ID: 1130079702

View in Genome Browser
Species Human (GRCh38)
Location 15:80721839-80721861
Sequence CTTTGTTTCTGGAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 447}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130079693_1130079702 17 Left 1130079693 15:80721799-80721821 CCAGTAGGGCACTGGGGGCCTCC 0: 1
1: 0
2: 1
3: 10
4: 169
Right 1130079702 15:80721839-80721861 CTTTGTTTCTGGAGGGAAGGAGG 0: 1
1: 0
2: 2
3: 58
4: 447
1130079695_1130079702 -1 Left 1130079695 15:80721817-80721839 CCTCCTTCCTTGTTGTGGTAGAC 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1130079702 15:80721839-80721861 CTTTGTTTCTGGAGGGAAGGAGG 0: 1
1: 0
2: 2
3: 58
4: 447
1130079696_1130079702 -4 Left 1130079696 15:80721820-80721842 CCTTCCTTGTTGTGGTAGACTTT 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1130079702 15:80721839-80721861 CTTTGTTTCTGGAGGGAAGGAGG 0: 1
1: 0
2: 2
3: 58
4: 447
1130079697_1130079702 -8 Left 1130079697 15:80721824-80721846 CCTTGTTGTGGTAGACTTTGTTT 0: 1
1: 0
2: 1
3: 12
4: 205
Right 1130079702 15:80721839-80721861 CTTTGTTTCTGGAGGGAAGGAGG 0: 1
1: 0
2: 2
3: 58
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130079702 Original CRISPR CTTTGTTTCTGGAGGGAAGG AGG Intronic
900366162 1:2312798-2312820 CATCATTTCTGGAGGGCAGGCGG - Intergenic
901196789 1:7444789-7444811 CTTTGTTTTTAGAGGGTTGGGGG - Intronic
902743270 1:18455313-18455335 CTTTATTTCTGGGGGCAAGTGGG - Intergenic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
905022221 1:34825723-34825745 CTTGTTTTCTGAAGGGGAGGAGG + Intronic
905301478 1:36989069-36989091 CTGTGTTTGTGCAGGGAGGGAGG - Intronic
905562968 1:38941795-38941817 TTTTGTTTGGGGAGGGACGGAGG - Intronic
905714218 1:40134155-40134177 TTTTGTTACTGATGGGAAGGAGG + Intergenic
905853620 1:41292565-41292587 CATTGTTTCTGGAGGCCAGCAGG - Intergenic
906801517 1:48741516-48741538 CTTTGCCTCTGCAGGGGAGGAGG + Intronic
906885937 1:49648664-49648686 CATAGTTTCTGGAGAGAAGTTGG - Intronic
907372636 1:54013324-54013346 CTGTGTTCCTGCAGGGCAGGGGG + Intronic
907883522 1:58572976-58572998 GTTTGTTTTTGGTGGGGAGGTGG + Intergenic
910298679 1:85680204-85680226 CTTTATTTTTGGAGGGGAGTGGG - Intronic
911067946 1:93808668-93808690 TTTTGTTTTTGGAGGGCAGCTGG + Intronic
911590878 1:99746185-99746207 CATTGTATTTGGAGGCAAGGAGG - Intronic
912203082 1:107480465-107480487 CTTCGTTTGTGGAGGGGAGGGGG + Intronic
912236169 1:107853560-107853582 TTTTGGTTCTTGAGGGATGGGGG - Intronic
912687578 1:111779308-111779330 CTTTTTTTTTGGTGGGGAGGGGG - Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912703908 1:111897954-111897976 CCGTGTTTATGGAAGGAAGGTGG - Intronic
912856264 1:113171070-113171092 CTCTGCTTCTGGAGGGAGTGGGG - Intergenic
913560696 1:120015943-120015965 CTTTTTTTTTTGAGAGAAGGGGG - Intronic
913637430 1:120777659-120777681 CTTTTTTTTTTGAGAGAAGGGGG + Intergenic
915268611 1:154735778-154735800 CTTTCTGGCTGGAGGGATGGTGG + Intronic
916178104 1:162059766-162059788 CTGCTTTTGTGGAGGGAAGGTGG - Intergenic
916573864 1:166050287-166050309 CTTTCATTCAGGAGGGAAGGAGG + Intergenic
916640074 1:166718030-166718052 CATTGCCTCTGGAGGGAAAGTGG + Intergenic
916696845 1:167246284-167246306 CTTTGCTTTAGGAGGAAAGGGGG - Intronic
917106210 1:171494778-171494800 GTTTCTTTCTTGAGGGAGGGGGG - Intronic
917745605 1:178003825-178003847 CTGTGTTTGTGGAGGGAGTGTGG + Intergenic
918658384 1:187057653-187057675 CATTGCTTCTGGAGGAAATGTGG - Intergenic
919307227 1:195856815-195856837 CTTTGTTTCTAGCGGGATGCAGG - Intergenic
920442078 1:205987915-205987937 TTTTGTTTTTGGAGAGATGGGGG + Intronic
920572041 1:207024709-207024731 CCTTGTCCCTGGAGGGAAGGAGG - Intronic
920726322 1:208438574-208438596 CAATGTTTCTGGAGTGAGGGAGG + Intergenic
922704336 1:227781188-227781210 CTTTATTTCTGGATGGAAACGGG - Exonic
923029248 1:230234256-230234278 CTGTGCTTCTGAAGGGAAGTTGG + Intronic
924181508 1:241443454-241443476 CTTTGCTTCTGGAGACAATGGGG + Intergenic
1063578027 10:7279290-7279312 CTTTGTCTCTGGTGTGGAGGAGG - Intronic
1064941396 10:20739639-20739661 CTTTCTTTTGGAAGGGAAGGTGG - Intergenic
1065592810 10:27282843-27282865 CATTATTTCTGGAGGGTAGTGGG + Intergenic
1065657555 10:27967441-27967463 CATTATTTCTGGAGGGTAGTGGG - Intronic
1066633294 10:37477801-37477823 CTTTGTTTGGGGAGGGTAGACGG - Intergenic
1067561601 10:47308508-47308530 CTTTGTTTCTGTTGGGAAGAAGG - Intronic
1067908436 10:50318916-50318938 TTTTTTTGATGGAGGGAAGGAGG - Intronic
1067934051 10:50593062-50593084 CTCTGTTTTCGGAGGGAAGCTGG + Intronic
1068904775 10:62310540-62310562 CTTTGCTTCTGGAGAGAATGTGG + Intergenic
1069202235 10:65634520-65634542 ATTTTTTTTTGGAGGGGAGGGGG - Intergenic
