ID: 1130079673

View in Genome Browser
Species Human (GRCh38)
Location 15:80721714-80721736
Sequence TTCCTCTGTGCAGCGTAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130079673 Original CRISPR TTCCTCTGTGCAGCGTAAGG TGG Intronic
900025429 1:267990-268012 TTTCTCTGTGCAGCACCAGGTGG + Intergenic
900827828 1:4940817-4940839 GGCCTCTGTGCAGAGTGAGGTGG - Intergenic
903438003 1:23367092-23367114 TCCCTCTGTGCAGCGTCCAGAGG + Exonic
906773385 1:48505655-48505677 TTCCTCTTTGCAGAGTCAGAAGG + Intergenic
911272910 1:95825385-95825407 TTCCTTTGTCCAGCATAAGATGG + Intergenic
914919384 1:151837447-151837469 TTCCTCTGTGCAGCCTCAAGTGG + Intergenic
917352280 1:174090660-174090682 TTCCTCTCTGCAGCTTAATGTGG + Intergenic
917627671 1:176862438-176862460 GTCCTCTGTGCAGTGGAAGGAGG - Exonic
922595353 1:226808966-226808988 TGCCTCTGTGCAGCGCATGAGGG + Intergenic
1063378039 10:5565871-5565893 TTCCTCCGTGCAGATTAAGGAGG + Intergenic
1065654735 10:27936832-27936854 GTCCTCCGTGCAGCCTAACGAGG + Exonic
1067030454 10:42875948-42875970 TTCCACTGTGGAGAGGAAGGGGG + Intergenic
1070707101 10:78647688-78647710 TGCCTCTGTGCAGCCTCTGGGGG - Intergenic
1076767130 10:132642279-132642301 TTGCTCTGTGCAGTGTCCGGCGG + Intronic
1080610477 11:33899778-33899800 TTCCTCTGGACAGGGTTAGGTGG + Intergenic
1084552301 11:69851996-69852018 TGCCTCTGTGAAGGGTCAGGGGG + Intergenic
1087971316 11:104488296-104488318 TTTTTCTGTGCAGGGTCAGGTGG + Intergenic
1092738805 12:11609305-11609327 TTCCTCTGCTCAGCCTAAGATGG + Intergenic
1093346618 12:18044244-18044266 TTCCTCTCTGCTTTGTAAGGAGG + Intergenic
1094474823 12:30833058-30833080 CTCCTCTGTGCACCCTGAGGTGG + Intergenic
1096238862 12:49948764-49948786 TTCCTATGTGCAGAGTCTGGAGG + Intergenic
1099296198 12:80830951-80830973 TTAATCAGTACAGCGTAAGGAGG - Intronic
1102471210 12:113160971-113160993 TTCATCTGTGAAGTGGAAGGGGG + Intronic
1104020072 12:124986351-124986373 TTCCTGTGTGCAGACTCAGGAGG - Intronic
1113014451 13:105812478-105812500 TTCCTCTGTGCATTCTGAGGTGG + Intergenic
1113364297 13:109661869-109661891 TGCCTCTGGGCAGGGCAAGGAGG + Intergenic
1118221698 14:63860325-63860347 TTCCTCTGGGCTGCATTAGGAGG + Intronic
1120331542 14:83099614-83099636 TTTCTCAGTGGAGAGTAAGGAGG - Intergenic
1121990465 14:98552122-98552144 CTCCTCTGTGCAGCTTAATGAGG - Intergenic
1202919016 14_KI270723v1_random:13638-13660 TTCCTGTGGGCAGGCTAAGGTGG + Intergenic
1202925613 14_KI270724v1_random:21357-21379 TTCCTGTGGGCAGGCTAAGGTGG - Intergenic
1123704790 15:22943350-22943372 TTTCTCTGTGCAGAGGAAGCAGG + Exonic
1126273681 15:46850206-46850228 TTCCTCTGGGCAGCACAGGGTGG + Intergenic
1127994417 15:64144764-64144786 TTCCTCTGAGCAGCCTTGGGTGG - Intronic
1130079673 15:80721714-80721736 TTCCTCTGTGCAGCGTAAGGTGG + Intronic
1130351105 15:83092462-83092484 TTCCTATGTGCAGAGGAAAGGGG + Intergenic
1130913110 15:88284464-88284486 GCCCTCTCTGCAGCGCAAGGGGG + Intergenic
