ID: 1130078497

View in Genome Browser
Species Human (GRCh38)
Location 15:80710474-80710496
Sequence GCTGATATGTCGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130078497 Original CRISPR GCTGATATGTCGAGGGAGGA AGG Intronic
900871911 1:5310451-5310473 GCTGAGATGTCCAAGGTGGAGGG + Intergenic
902993675 1:20207227-20207249 GGTGGGATGTGGAGGGAGGAGGG - Intergenic
903443098 1:23402928-23402950 GCTGAAATGTGGAAAGAGGAAGG + Intronic
903588662 1:24437768-24437790 GCCGTGATGTCTAGGGAGGATGG + Intronic
904037518 1:27566830-27566852 GCAGAGCTGTCGAGGGAGGGGGG + Intronic
904998131 1:34647344-34647366 GCAGAGATGTCAGGGGAGGAGGG - Intergenic
908150651 1:61298077-61298099 CCCCACATGTCGAGGGAGGAGGG + Intronic
911014710 1:93320013-93320035 GCTGCTATGTGGATAGAGGAAGG - Intergenic
915322081 1:155061730-155061752 GCTGATGTCTCAGGGGAGGAAGG - Intronic
916429558 1:164713868-164713890 AATGATATGTCGAAGCAGGAAGG + Intronic
916507334 1:165439933-165439955 GCTGTTATGTGGAAAGAGGAGGG + Intronic
918065797 1:181100869-181100891 GTTGATATCTAGAGGGAAGAGGG + Intergenic
919121506 1:193346514-193346536 GCAGATATGGGGAGGGAGGATGG + Intergenic
919760005 1:201091877-201091899 CCTGAGATGTCAAGGTAGGAAGG + Intronic
920084959 1:203408684-203408706 GCTGATGTGGGGAGGGAAGAAGG + Intergenic
921721418 1:218475962-218475984 GTTGATTTCTGGAGGGAGGAAGG + Intergenic
923891084 1:238215500-238215522 CCCCATATGTTGAGGGAGGAAGG - Intergenic
1067543597 10:47175825-47175847 GCTGAAATGCCAAGGGAGGCAGG - Intergenic
1070555768 10:77526857-77526879 GGAGATATGGAGAGGGAGGATGG - Intronic
1080793935 11:35546091-35546113 GCAGAAATGTCAATGGAGGATGG - Intergenic
1083628273 11:64082934-64082956 GCTGCTGTGACGAGGAAGGAAGG - Intronic
1087160102 11:94940455-94940477 GCTGATAGGTCAAGTGAGGCGGG - Intergenic
1088186790 11:107179265-107179287 TCTGTTATGGTGAGGGAGGAAGG - Intergenic
1089535746 11:119160043-119160065 GGTCATATGGCCAGGGAGGAAGG + Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1091613559 12:2032072-2032094 GCTGCAAGGTAGAGGGAGGAGGG + Intronic
1093317254 12:17666845-17666867 GCTGATGAGTGGAGGGAGGCTGG - Intergenic
1093533210 12:20191867-20191889 GCTGGTACGTCCAGGGAGGAAGG - Intergenic
1093667642 12:21833484-21833506 GCTCATGTGTCTAGGGAAGAAGG + Intronic
1104159033 12:126161194-126161216 GATGATGTGTCTAGGGAGGAAGG - Intergenic
1110917016 13:81033429-81033451 GCTGATTTTTCTAGGGATGAAGG - Intergenic
1113392963 13:109915701-109915723 GCTGATATATCAAGTGAGCAGGG + Intergenic
1113999810 14:16403549-16403571 GCTTATATTTCAAGGGAGGAGGG + Intergenic
1116040477 14:39680166-39680188 GCTGACATGTAGAGGGCCGAAGG - Intergenic
1118764506 14:68900791-68900813 GCTGGAGTGTCCAGGGAGGACGG + Intronic
1118774087 14:68962529-68962551 GCTGGGGTGTGGAGGGAGGAGGG - Intronic
1119197284 14:72726456-72726478 GCTGATGGGCAGAGGGAGGATGG - Intronic
1119692402 14:76685844-76685866 GCTAATATGTGGGGGGAGGGGGG + Intergenic
1121776033 14:96591661-96591683 GCTGATATGTCTAGAAAGGATGG + Intergenic
1123791497 15:23725168-23725190 GCTGTCATGACGGGGGAGGAGGG - Intergenic
1128645179 15:69373061-69373083 GCTGATGTGAAGATGGAGGAAGG - Intronic
1130078497 15:80710474-80710496 GCTGATATGTCGAGGGAGGAAGG + Intronic
1130397182 15:83512785-83512807 GCTGATAGGGAGAGGGAGGGAGG - Intronic
1131902533 15:97104035-97104057 GGTTATATGTAGAGGGAAGATGG + Intergenic
1132553538 16:563289-563311 GCTGCCATGTCGCGGGAGGCGGG + Exonic