1069495824 10:68902178-68902200 TTTTTTTTTTGGAGGGCAGGGGG - Intronic
1070232916 10:74589870-74589892 CTTTTTTTCTGGGGAGACGGAGG + Intronic
1070337903 10:75471201-75471223 CTTTTTTTCTGGCGGGGGGGTGG + Intronic
1071124446 10:82318058-82318080 CTTTGTGTCTGGTGGGCAGGGGG + Intronic
1071293374 10:84202681-84202703 CTTGGTTTCTGGCTGGGAGGGGG + Intronic
1071478117 10:86042184-86042206 CCATCTTTCTGGAAGGAAGGTGG - Intronic
1071504676 10:86225492-86225514 GTGTATTTCTGCAGGGAAGGAGG + Intronic
1071679070 10:87686119-87686141 CTTTGAATCTGGATGGAAGGTGG + Intronic
1072414593 10:95236682-95236704 CTCAGTGTCTGGAGGGATGGGGG + Intergenic
1074086372 10:110210991-110211013 CCTGGTTTCTGGAAGGAAGCAGG + Intronic
1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG + Exonic
1074890065 10:117728327-117728349 CTTTGCTTCTGGAGGTTAGCTGG + Intergenic
1074969680 10:118525860-118525882 CTCTATTTCTGAAGGGAAGAAGG + Intergenic
1076132209 10:128021201-128021223 CTTTTTTTCAGGTGGGATGGTGG + Intronic
1076142334 10:128089587-128089609 CTTGGTGTCTGGAGAGGAGGAGG - Intergenic
1078095050 11:8291689-8291711 CCCTGTTTCCGGAGGGCAGGTGG + Intergenic
1078191087 11:9092553-9092575 ATTTGTTCCTGGAGTGATGGTGG - Intronic
1078335045 11:10456490-10456512 CTTCCTTTCTGGAGGGACTGTGG + Intronic
1078355727 11:10630134-10630156 CAATGTGACTGGAGGGAAGGTGG - Intronic
1078641441 11:13100728-13100750 CTCTGTTTCTTGATGGGAGGAGG - Intergenic
1079391299 11:20024217-20024239 GCTTGTTTCTGGAAGGAAGAGGG + Intronic
1079525830 11:21386447-21386469 CTTTGTCTATGGAAGGAAGTGGG - Intronic
1080015896 11:27506643-27506665 CTGTGTCGCTGGAGGGGAGGAGG - Intronic
1080264656 11:30388345-30388367 CTTGGCTCCCGGAGGGAAGGGGG + Intronic
1080437491 11:32259173-32259195 TTTTGCTTCTGAAGGGAGGGAGG - Intergenic
1082124709 11:48418498-48418520 GTTTGTGTCTGCAGGGAAGTAGG + Intergenic
1082673499 11:56066647-56066669 CTTTGTTTCTTGAGGGATTTAGG - Intergenic
1082939692 11:58691453-58691475 CTTTGTTGCTGTAGGGAACAAGG - Intronic
1083333815 11:61911645-61911667 CTCTGTTTCTGCAGGGAACGGGG - Intronic
1083486605 11:62986880-62986902 ATTTGTTTCTGGTGAAAAGGTGG + Intergenic
1083902658 11:65651099-65651121 ATTTGGTTCTGCAGGGAAGCAGG + Intergenic
1083953577 11:65970531-65970553 ATTTATTTCAGGAGGGAAGGTGG + Intronic
1084067809 11:66715390-66715412 CTTTGGCTGTGGAGGGACGGGGG + Exonic
1084069238 11:66723366-66723388 CTCGGGTTCTGGAAGGAAGGAGG + Intronic
1085932883 11:81106425-81106447 CTTTGTTGCTGGAAGAGAGGTGG + Intergenic
1086040713 11:82474174-82474196 TTTTGTTTTTGCAGGGGAGGGGG + Intergenic
1086320275 11:85639139-85639161 CTTTGTTCCTGTAGTGAAGCTGG - Intergenic
1087085574 11:94214870-94214892 ACTTGTTGTTGGAGGGAAGGGGG + Intergenic
1087268433 11:96085832-96085854 ATTTCTTTATGGAGGGAAAGAGG + Intronic
1087373530 11:97315711-97315733 CTTTGTTTCTGGTGTAAAGAAGG + Intergenic
1087769955 11:102197844-102197866 CTTTGTTTCCTGGGGAAAGGGGG - Intronic
1088015727 11:105057093-105057115 TTTTGTGTGTGGAGGGATGGAGG - Intronic
1088209991 11:107444105-107444127 TTTTTTTTAAGGAGGGAAGGGGG + Intronic
1089130447 11:116208078-116208100 CTTTTTCTCTAGAGGGAAAGTGG + Intergenic
1089458036 11:118636784-118636806 CTTTCTTTCTGGAGGGAATGCGG + Intronic
1089794027 11:120966156-120966178 CTTCTTTTGAGGAGGGAAGGAGG + Intronic
1090499357 11:127246763-127246785 TTTTGTTGGTGGAGGGAAGGGGG + Intergenic
1090556057 11:127877849-127877871 ATTTGTTTCAGGAGGAAATGGGG - Intergenic
1090645380 11:128763132-128763154 TTGTGTCTCTGGTGGGAAGGAGG + Intronic
1090964403 11:131585432-131585454 CTTGGTTCCTGCAGGAAAGGAGG + Intronic
1091068889 11:132544325-132544347 CTTAGTTCCTGGTGGGCAGGTGG - Intronic
1091150702 11:133326152-133326174 AATTGTTTTTGGAGGGAAAGAGG - Intronic
1091280948 11:134381244-134381266 CTTTGCTTCTGAAGTGTAGGTGG + Intronic
1091383879 12:79602-79624 CTTTGTTTTTGTAGAGACGGAGG + Intronic
1095838288 12:46663108-46663130 CTTTTATTCTAGTGGGAAGGGGG + Intergenic
1096559272 12:52424197-52424219 CTCTGCATCTGGAGGGAGGGAGG + Exonic
1096868179 12:54577534-54577556 CTTTGTTCCTGCAGGGACTGGGG - Intronic
1097444378 12:59649948-59649970 CTTTTTTTTTGGTGGGGAGGGGG - Intronic
1097798817 12:63890706-63890728 CTTTGATTTTGCAGGGATGGGGG - Intronic
1098373969 12:69792292-69792314 CCTTTTTTTTGGAGGGGAGGTGG - Intronic
1098878850 12:75895699-75895721 ATTTGTTTCTGGAGTAAAAGTGG - Intergenic
1098933584 12:76450789-76450811 TTTTGTTTTTGGAGGGGAGAAGG - Intronic
1100349377 12:93764315-93764337 CAGAGTTGCTGGAGGGAAGGGGG + Intronic
1100721141 12:97359939-97359961 GTTTGTTTCTGGAGGCATGTTGG + Intergenic
1101318917 12:103655692-103655714 CTTGGTTGTTGGAGGGTAGGTGG - Intronic
