTTTTAATGG + Intergenic
1015809056 6:137143037-137143059 GGGTAGGTTGCAATTTTAAATGG + Intergenic
1016739540 6:147512894-147512916 GGGTTGGATGCACCTGTTCATGG - Intronic
1018858391 6:167692058-167692080 GGGTTGGATCCATCTTTGAACGG - Intergenic
1020052397 7:5090497-5090519 GGGTTGACTGCACCTGTAAAAGG + Intergenic
1028512535 7:91640976-91640998 GGGTTGGGTGCAAGTCTCAATGG + Intergenic
1031688967 7:124765264-124765286 GTGTTGATTGCAACTTTTCAAGG - Exonic
1032269894 7:130394861-130394883 GGATGGGCTGCATCTTTTAAAGG - Exonic
1032278094 7:130477416-130477438 GGGTTGGCTGAAACTCTTGTGGG - Intergenic
1034266963 7:149785738-149785760 GAGGTGGCTGCAACATTGAAGGG + Intergenic
1035874014 8:3167328-3167350 AGGTTGGCTATCACTTTTAATGG + Intronic
1038777428 8:30543659-30543681 GTGTTTGCTGTTACTTTTAATGG + Intronic
1040551057 8:48437887-48437909 GGGTTGGCTCCATCTCTCAACGG - Intergenic
1045066226 8:98448128-98448150 AGCTTTGCTGAAACTTTTAAAGG + Intronic
1046370999 8:113306296-113306318 GGGTTGGTTCCAACTCTGAAGGG + Intronic
1046396203 8:113643233-113643255 GGGTTGGCTCCCTCTTTGAAAGG - Intergenic
1050997190 9:12235250-12235272 GGGTCAGCAGAAACTTTTAAGGG + Intergenic
1052532556 9:29706484-29706506 TGGATGGCTGAAACTGTTAATGG - Intergenic
1055897191 9:81191837-81191859 GGGCTGGCTACAACTTTGATAGG - Intergenic
1057270988 9:93651412-93651434 GGGTTGTTTGCAACTTTTGTTGG + Intronic
1061348426 9:130044323-130044345 GGGTTAGCTCCACCTTTTAATGG - Intergenic
1186023602 X:5284224-5284246 TGGGTGGCTGCGACATTTAAGGG - Intergenic
1189580682 X:42403169-42403191 GGGTTGGCTGAAACTTTTTTGGG + Intergenic
1190482511 X:50890658-50890680 GGGTTGGCTGCAGTTATTAATGG - Intergenic
1200816839 Y:7542098-7542120 GGGCTGGCTGCAGCATTTACAGG - Intergenic
1200875231 Y:8147366-8147388 GTGTTGGCATCAAATTTTAAGGG + Intergenic