1131377393 15:91936991-91937013 TTCCTCTTTGCAGATTCAGGGGG - Intronic
1133340710 16:5033841-5033863 TTCCTCTGGGAAGCGTCCGGCGG - Exonic
1134040105 16:11061886-11061908 TTCCTCTGTTCATCCTCAGGAGG + Intronic
1135353980 16:21754309-21754331 TTCCTGTTTGCTGCGTAATGTGG + Intronic
1135452469 16:22570448-22570470 TTCCTGTTTGCTGCGTAATGTGG + Intergenic
1136633210 16:31501654-31501676 TTACTCTGCCCAGCCTAAGGAGG - Intronic
1142058139 16:88013450-88013472 TCCCTCAGTGCAGTGTGAGGTGG + Intronic
1142958875 17:3539871-3539893 TTCCTCTTAGCAGCATAGGGAGG + Intronic
1146549787 17:33770323-33770345 TTCCTCTGTAAAGCGAAAGCTGG + Intronic
1146948482 17:36890110-36890132 TTCCTCTATGCATAGTAAGAGGG + Intergenic
1147359336 17:39921379-39921401 TTCCTCTGTGCTGCTTGAGCAGG + Intronic
1152304787 17:79514141-79514163 TTCCTCTGTCCAGCACAGGGTGG - Intronic
1160387758 18:78506818-78506840 TTCCTCTGTAAAGCCCAAGGCGG + Intergenic
1160468404 18:79103470-79103492 TACCTCTGTGAAGAATAAGGAGG + Intronic
1160600201 18:80006720-80006742 TTCCCTTGTGCAGAGTGAGGGGG + Intronic
1160671337 19:365283-365305 TGCCCTTGTGCAGGGTAAGGGGG + Intronic
1161353244 19:3805157-3805179 TTCCTCTGGGCTGCGCATGGTGG - Exonic
1161617148 19:5277686-5277708 TTCCTCGGCGCTGCCTAAGGAGG + Intronic
1162901354 19:13796822-13796844 ATCCTCTGTCCAGCTTCAGGGGG + Intronic
1168142880 19:54401017-54401039 TTCCTCTGTGGAGGGAAAGGTGG - Intergenic
925968314 2:9087204-9087226 TTTCTCTGTGCCGCTTAATGAGG + Intergenic
929887635 2:45893004-45893026 CTTCTCTGTGCAGCGGAATGAGG - Intronic
932769787 2:74494181-74494203 TTCCTCTGTGAAAGGTAAGGGGG - Exonic
933522404 2:83390281-83390303 CTCGTCTGTGCAACCTAAGGTGG - Intergenic
937291097 2:120782567-120782589 TGCCTCTTTACAGCTTAAGGTGG + Intronic
939624663 2:144462057-144462079 TTCCTCTGTACAGGGTAAGGAGG + Intronic
940040489 2:149354694-149354716 TTTCACTGTACAGCATAAGGGGG + Intronic
940846214 2:158644743-158644765 TACCTCTGTGAAGAGGAAGGAGG + Intronic
946379430 2:219335190-219335212 TGCCTCTCTGCAGGGTAATGGGG + Intergenic
947653491 2:231807571-231807593 TGCCTCTGCTCAGCGTGAGGGGG - Exonic
948671058 2:239569181-239569203 GTCCTATCTGTAGCGTAAGGGGG + Intergenic
1173428477 20:42963726-42963748 TTCCCCTGTGCAGGGTAGGGTGG - Intronic
1176864266 21:14034975-14034997 TAACTCCGTGCAGTGTAAGGTGG - Intergenic
1183089281 22:35510386-35510408 TTCCTATGTGCTTCCTAAGGAGG - Intergenic
1184371030 22:44082148-44082170 TCCCACTGTGCACCGCAAGGTGG + Intronic
953328458 3:42032358-42032380 TTCCTCTGTGCAGTGCAGCGAGG + Intronic
954387208 3:50250394-50250416 TTCCTCTGTGCAGCTTAGCTGGG - Intronic
957294565 3:78320824-78320846 TTCCTTTGTCTAGCCTAAGGTGG + Intergenic
962899383 3:139745682-139745704 TTCCTCTGAACAATGTAAGGGGG - Intergenic
965942639 3:174203316-174203338 TTCCTCTGTGCACGGTGAAGTGG - Intronic
970681382 4:18512381-18512403 TTCCTCTTTTCAGAGTAAAGAGG + Intergenic
979743602 4:124181178-124181200 TTCCTCTGTGCAGCTTCATCAGG + Intergenic