1101665941 12:106814773-106814795 TTTTGTCTCTGGAGAGAATGCGG - Exonic
1101739774 12:107491923-107491945 CTTTTTTTCTGTAGAGAAAGAGG + Intronic
1101834006 12:108282367-108282389 CTTCGTTTCTGAAGACAAGGTGG + Intergenic
1102206835 12:111096619-111096641 CTTGCTTTCTGGAGGGAAAGAGG - Intronic
1102271603 12:111541242-111541264 CTTTAATTCTGGAGGAAAGGTGG - Intronic
1102906135 12:116676503-116676525 CTTTTTTTTGGGAGGGAAGGGGG - Intergenic
1103629022 12:122244344-122244366 CTTTTTGTGTGGAGGGTAGGTGG - Intronic
1103662040 12:122527861-122527883 ATTTGTTTGGGAAGGGAAGGAGG - Intronic
1104704815 12:130935192-130935214 CTTTGTTTCAGGGAGGGAGGTGG + Intergenic
1106674354 13:31942144-31942166 CTTTTTTTCTGTAGAGATGGGGG - Intergenic
1106743146 13:32669289-32669311 CTTTTTTTTTGGAGGGGAGGGGG + Intronic
1106971055 13:35142254-35142276 CTTTTCTCCTGGAGAGAAGGAGG - Exonic
1107348561 13:39489551-39489573 CTTTTTTTTTGGAGGGGAGCGGG + Intronic
1108223774 13:48266326-48266348 TTTTCTTTGTGGAGGGCAGGGGG - Exonic
1108637305 13:52348357-52348379 CTGTGTTTCTGCAGGGATGAAGG - Intergenic
1110317852 13:74132115-74132137 CTTTTTTCCTTGAGGGAGGGGGG + Intronic
1111999970 13:95201062-95201084 CATAGTTTCTGGTGGGAGGGTGG - Intronic
1113192282 13:107762553-107762575 CATTGTGTATGGAGGTAAGGCGG + Intronic
1113377860 13:109782002-109782024 CTTGGCGTCTGGCGGGAAGGAGG - Intronic
1113710717 13:112462863-112462885 CTTTGTTTCTGATGGGAAGTTGG - Intergenic
1113777944 13:112959486-112959508 CTTTGTTCCTGCAGTGAGGGAGG + Intronic
1114674420 14:24430947-24430969 CTTGGTGCCTGGAGGGATGGGGG - Intronic
1115892683 14:38049374-38049396 CTGAGTTTCTTGAGGGAATGAGG + Intergenic
1117119840 14:52554557-52554579 CTTTTCTTTTGGTGGGAAGGAGG - Intronic
1117288058 14:54306757-54306779 CTTTCTTCCTGTGGGGAAGGTGG - Intergenic
1117577181 14:57111224-57111246 TTTTTTTTCTGGAGGGCATGTGG - Intergenic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1119924924 14:78484515-78484537 CTTTTTTTCTGGGGGAGAGGGGG + Intronic
1120862459 14:89267075-89267097 CTTTTTTCCTGTAGGGAAGAAGG - Intronic
1122710424 14:103652821-103652843 CTTTGTTAGTGGAGTGGAGGTGG + Intronic
1124530434 15:30500750-30500772 ATTTGTGTCTGGAGGGCAGGGGG - Intergenic
1124631847 15:31342393-31342415 CTGGGTCTCAGGAGGGAAGGCGG - Intronic
1124768225 15:32506938-32506960 ATTTGTGTCTGGAGGGCAGGGGG + Intergenic
1125759859 15:42088968-42088990 GTTTTTTTCTGGAATGAAGGTGG - Intronic
1125925249 15:43557841-43557863 TTTTTTTTCTGGAGAGATGGGGG + Intronic
1127486366 15:59421394-59421416 CTTAGTTTCTGGAGGAAAATGGG + Intronic
1128084762 15:64878095-64878117 ATTTGTTTCTGGAGGGCCAGAGG + Intronic
1128617383 15:69120921-69120943 CTTATTATCTGGAGGGAAGATGG + Intergenic
1129023539 15:72546922-72546944 CTTTTTTTTTGGAGGGGGGGGGG + Intronic
1130079702 15:80721839-80721861 CTTTGTTTCTGGAGGGAAGGAGG + Intronic
1130763492 15:86845953-86845975 CTTTCTTTCAAGAGGGAAGAAGG - Intronic
1130897818 15:88184292-88184314 CTATGTGTCTGCAGGGGAGGAGG + Exonic
1131337297 15:91561617-91561639 CTTTGTTTCTCGTGGGTAGGAGG - Intergenic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133148761 16:3810633-3810655 CTTGATATCTGTAGGGAAGGTGG + Exonic
1134682781 16:16138027-16138049 TTTTGTTTTTGGAGAGATGGGGG + Intronic
1135075370 16:19388867-19388889 TTTTTTTTCTAGAGGGTAGGGGG + Intergenic
1135939356 16:26807552-26807574 ATTGGTTTCTGGGGGGAAGGAGG - Intergenic
1136593020 16:31229074-31229096 CATGGTGTCTGGAGGGATGGTGG + Intergenic
1137942768 16:52704919-52704941 TTTTATTTTTGGAAGGAAGGTGG - Intergenic
1138059318 16:53873130-53873152 CTTTGATTATGGAGGGAAAGAGG + Intronic
1138185582 16:54974681-54974703 GTTTGTTTCTCAAGTGAAGGTGG - Intergenic
1140452427 16:75081460-75081482 TTTTGTTTCTTGAGGGAAAGTGG + Intronic
1140462567 16:75152045-75152067 CTTAGTTTCTGATGAGAAGGTGG + Intronic
1140672934 16:77296820-77296842 CTTTTTTTTTGGAGGGGAGGAGG - Intronic
1141017534 16:80464689-80464711 ATTTGCTCCTGGAGGGATGGAGG + Intergenic
1141025397 16:80541570-80541592 CTCTTTTTCTGGGGGGGAGGGGG - Intronic
1141525554 16:84608932-84608954 CATTGTTTCTGGAGCAAAGTAGG + Intronic
1142158186 16:88542507-88542529 GTTTGATTGTGGAAGGAAGGAGG - Intergenic
1142253997 16:89005365-89005387 CTTTGCTCCTGCGGGGAAGGAGG + Intergenic
1143880749 17:10027855-10027877 CTTTATTTTTGGAGAGATGGAGG - Intronic
1144466702 17:15502934-15502956 CTTTGGGCCTGGAGGGGAGGTGG - Exonic
1144511810 17:15883480-15883502 CTGTGGTTCTGGAGGAGAGGAGG + Intergenic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1146560042 17:33860236-33860258 CTTTCTACCTGGAGGGAAGAAGG - Intronic