1133636116 16:7667434-7667456 GCTGGTATCTCAAGGGAGGTAGG - Intronic
1134392891 16:13836061-13836083 GCTGAGATGTGCAGAGAGGAAGG - Intergenic
1135410249 16:22228625-22228647 GCTTATATGTCGTTTGAGGAGGG + Intronic
1138400873 16:56742668-56742690 GCAGATATGTCTAGGATGGATGG + Intronic
1139038629 16:62977769-62977791 GGGGATTTGTCCAGGGAGGAAGG - Intergenic
1139268564 16:65661621-65661643 CCTCATGAGTCGAGGGAGGAGGG - Intergenic
1142132056 16:88435654-88435676 GATGCTGTGTCCAGGGAGGATGG + Exonic
1145302332 17:21649401-21649423 GCTGATATCTGGAAAGAGGAAGG + Intergenic
1145415597 17:22711471-22711493 GCTGATATCTGGAAAGAGGAAGG + Intergenic
1146739706 17:35272167-35272189 GCTGATATGTGGAGGGTCAATGG + Exonic
1151322178 17:73358829-73358851 GCTGCTAGGAGGAGGGAGGAAGG + Intronic
1152525676 17:80887098-80887120 GGTGATGTCTGGAGGGAGGAAGG + Intronic
1153758056 18:8303068-8303090 GGTGATCTGTGGAGGGAGCAAGG + Intronic
1153886659 18:9474186-9474208 GCTGCTATGTGGATGCAGGAGGG - Intergenic
1153969856 18:10216151-10216173 GCAGATATATCCAGGGATGAGGG + Intergenic
1158978749 18:62737895-62737917 GATTATATGTGGAGGGGGGAAGG + Intronic
1159102619 18:63972167-63972189 GCGGATGTGATGAGGGAGGAGGG - Intronic
1164669747 19:30065645-30065667 GGAGGTATGTGGAGGGAGGAGGG + Intergenic
1164981848 19:32620048-32620070 GCTGGGATGTCTTGGGAGGAGGG - Intronic
1167560779 19:50225762-50225784 GTGGATCTGTTGAGGGAGGAGGG + Intronic
1168272394 19:55257535-55257557 GCAGATATGTCAAGGAAGGAAGG - Intronic
925494989 2:4436664-4436686 TCCCACATGTCGAGGGAGGAAGG - Intergenic
925958321 2:8991806-8991828 GCTGATTTGTCAAGGGAAGATGG - Intronic
927614365 2:24576226-24576248 GCTGATATGTCCTGTGTGGAAGG - Intronic
927729092 2:25454522-25454544 GCTGTTATGTAGGGGAAGGATGG + Intronic
929046648 2:37797119-37797141 GCTGAAGTGTAGAGGGAGGGAGG - Intergenic
929955930 2:46458697-46458719 ACTGAAATCTGGAGGGAGGAGGG + Intronic
930861026 2:56072815-56072837 TCTGATATGTGGAGGGAGAGAGG - Intergenic
934936168 2:98467101-98467123 GCTCACATGGCGAGAGAGGAAGG + Intronic
935522233 2:104121882-104121904 GCAGATATGTGCAGGGAGTAGGG + Intergenic
938094720 2:128454008-128454030 GCTGGTATTTAGCGGGAGGAAGG + Intergenic
938291822 2:130154641-130154663 GCTGACATGGGGAGGGCGGATGG + Intronic
938464726 2:131518323-131518345 GCTGACATGGGGAGGGCGGATGG - Intergenic
946237390 2:218332541-218332563 GCTGAGATGGGGAAGGAGGAAGG - Intronic
946339674 2:219059409-219059431 GCTGAGATGCCGAGGGAGGCAGG - Intronic
1168985685 20:2046744-2046766 GCTGCCATGTCGTGGGCGGAGGG + Intergenic
1171518915 20:25760828-25760850 GCTGATATCTGGAAAGAGGAAGG + Intergenic
1171557937 20:26095383-26095405 GCTGATATCTGGAAAGAGGAAGG - Intergenic
1171727229 20:28635699-28635721 GCTTATATTTCAAGGGAGGAGGG + Intergenic
1171791949 20:29535012-29535034 GCTTATATTTCAAGGGAGGAGGG + Intergenic
1171856392 20:30347872-30347894 GCTTATATTTCAAGGGAGGAGGG - Intergenic
1174286816 20:49480001-49480023 GCTGAAATGGGGAGGGAGGCAGG - Intronic
1176653061 21:9567236-9567258 GCTGATATCTGGAAAGAGGATGG + Intergenic
1181888340 22:26039506-26039528 GCTGACATCTGGAGGGAGGAGGG - Intergenic
949370799 3:3332792-3332814 GCTGCTATGTAGAGGCAGGTAGG + Intergenic
952487669 3:33831418-33831440 GCTGATGTGTTTAGGGATGAGGG + Intronic
953552241 3:43912536-43912558 GCTTAGATGTCCAGAGAGGAAGG - Intergenic
961909577 3:130301096-130301118 GCTGCCATGTTGCGGGAGGATGG - Intergenic