981756125 4:148143231-148143253 ATCCTCAGTGCAGCAAAAGGAGG + Intronic
982823164 4:159969434-159969456 TTTCTCTGTGCACCCTAAGGGGG - Intergenic
984569611 4:181376233-181376255 TTCCTCTGTGCAGCTTCTGTGGG + Intergenic
984871212 4:184326833-184326855 TTCCTTTGTCCAGCCTAAGATGG + Intergenic
985277627 4:188253669-188253691 TTTCTCTGTGCATCGTAATCAGG + Intergenic
985812963 5:2103607-2103629 TTTCTCTGTGCAGCCTACAGGGG + Intergenic
991456251 5:66807661-66807683 TTCCTCTATGCAGGGAAAGTGGG - Intronic
996556098 5:124780470-124780492 TTCGTCGATGCAGCCTAAGGTGG - Intergenic
997710441 5:135999573-135999595 TTCTTCTGAGCAGCGGAAGTGGG + Intergenic
998352668 5:141511552-141511574 TTCCTCTTTCCCGAGTAAGGTGG + Exonic
999102185 5:149035751-149035773 GTCCTCTGTGCTGTGTGAGGTGG - Intronic
999110366 5:149115164-149115186 GTCCTCTGTGCTGTGTGAGGTGG - Intergenic
999325982 5:150643843-150643865 TTTCTCTGTGCAGCCTGGGGAGG + Intronic
1001415135 5:171540330-171540352 TTCCTCTGTGCATCCTAATATGG + Intergenic
1002135703 5:177106166-177106188 TTCCACTTAGCAGTGTAAGGCGG - Intergenic
1004008028 6:11654734-11654756 TTCCTATGTTCAGCATAAAGGGG + Intergenic
1007355048 6:41308594-41308616 TTCCTCGGTGCTGCCTATGGAGG - Intergenic
1007916357 6:45565271-45565293 TGCCTCTGGGCAGGGTCAGGAGG + Intronic
1007966005 6:46004333-46004355 TTCCTCTGTGCAAGGGAAGCTGG - Intronic
1014067418 6:117143880-117143902 TTCCTCTGTGTAGATGAAGGGGG + Intergenic
1016531712 6:145065679-145065701 CTCCTCTGTGCAGGGAAAAGAGG + Intergenic
1018731660 6:166656387-166656409 TTCCTCTGTGAAGGGTTGGGCGG + Intronic
1020011823 7:4809410-4809432 TTCCTGTGTGCACGGAAAGGAGG - Intronic
1028852188 7:95550242-95550264 TTCCTCTCTGGAGTGTCAGGAGG - Intergenic
1029214311 7:98934843-98934865 TTCCTCTGGGCAGTGGAATGGGG + Intronic
1029790946 7:102842630-102842652 TTCCTCTCTGGAGTGTAAGAAGG - Intronic
1032495937 7:132362375-132362397 TTCCTCTTTGGAGAGCAAGGGGG - Intronic
1034115517 7:148580356-148580378 TTCCTCGGTGCCGCCTACGGAGG + Intergenic
1034895207 7:154872116-154872138 TGCCTCTGTGCAGAGCCAGGTGG - Intronic
1036775863 8:11612903-11612925 ATCCTCTGTGGAGAGTGAGGAGG - Intergenic
1038488895 8:27955439-27955461 TTCCTCTGTGCAGCCCAGAGTGG - Intronic
1043575526 8:81651856-81651878 TTCCCATGTGCAGCTTGAGGGGG + Intergenic
1048864999 8:138753918-138753940 TTCCTCTGAGCTCCGTAAAGGGG - Intronic
1051329794 9:16012135-16012157 TTCCTCTGTGCTGCCCAAGGAGG + Intronic
1059331691 9:113539594-113539616 TTCCTTTGTTCAGCAGAAGGTGG - Intronic
1059634733 9:116159742-116159764 TTCCTCTGTGCAGGGAAAAATGG - Intronic
1060743772 9:126116700-126116722 TTCCTAAGAGCAGCGTGAGGCGG + Intergenic
1185565991 X:1095888-1095910 GTCCCCTTTGCAGAGTAAGGTGG + Intergenic
1186844811 X:13520150-13520172 TTTGTCTGTACAGCGAAAGGTGG - Intergenic
1193882810 X:86945519-86945541 TTCCCCTGACCAGCATAAGGTGG - Intergenic
1194530203 X:95038156-95038178 TTGCTCTGTGCTGAGTCAGGGGG - Intergenic