1148645548 17:49217970-49217992 CTGGGGTTCTGGAGGGAAAGGGG - Intronic
1148910299 17:50938961-50938983 CTATTTTTCTGGTGGGAAGCAGG - Intergenic
1149488959 17:57068241-57068263 CTTTGATTCTGGAGAAAAAGGGG + Intergenic
1149869351 17:60168423-60168445 CTTTTTTTGTGGGGGGCAGGTGG + Intronic
1150894275 17:69192583-69192605 CTTTGTTTCTGAAGCGAAAGTGG - Exonic
1151257823 17:72893103-72893125 TTTTCTTTTTGGAGGGAAGTTGG - Intronic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152528431 17:80902843-80902865 CAGGGTTTCGGGAGGGAAGGCGG - Intronic
1152723045 17:81932123-81932145 CACTGCCTCTGGAGGGAAGGGGG + Intergenic
1152862250 17:82703221-82703243 CTCTGCTTCTGAAGGGAAGAGGG - Intergenic
1153225387 18:2895830-2895852 GTATGTTTGGGGAGGGAAGGGGG + Intronic
1153500186 18:5741134-5741156 ATTTGTTTCTTGTGGTAAGGAGG - Intergenic
1153542905 18:6175230-6175252 CACTGTTTCTGGTGAGAAGGTGG - Intronic
1154385176 18:13886708-13886730 CTGTGTCTCTGGGGTGAAGGCGG + Intronic
1156382158 18:36572949-36572971 GTTTGTTTGGGAAGGGAAGGAGG + Intronic
1156572885 18:38279179-38279201 CTTTGTTTCCACAGGAAAGGAGG - Intergenic
1157413588 18:47484073-47484095 CTTTGTTGCTGCAGGGACAGAGG + Intergenic
1158617353 18:59000524-59000546 TTTTGTTTCTGTAAGGATGGTGG - Intergenic
1158815291 18:61088036-61088058 CTTTCTTTCTGGGGGTGAGGGGG - Intergenic
1158849641 18:61482525-61482547 TAGTGTTTCTGGAGAGAAGGTGG - Intronic
1159795249 18:72835312-72835334 CTTTTATTCTGGAGGCAAAGAGG + Intronic
1160376543 18:78418044-78418066 CTATGTTTCTTGAAGGAAGTTGG + Intergenic
1161409241 19:4107705-4107727 CTTTTTTTGTGGGGGGTAGGGGG - Intronic
1161627090 19:5333608-5333630 CTTTGTGGCTGGAGGTGAGGGGG - Intronic
1163239768 19:16053600-16053622 CTTTTTTTGTGGGGGGAGGGGGG + Intergenic
1165015487 19:32877312-32877334 CCTTGTTTCAGGTGGGAAGGAGG - Intergenic
1165047735 19:33119036-33119058 TTTTGTATCGGGAAGGAAGGTGG - Exonic
1165804803 19:38573677-38573699 TTTTTTGTCTGGGGGGAAGGGGG - Intronic
1166195734 19:41204514-41204536 GTTTGATTCTGCAGTGAAGGTGG - Intronic
1166303472 19:41924828-41924850 CGGTGTTTCTGGAGAGAAGCAGG + Intronic
1166566949 19:43771162-43771184 CTGGGTCTATGGAGGGAAGGAGG + Intronic
1166674538 19:44731998-44732020 CTATGTCTCCGGAGGGCAGGTGG + Intergenic
1166884741 19:45953340-45953362 CGTTAATTATGGAGGGAAGGAGG + Intronic
1167248063 19:48385716-48385738 CTTGGTTTGTGGAAGGAAGGTGG + Intronic
1167707431 19:51089993-51090015 CATTGTTTCGGGAAGGAAGAAGG + Intergenic
1168081382 19:54012729-54012751 GTATGTTTCTGGAGGGAATATGG - Intergenic
924998550 2:385893-385915 CTCCCTCTCTGGAGGGAAGGTGG + Intergenic
925018397 2:548991-549013 CTTTGTTTCAGCAGGGATGGTGG + Intergenic
925769287 2:7266628-7266650 CACTGTATCTGGAGGGAAGGAGG - Intergenic
926447199 2:12957438-12957460 CTTTTGTTCTGTAGGGAAGATGG + Intergenic
926631335 2:15139014-15139036 GTTTGTTCTTGGAGGGCAGGAGG + Intergenic
927352133 2:22128099-22128121 ATTTGTGTCTGGTGGGAAGGGGG - Intergenic
927798087 2:26069663-26069685 CTTTTTTTTTGGGGGGTAGGGGG - Intronic
927862445 2:26568532-26568554 CCTTTCTTCTGGAGAGAAGGAGG - Intronic
928077767 2:28280812-28280834 CTTTGTTTCTGGAGGCCAAATGG - Intronic
929254680 2:39797106-39797128 CATTGTTTCTGGAGTCATGGTGG + Intergenic
930979051 2:57499372-57499394 TTTTGTTTTTGAAGGGAAGTAGG - Intergenic
931178587 2:59877467-59877489 CACTGTTTGGGGAGGGAAGGGGG - Intergenic
931791788 2:65670062-65670084 CTTTCTTACTGGTGGGAATGTGG + Intergenic
932000046 2:67876823-67876845 CTTTGTTTCATGAAGTAAGGTGG - Intergenic
932574096 2:72953371-72953393 ATTTGAGACTGGAGGGAAGGAGG + Intronic
937670616 2:124533734-124533756 CTTTGTTTGTAGTGGGAAGCAGG - Intronic
937862827 2:126724398-126724420 GTGTGTTTGTGGAGGAAAGGAGG - Intergenic
939001425 2:136740006-136740028 ATTTTTTTCTGAAAGGAAGGAGG + Intergenic
939583273 2:143976873-143976895 CTTTGCTTTTTGAGGGAGGGTGG + Intronic
939958315 2:148545288-148545310 ATTTGTTTCTGTAGTGAGGGAGG - Intergenic
940144965 2:150536284-150536306 TTTTATTTCTGTAGGGCAGGGGG - Intronic
940265675 2:151833271-151833293 CTGTGTTTTTGTAGGGATGGTGG - Exonic
941908572 2:170740663-170740685 ATTTTTTTCTGGAGAGAAGGAGG - Intergenic
942748602 2:179264266-179264288 CTTTGTCTGTGGCGGCAAGGCGG + Intronic
942756654 2:179349131-179349153 CTCTGCTTCTGGAGGGATGCTGG - Intergenic
943199631 2:184803858-184803880 CTTTTTTTTTGGGGGGGAGGGGG + Intronic
943771246 2:191720253-191720275 CCTAGTGTCTTGAGGGAAGGTGG - Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946404809 2:219486672-219486694 CCTTGTTTCTGCAGGGAACGGGG - Intronic
947326370 2:228982928-228982950 CTATGTATCTGGAGGAAATGAGG + Intronic