963752743 3:149200026-149200048 TCTGATATGTCGAGGTTGGAAGG + Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
969230647 4:5827986-5828008 GCAGAAACGTCAAGGGAGGAAGG + Intronic
970246725 4:14071831-14071853 ACTGATAAATTGAGGGAGGAGGG + Intergenic
972266557 4:37465505-37465527 GCTGATATGGCTTGGGGGGATGG + Intronic
976388971 4:84490247-84490269 GCAAATATGTAGAGGAAGGATGG - Intergenic
990061524 5:51655646-51655668 TTTGATATGGCCAGGGAGGAGGG + Intergenic
993900576 5:93581619-93581641 GGTGATTGGTCGCGGGAGGAGGG - Intergenic
995608308 5:113881745-113881767 CCACATATGTCGAGGGAGGGAGG + Intergenic
998171120 5:139872531-139872553 GCTGATAAGGTCAGGGAGGAGGG - Intronic
999301106 5:150490967-150490989 GCAGATTTGTAGAGGTAGGAGGG - Intronic
999424661 5:151476753-151476775 GCTGGTACGTGGAGGGAGGATGG + Exonic
1004492342 6:16128981-16129003 GCTGATCGGGCGGGGGAGGAGGG + Intergenic
1005969539 6:30750461-30750483 CCTGATATGGAGAGGGAGGGAGG - Intergenic
1007075819 6:39065510-39065532 GCGTATATGTCAGGGGAGGAAGG + Intronic
1007501549 6:42301840-42301862 GCTGATATGTTCAGAGAGGGAGG + Intronic
1016681932 6:146840785-146840807 GCTTATATCTCAAGGAAGGAAGG + Intergenic
1018736448 6:166690107-166690129 GCTGAGGGGTGGAGGGAGGAGGG + Intronic
1020115904 7:5476247-5476269 GCTGATGTGTCTGGGGTGGAGGG - Intronic
1020680810 7:11234381-11234403 GCTGAATTCTGGAGGGAGGAAGG + Intergenic
1021071184 7:16243082-16243104 CCTGATGTGTCAAGGGAGGGAGG + Intronic
1021903602 7:25311854-25311876 CCTCATATGTGGAGGGAGGGAGG + Intergenic
1025279406 7:57615957-57615979 GCTGATATCTGGAAAGAGGAAGG + Intergenic
1025305325 7:57849543-57849565 GCTGATATCTGGAAAGAGGAAGG - Intergenic
1026565535 7:71487007-71487029 ACTGAAAAGTCAAGGGAGGAGGG - Intronic
1027933973 7:84578745-84578767 GATGATATGTTGGGGGAGGGCGG + Intergenic
1030554566 7:111007281-111007303 CCTGACATGTCCAGGAAGGAAGG - Intronic
1034446745 7:151117535-151117557 GGTGGTATGTCCAGGGAGAAGGG + Intronic
1035153896 7:156896744-156896766 ACCCATATGTCGAGGGAGGAAGG - Intergenic
1038676944 8:29631464-29631486 GCTGAGAGGCCGAGGGAGGCAGG + Intergenic
1039557055 8:38484114-38484136 GATGAAATGTTGAGTGAGGATGG - Intergenic
1042191649 8:66193338-66193360 GCTGATATGTGGAGGGGTGTTGG + Intergenic
1046447287 8:114339423-114339445 GATTAAATGTCGAGGGAGAATGG + Intergenic
1048280001 8:133098672-133098694 GCTGATGGGGCTAGGGAGGAGGG + Intronic
1050526204 9:6548984-6549006 GCTGAGATGTGGATGGAGGTCGG - Intronic
1053722519 9:40961403-40961425 GCTTATATTTCAAGGGAGGAGGG - Intergenic
1054343449 9:63890594-63890616 GCTTATATTTCAAGGGAGGAGGG + Intergenic
1057272429 9:93658546-93658568 GCTGGTGTGTCCTGGGAGGAAGG + Intronic
1059053299 9:110952484-110952506 TCAGATATGTGGAGAGAGGAGGG - Intronic
1060181292 9:121536152-121536174 GCTGCTATTTCTAGGGATGAGGG - Intergenic
1060666010 9:125432687-125432709 GCTACTATGTGGAGGCAGGAAGG + Intergenic
1061825020 9:133252549-133252571 AGTGAAATGTGGAGGGAGGAAGG + Intronic
1203452657 Un_GL000219v1:134575-134597 GCTTATATTTCAAGGGAGGAGGG + Intergenic
1203630791 Un_KI270750v1:70776-70798 GCTGATATCTGGAAAGAGGATGG + Intergenic
1185612143 X:1399075-1399097 GCTGATGTGGGAAGGGAGGAAGG + Intergenic
1186815523 X:13234203-13234225 CCCCATATGTCGAGGGAGGGAGG - Intergenic
1192163587 X:68808394-68808416 GCTGATATCTCCAGTGAGAAAGG - Intergenic
1196685879 X:118509884-118509906 GCTGGTTTGAGGAGGGAGGAAGG - Intronic
1201721966 Y:17108887-17108909 ACCCATATGTTGAGGGAGGAAGG + Intergenic