947709818 2:232306560-232306582 CTGTGTTTGTGTTGGGAAGGAGG + Intronic
947746316 2:232509058-232509080 GTTTCTTTCTGGAGGGCAGAGGG - Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948438273 2:237968031-237968053 ATTCGTTTGTGAAGGGAAGGAGG + Intronic
1169215843 20:3794562-3794584 CTTAGTGCCAGGAGGGAAGGGGG - Intronic
1169218755 20:3808355-3808377 AGTAGTGTCTGGAGGGAAGGGGG + Intergenic
1169529315 20:6467127-6467149 CTTTGTGTCTTGTGGGAAGCAGG + Intergenic
1170116067 20:12861059-12861081 CTTTGTTTCTGGGAGTAAGGTGG + Intergenic
1170435296 20:16320403-16320425 ATTTTTTTGTGGAAGGAAGGAGG - Intronic
1171333782 20:24364533-24364555 CTTTGTTGAGGGAGGGAGGGTGG + Intergenic
1172188153 20:33044327-33044349 CTTGGGATCTGGAGGGAAGCTGG + Intergenic
1172862428 20:38065288-38065310 TTTTTTTTCTGGCGGGGAGGGGG + Intronic
1172993468 20:39052586-39052608 CTTTGTTTCTTGAGGCAAGTGGG + Intergenic
1173986581 20:47266265-47266287 TTTTGTTTTTGGGGGGGAGGGGG + Intronic
1174763663 20:53231041-53231063 TTTGCTTTCTTGAGGGAAGGAGG + Intronic
1175397262 20:58675059-58675081 CCTTGTGGCTGGAGGGAAGATGG - Intronic
1175716642 20:61259061-61259083 CTTTGTTTTAGGAAGGAAGAAGG + Intronic
1175989255 20:62779324-62779346 CCTGCTTTCTGAAGGGAAGGTGG - Intergenic
1176361641 21:6001711-6001733 CCTTATTTCTGGAGGGATGAAGG + Intergenic
1177576575 21:22964307-22964329 CATTGTTGCTGAAGGGAAGGGGG + Intergenic
1178300673 21:31450249-31450271 TGTTGTTTCTGTAGGGAAGTTGG - Intronic
1178640823 21:34343718-34343740 TTATTTTTCTGGATGGAAGGGGG - Intergenic
1179761877 21:43536839-43536861 CCTTATTTCTGGAGGGATGAAGG - Intronic
1180141563 21:45896377-45896399 CATTGTCTCTGTAGGAAAGGCGG + Intronic
1180141595 21:45896554-45896576 CATTGTCTCTGTAGGAAAGGCGG + Intronic
1180141646 21:45896849-45896871 CATTGTCTCTGTAGGAAAGGCGG + Intronic
1180141657 21:45896908-45896930 CATTGTCTCTGTAGGAAAGGCGG + Intronic
1180141668 21:45896967-45896989 CATTGTCTCTGTAGGAAAGGCGG + Intronic
1180141679 21:45897026-45897048 CATTGTCTCTGTAGGAAAGGCGG + Intronic
1180759490 22:18188653-18188675 CTTTGTTTCTGTATTGCAGGTGG - Intergenic
1180769800 22:18372953-18372975 CTTTGTTTCTGTATTGCAGGTGG - Intergenic
1180776529 22:18489713-18489735 CTTTGTTTCTGTATTGCAGGTGG + Exonic
1180809257 22:18747082-18747104 CTTTGTTTCTGTATTGCAGGTGG + Intergenic
1180827737 22:18875909-18875931 CTTTGTTTCTGTATTGCAGGTGG - Intergenic
1181072178 22:20352063-20352085 CTTTGTTTCTGTATTGCAGGTGG + Intronic
1181195252 22:21181004-21181026 CTTTGTTTCTGTATTGCAGGTGG + Intergenic
1181214195 22:21311770-21311792 CTTTGTTTCTGTATTGCAGGTGG - Intergenic
1181561613 22:23706293-23706315 CTTTGTGTCTGGTGAGAGGGAGG - Intergenic
1181730554 22:24843313-24843335 ATGTGTTTCTGCAGAGAAGGTGG + Intronic
1182074252 22:27484083-27484105 GTTTGGCTATGGAGGGAAGGAGG - Intergenic
1182213889 22:28699926-28699948 TTGTGTTTCAGGATGGAAGGGGG - Exonic
1182834321 22:33329428-33329450 TTTTTTTTGTGGGGGGAAGGGGG + Intronic
1183258301 22:36777267-36777289 CTAGGTGTCTGGAGGGAATGTGG - Intergenic
1183343029 22:37292527-37292549 CTGGGTTTCCGGAGGGAAGGGGG + Intronic
1183992192 22:41604915-41604937 TCTTGTTTCTAGAGGGGAGGGGG + Intronic
1184190200 22:42889438-42889460 ATTTCATTCTAGAGGGAAGGAGG + Intronic
1184731652 22:46373994-46374016 CGTTGTTTCTGGAGGGTGGCTGG - Intronic
1203231629 22_KI270731v1_random:114137-114159 CTTTGTTTCTGTATTGCAGGTGG - Intergenic
1203277837 22_KI270734v1_random:101906-101928 CTTTGTTTCTGTATTGCAGGTGG - Intergenic
949747179 3:7308485-7308507 TTATGTGTCTGGAGGGATGGAGG + Intronic
949875862 3:8625640-8625662 TGTTCTTCCTGGAGGGAAGGAGG + Exonic
950475864 3:13214481-13214503 ATTTGTTTCTTGGAGGAAGGAGG - Intergenic
951393312 3:22133805-22133827 CTTTGTTTGTGGAGAAAAGTAGG - Intronic
951447436 3:22798960-22798982 CTCTGTGTCTGGAGGCAAAGTGG - Intergenic
951853685 3:27170815-27170837 CTTTGTGTCTGGAGAAAGGGAGG - Intronic
951873629 3:27395348-27395370 CCTGGTTTCAGGGGGGAAGGAGG - Intronic
952075654 3:29694145-29694167 GTTTGTGTGTTGAGGGAAGGGGG + Intronic
952762643 3:36928277-36928299 TTTTGTTTGTGAAGGGAATGGGG + Intronic
953331029 3:42053311-42053333 CTTTTTTTCTGGAGGCAGGGAGG - Intronic
954050834 3:47975746-47975768 TTTTATTTGGGGAGGGAAGGTGG - Intronic
954853004 3:53619058-53619080 CGTTGTTTCTGCATGGAGGGAGG - Intronic
955047468 3:55373618-55373640 CTTAGTTTGTGGGTGGAAGGTGG + Intergenic
955067321 3:55544430-55544452 CTTTGTCTCTGGCTGGAAAGAGG + Intronic
956251834 3:67242162-67242184 CTTTCTTTTTGGTGGGAAGGAGG + Intergenic
957540831 3:81566780-81566802 TCTTTTTTCTGGGGGGAAGGAGG + Intronic
957687443 3:83520361-83520383 GTGTGTTTCTCGAGGGAAAGGGG - Intergenic
958054596 3:88393032-88393054 CTTTGTATCAGGAGGAAAGGAGG + Intergenic
958773563 3:98455001-98455023 CTTTATTTCTGGAGGGAACATGG - Intergenic
959366730 3:105469673-105469695 ATTTGTATCTGTAGGGAAGTTGG + Intronic
959714552 3:109417996-109418018 CTTTTTTTCTGGAGGGCGGGGGG + Intergenic
959831771 3:110871495-110871517 CTTTTTTTCTGGAAGGTAGAGGG + Intergenic
960538148 3:118835487-118835509 CTTTTGCTATGGAGGGAAGGAGG - Intergenic
961522618 3:127475680-127475702 CTTTGTCCTTGGAGGGAAGCTGG + Intergenic
961713665 3:128845115-128845137 CTTTGGTTTTGCTGGGAAGGTGG + Intergenic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962982654 3:140504778-140504800 CTCTGGCTCTGGAGAGAAGGTGG - Intronic
963192454 3:142487843-142487865 TTTTGTTTATGGTGGGAAGAAGG + Intronic
963272961 3:143303376-143303398 TTTTTTTTTTTGAGGGAAGGAGG + Intronic
963511347 3:146251911-146251933 ATTTGATCTTGGAGGGAAGGCGG + Intergenic
964028529 3:152107817-152107839 CTTGGTTTCTGGAGGCAACTTGG - Intergenic
964221723 3:154354571-154354593 TTTTTTTTTTGGAGGGCAGGCGG + Intronic
965605895 3:170497041-170497063 TTTTGTAGCTGGAGGCAAGGGGG - Intronic
967075674 3:185999823-185999845 CTTTTTTTCTGGGGGGGTGGGGG - Intergenic
967324259 3:188223587-188223609 ATTTGTGCCTGGAGGGAAGCTGG + Intronic
967407735 3:189136262-189136284 CATTGTTTCAGAAGGGAAGGTGG + Intronic
967408009 3:189138765-189138787 CTTTGTGTCTGGAGAACAGGAGG + Intronic
967438390 3:189477849-189477871 CTGGGCTTCTGGAGGGGAGGGGG - Intergenic
967741734 3:193010480-193010502 CTGTGTTCCTGGAGGGAATGTGG + Intergenic
967814593 3:193788241-193788263 CTGTGTTGCTGGGGAGAAGGTGG + Intergenic
968295704 3:197575144-197575166 CTCTGTTTTTGGCTGGAAGGTGG - Intergenic
968951964 4:3700004-3700026 CCTTGTCACTGGAGGGAAAGCGG - Intergenic
969275401 4:6131751-6131773 CATGGTTTCTGCAGGGAAGTCGG - Intronic
970057088 4:11987153-11987175 CTTTGTATTTGGAGTGAAGAGGG - Intergenic
970090713 4:12404520-12404542 CAGTTTTTCTGGAGGCAAGGTGG - Intergenic
970978287 4:22066982-22067004 TTTTCTTTCTGGAGGAAACGGGG + Intergenic
971671129 4:29559336-29559358 TTTTGTGTGTGGAGGGATGGAGG + Intergenic
972741689 4:41893220-41893242 CTTGGTGTCTGGAGGGAGGGAGG - Intergenic
974218992 4:58941390-58941412 TTATGTTTCTGGAGAGCAGGTGG - Intergenic
974449570 4:62035640-62035662 CTTTGTGTCTGGAAAGAATGAGG - Intronic
976756072 4:88498937-88498959 TTTTGTTTTTGTGGGGAAGGCGG - Intronic
977239792 4:94554180-94554202 CATTGTCTCTGGATGGAAGATGG - Intronic
977565748 4:98578790-98578812 CTTTGGATCTGGAGGAAAAGTGG - Intronic
977809968 4:101347096-101347118 CTTTTATTCTTGGGGGAAGGGGG + Exonic
978097277 4:104793368-104793390 CATTGTGTCTGGCAGGAAGGTGG + Intergenic
978169149 4:105648343-105648365 CCTTGTTTCTGGAGGTCAGTGGG + Intronic
978433174 4:108654513-108654535 CTTTGTAGCTGGAAAGAAGGAGG + Intronic
979402045 4:120260754-120260776 CCTTGAATCTGGAGGCAAGGGGG + Intergenic
980478002 4:133345059-133345081 ATTTGTATGTAGAGGGAAGGAGG + Intergenic
981569443 4:146135781-146135803 CTTTGTTTCAGGAGGAAAAATGG - Intergenic
981618912 4:146671766-146671788 CTCTGTGACTGGAGAGAAGGAGG + Intergenic
981734120 4:147931635-147931657 CTCTGTATTTGGAGAGAAGGTGG + Intronic
984028287 4:174571241-174571263 TTTTAATTCTGGAGGGAAAGAGG - Intergenic
984382433 4:179012783-179012805 ATTTGTATCTGGTGGGTAGGGGG - Intergenic
984508651 4:180653018-180653040 TTTTGGTTCTGGACAGAAGGAGG + Intergenic
984779831 4:183515009-183515031 CTTAGATTCTGGAGTGAATGGGG + Intergenic
984965827 4:185138898-185138920 CTTGGTTGCTGGAGGCAGGGAGG - Intergenic
986856529 5:11875124-11875146 CTTTGCTTCTGAAGGGACAGAGG - Intronic
988298133 5:29391629-29391651 CTTTTCTTCTGGAAGGAGGGTGG - Intergenic
988679983 5:33475524-33475546 CTCATTTACTGGAGGGAAGGAGG - Intergenic
990475543 5:56158692-56158714 TTTTCTTTTTGGAGGGGAGGGGG + Intronic
990635808 5:57725055-57725077 CTTTGTTTCTGAAGGGCTTGAGG + Intergenic
990729970 5:58797553-58797575 CTATCTCTATGGAGGGAAGGAGG - Intronic
992125653 5:73637319-73637341 CTAAGTTTCTTGAGAGAAGGAGG - Intronic
992132490 5:73707122-73707144 CTTTACTTCTGGGGGCAAGGTGG - Intronic
993011624 5:82489659-82489681 ATCTGTTTCTGGAGAGAATGTGG - Intergenic
994357484 5:98810300-98810322 CTTTGTTTATGGAGAACAGGAGG - Intergenic
995550940 5:113280682-113280704 CTTTGTTTTGAGAGGGCAGGAGG + Intronic
995590305 5:113692892-113692914 GCTTGTCTCTGTAGGGAAGGAGG - Intergenic
996007511 5:118440623-118440645 CTTCATTTTTGGAGGCAAGGAGG - Intergenic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
996446703 5:123561592-123561614 TTTTGTAACAGGAGGGAAGGAGG + Intronic
996500347 5:124209632-124209654 CTTTGCTTTTGGAGGAAAGAGGG - Intergenic
997685218 5:135783727-135783749 CTTAATTTCCAGAGGGAAGGAGG + Intergenic
998005330 5:138653173-138653195 CTTTGTTTCTAAAGGGAATGTGG - Intronic
998852512 5:146364433-146364455 CCTTCTTTTTGCAGGGAAGGAGG + Intergenic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1000643405 5:163732544-163732566 CCTTGTTACTGGAGTGAAGTTGG + Intergenic
1001856994 5:175021609-175021631 CTTCTTTTCTGGAGGGGACGTGG - Intergenic
1001929487 5:175662608-175662630 CTTTGTTGCTTGAGGGGTGGGGG - Intronic
1002270220 5:178066938-178066960 CTTTGTGGAAGGAGGGAAGGAGG + Intergenic
1002628544 5:180551360-180551382 CTTATTTTCTAGAGGGGAGGAGG - Intronic
1003425937 6:5998385-5998407 CTTTGTGTTTGGAGGATAGGAGG - Exonic
1004408853 6:15361619-15361641 CTTTTTTTTTGGCGGGAGGGTGG + Intronic
1005446637 6:25930837-25930859 CTTTTTTTCTGAAAGCAAGGGGG + Intergenic
1005499886 6:26420687-26420709 ATTTTTTTTTGGAGGGAAGAGGG + Intergenic
1005909106 6:30292530-30292552 TTTTGTTTCTGGAGGGAAAAGGG + Intergenic
1007071480 6:39041419-39041441 CTTTTTCTCTGGAGGAAAGGTGG - Intergenic
1007636469 6:43302640-43302662 CTTCATATCTGGAGGGAAGCGGG - Exonic
1007650593 6:43418205-43418227 CTTTCTTTCTTTAGGGAAAGAGG - Intergenic
1008851342 6:56026276-56026298 CCCCCTTTCTGGAGGGAAGGGGG + Intergenic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1011182598 6:84637634-84637656 CTTTTTTTCTGGAGAGAATGGGG - Intergenic
1011284188 6:85706250-85706272 CTTTGTTCCTGGCTTGAAGGTGG + Intergenic
1012051005 6:94343873-94343895 TTTTGTTCCTGGATGGAAGGTGG + Intergenic
1012305903 6:97656823-97656845 CTATGTAACAGGAGGGAAGGAGG + Intergenic
1012934335 6:105350195-105350217 CTTTGTTTCTTGACTGAAAGAGG - Intronic
1012949871 6:105506445-105506467 CCTTGCCTCTGGAGGCAAGGCGG + Intergenic
1013160795 6:107542842-107542864 TTTTCTTTCTGTAGGGCAGGTGG + Intronic
1013262978 6:108464759-108464781 TTTTGTTTTTTGAGGGGAGGGGG - Intronic
1013949888 6:115767069-115767091 ATTCCTTTTTGGAGGGAAGGTGG + Intergenic
1013959285 6:115879707-115879729 CTTTTCTTCTAGAGGGAATGAGG - Intergenic
1015138343 6:129900043-129900065 ATTCTTTTCTGGAGTGAAGGGGG + Intergenic
1015394344 6:132718095-132718117 ACTTGTTACTGGTGGGAAGGAGG - Intergenic
1017058640 6:150460164-150460186 TTTTTTTTCTGATGGGAAGGTGG + Intergenic
1018216744 6:161535717-161535739 CTTTGTTTCTGGTTGAAAAGTGG + Intronic
1018302311 6:162416427-162416449 CTATGTTTCTGGAGGTAGGATGG + Intronic
1018438629 6:163787777-163787799 ATTTGTTTCTGGAGGGGTGGGGG + Intergenic
1018992275 6:168683234-168683256 CACTGTCTCTGGAGGGGAGGAGG - Intergenic
1019570264 7:1708124-1708146 TTTTGCATCTGGAGGGCAGGAGG - Intronic
1019828692 7:3304286-3304308 CTTTAATTCTGGAAGGCAGGTGG + Intronic
1020052396 7:5090477-5090499 ATTTGTGTCTGGTGGGCAGGGGG + Intergenic
1020331085 7:7017627-7017649 CTTTGTTTCCTGATGGGAGGTGG + Intergenic
1021704554 7:23353831-23353853 CTTTTTTTCTTAAGGGAATGTGG + Intronic
1023102799 7:36736225-36736247 CTCTGTATCTGGAGGGCAAGGGG - Intergenic
1023279154 7:38552262-38552284 CTCTGTTTCTGAAGTGCAGGGGG - Intronic
1023609275 7:41957357-41957379 CTTTCTTCCTGCAGGGAGGGAGG + Intergenic
1023897441 7:44445602-44445624 TTTTGTTTTTGGAGGGGAGGAGG + Intronic
1024229738 7:47354943-47354965 CCCAGTGTCTGGAGGGAAGGAGG - Intronic
1024468708 7:49742912-49742934 CTTTTGTTCTGCAGAGAAGGTGG - Intergenic
1024544899 7:50508924-50508946 CTTTCTTGTTGGAGGGAAGAGGG - Intronic
1025262934 7:57432905-57432927 TTTTGTTTATGGAGGGCAGAAGG - Intergenic
1026238217 7:68547956-68547978 CATTGTTTATCTAGGGAAGGCGG - Intergenic
1026533039 7:71216463-71216485 CTTTGCTTTTGGAGGGGAGAGGG + Intronic
1027350874 7:77309535-77309557 TGGTGTTTCTGGAGGGAAGGGGG + Intronic
1027614283 7:80402250-80402272 CTTTATTTTGGGAGGGTAGGAGG - Intronic
1028460469 7:91086319-91086341 CGTGGCTTCTGGAGGGGAGGAGG - Intronic
1029153110 7:98495341-98495363 CTCTGTTTCTGATGGGAAGCTGG + Intergenic
1029683948 7:102132527-102132549 CTCAGTTTCTGGAATGAAGGAGG - Intronic
1030848457 7:114453459-114453481 TTTTGCTTTTGGAGAGAAGGTGG - Intronic
1031101083 7:117480137-117480159 CTTTTTTTCAGGTGAGAAGGTGG + Exonic
1031556056 7:123177875-123177897 CTGTCTTTCTAGAGGAAAGGAGG - Intronic
1031926548 7:127643954-127643976 TTTTGGTTCTGGAGAGAATGAGG + Intergenic
1034103345 7:148470221-148470243 CTTGGTTTCTGGAGGGGAAATGG - Intergenic
1034305921 7:150045244-150045266 TTTTGTTCCTGGAGGAAAAGTGG + Intergenic
1034800917 7:154055404-154055426 TTTTGTTCCTGGAGGAAAAGTGG - Intronic
1035520153 8:269359-269381 CTTTTTTTCTTGGGGGAGGGTGG - Intergenic
1036197499 8:6733200-6733222 CTTTGTCTCCGGAGGGAACCAGG - Intronic
1036285662 8:7442510-7442532 CTATGTTTGTGGAAAGAAGGAGG - Intergenic
1036335811 8:7869019-7869041 CTATGTTTGTGGAAAGAAGGAGG + Intergenic
1037020595 8:13965769-13965791 CTTGGTTTTGGGAGGGAGGGAGG - Intergenic
1037062538 8:14532702-14532724 CTTTGTGTGTGGGGGGAGGGCGG + Intronic
1037916874 8:22778244-22778266 CTTTGGGTCTGGGAGGAAGGAGG - Intronic
1038048352 8:23786386-23786408 CCCCTTTTCTGGAGGGAAGGTGG + Intergenic
1039250160 8:35654742-35654764 CTTTCTTTTGGGAGGGATGGGGG + Intronic
1039385774 8:37134347-37134369 ATTTGGTTCTGGTGGGAGGGTGG - Intergenic
1039880191 8:41620879-41620901 CTTTGTCTCTCCAGGGATGGGGG + Exonic
1039890361 8:41681768-41681790 CTTGTGTTCTGGAGAGAAGGTGG - Intronic
1040571252 8:48613253-48613275 CATTGTTGCTGGAGGGAGAGGGG + Intergenic
1040595666 8:48835238-48835260 CTTTGTCTCTGGAGCAAAGTGGG + Intergenic
1041015856 8:53592624-53592646 CCTGGTTTCAGGAGTGAAGGAGG + Intergenic
1041100591 8:54392740-54392762 CTTTGTCTATGCAGAGAAGGAGG + Intergenic
1041513395 8:58675249-58675271 TTCTGTTTCTGAAGGGCAGGAGG + Intergenic
1042317352 8:67437912-67437934 CTTTTTTTCTGGGGGGTGGGGGG + Intronic
1042813561 8:72852980-72853002 CTCTTTTTCTGGAGGGGAGAGGG + Intronic
1042992186 8:74654303-74654325 CTTAGATTATGGAGGGAAGGAGG + Intronic
1045924222 8:107567532-107567554 CTTAATATCTGGAGGGGAGGGGG + Intergenic
1046834782 8:118788279-118788301 ATTTGTGTCTGGTGGGCAGGGGG - Intergenic
1048287370 8:133152237-133152259 ATTTTTTTCTGGTGGGAAGAGGG - Intergenic
1049218570 8:141418621-141418643 CTTGGTAGCAGGAGGGAAGGAGG + Intronic
1049242172 8:141543627-141543649 CTTTGTGTCTGCAGGGATTGAGG - Intergenic
1050296119 9:4207184-4207206 CTCTGTGTCGGGAGGGGAGGTGG - Intronic
1050405989 9:5309177-5309199 CTTTGTTCCTAGAGGGACAGAGG + Intergenic
1050820917 9:9878869-9878891 GTTTGATTGTGGAGGGAAGGAGG - Intronic
1052113216 9:24615908-24615930 CTTTTTTTCATGAAGGAAGGAGG - Intergenic
1053019333 9:34684150-34684172 TTTTGTTTTTGGAGGAGAGGGGG + Intergenic
1054862110 9:69964661-69964683 ATTTATTTCTGGAGGCTAGGAGG - Intergenic
1054905037 9:70407336-70407358 CTTTGTGTCTGAAGGTAATGGGG + Intronic
1055305768 9:74927680-74927702 ACTTGTAACTGGAGGGAAGGAGG - Intergenic
1055666028 9:78553956-78553978 TTTTGGTTTTGGAGGAAAGGAGG + Intergenic
1056552372 9:87663005-87663027 AATTGCTTCTGGAGGGTAGGAGG - Intronic
1056697539 9:88872505-88872527 TTTTATTTTTTGAGGGAAGGGGG + Intergenic
1057431136 9:94995284-94995306 TTTTGTTTCTGAGGGGAAAGAGG + Intronic
1057544729 9:96009488-96009510 CTCTCTTTCTGGAGGAAGGGAGG - Intronic
1058447057 9:105063920-105063942 CTTTGTTTATGAAGGGAATGGGG - Intergenic
1059751909 9:117255621-117255643 TTCTGTTTCTTGAGGGATGGGGG - Intronic
1060298264 9:122357611-122357633 CTTTGTTGTTGGAAGGAAGGAGG + Intergenic
1060329970 9:122659123-122659145 CCTAGTGGCTGGAGGGAAGGAGG + Intergenic
1060716453 9:125934578-125934600 TTTTGTTTTTGTTGGGAAGGGGG - Intronic
1060721792 9:125984486-125984508 CTGGGACTCTGGAGGGAAGGAGG - Intergenic
1061679965 9:132238127-132238149 CTTTCTTGCTGGAGGGTGGGTGG + Intronic
1186866236 X:13723505-13723527 TTTTGTTGGTGAAGGGAAGGTGG - Intronic
1187986676 X:24820717-24820739 TTTTTTTTTTGGAGGGGAGGTGG + Intronic
1188598234 X:31927564-31927586 TTTTATGTATGGAGGGAAGGTGG - Intronic
1189911197 X:45812041-45812063 CTATGTTTCAGGAGGCAAGAAGG - Intergenic
1190470239 X:50771193-50771215 CTTTGTGTGTGAAGGGAGGGTGG - Intronic
1191669427 X:63735340-63735362 CTTTGTTTCCAGAAGGTAGGAGG + Intronic
1196035363 X:111138099-111138121 CTTTGGTTCTGGAGACAAAGTGG + Intronic
1198088968 X:133308754-133308776 CTTTGTTGCTGGGGGTATGGGGG - Intronic
1198524922 X:137491456-137491478 CTATCTCTCTGGAGGAAAGGGGG + Intergenic
1198771034 X:140130306-140130328 CTTTTTTTCTGTAGGGAAGGGGG + Intergenic
1199327026 X:146511549-146511571 CTCTGTTTCTGGAGAAAGGGAGG - Intergenic
1199549611 X:149044356-149044378 CTGTGTCTCCTGAGGGAAGGAGG + Intergenic
1199764613 X:150931995-150932017 CCTAGGTTCTGGAGGGGAGGTGG - Intergenic
1199814868 X:151388334-151388356 CCTTGTTCCTGGAGGGCAGGGGG + Intergenic
1199903790 X:152204383-152204405 CTTTGCATCTAGAAGGAAGGAGG - Intronic
1200270753 X:154680290-154680312 CTTGGTTGCTCAAGGGAAGGAGG + Intronic
1200826930 Y:7656104-7656126 GTTTTCTTCTGGAGGGAAGAAGG + Intergenic
1201363101 Y:13174950-13174972 CTTTCTTTCTGGAGGGCACTGGG - Intergenic
1201787673 Y:17803550-17803572 TTTTGTTGGTGAAGGGAAGGTGG - Intergenic
1201813880 Y:18102438-18102460 TTTTGTTGGTGAAGGGAAGGTGG + Intergenic
1202232949 Y:22673694-22673716 GTTTTCTTCTGGAGGGAAGAAGG - Intergenic
1202310207 Y:23522464-23522486 GTTTTCTTCTGGAGGGAAGAAGG + Intergenic
1202560594 Y:26148129-26148151 GTTTTCTTCTGGAGGGAAGAAGG - Intergenic