ID: 1130080437

View in Genome Browser
Species Human (GRCh38)
Location 15:80728113-80728135
Sequence CCACCTTGTAAACTGTTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130080431_1130080437 14 Left 1130080431 15:80728076-80728098 CCTTAGTTTCCTGGTCTGCGTAA 0: 1
1: 0
2: 2
3: 47
4: 374
Right 1130080437 15:80728113-80728135 CCACCTTGTAAACTGTTGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 117
1130080429_1130080437 25 Left 1130080429 15:80728065-80728087 CCTGGCAGGAACCTTAGTTTCCT 0: 1
1: 0
2: 0
3: 18
4: 169
Right 1130080437 15:80728113-80728135 CCACCTTGTAAACTGTTGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 117
1130080433_1130080437 5 Left 1130080433 15:80728085-80728107 CCTGGTCTGCGTAATGGAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1130080437 15:80728113-80728135 CCACCTTGTAAACTGTTGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130080437 Original CRISPR CCACCTTGTAAACTGTTGCC AGG Intronic
905964357 1:42079142-42079164 TCACTTTGTTAACTGTTTCCTGG + Intergenic
907072465 1:51549117-51549139 CCTCCCTGTAGACTGGTGCCTGG - Intergenic
908126172 1:61032263-61032285 CCACCTTATAAACTGTACGCAGG + Intronic
908899566 1:68940778-68940800 CTAACTTATAAACTGTTTCCTGG + Intergenic
917049972 1:170910857-170910879 CCTTCTTGAAAACTGTTGCTGGG - Intergenic
917569103 1:176245908-176245930 CCTCCTTGTACACTGTTGGGGGG - Intergenic
920737757 1:208549980-208550002 GCAGGTTGTAAATTGTTGCCTGG + Intergenic
921338018 1:214107734-214107756 CCAGGTTGTAAAATGTTGGCCGG - Intergenic
921826434 1:219677210-219677232 ACACCATGTAAACTGTTGCAAGG - Intergenic
922362814 1:224838711-224838733 CCATCTTGGAACCTATTGCCAGG + Intergenic
923635381 1:235691211-235691233 GAAACTTGTAAACTGTAGCCAGG - Intronic
1067905888 10:50290483-50290505 CCACCCTGAAATCTGTGGCCTGG - Intergenic
1070628736 10:78069367-78069389 AGACATTGCAAACTGTTGCCTGG + Intergenic
1075082079 10:119391029-119391051 CCAGCTTGTGAATTGTGGCCTGG - Intronic
1075322126 10:121499785-121499807 CCACCTTGGAGCCTGATGCCGGG - Intronic
1075398204 10:122142816-122142838 CCACCCTGAAAGCTGTTCCCAGG + Intronic
1076637669 10:131892836-131892858 CCACCTTGTGAGCTGCTGGCAGG - Intergenic
1077076962 11:706322-706344 CCACCGGGTAAACTGAGGCCCGG - Intronic
1077200829 11:1306707-1306729 GCACTCTGTAAAGTGTTGCCTGG - Intronic
1081739666 11:45429806-45429828 GCACTTTGTAAACTCTGGCCGGG - Intergenic
1084931273 11:72558160-72558182 CCACCTTCTTATCTGATGCCTGG - Intergenic
1086491008 11:87357831-87357853 CCACCTTATAAACTTTTGTGAGG + Intergenic
1088115556 11:106308122-106308144 CCATCTTGAAAACAGTTGCATGG - Intergenic
1097137839 12:56874314-56874336 CCAGCTTGGAAACTGTTTACTGG - Intergenic
1102349583 12:112182504-112182526 CCCCCTTGTAAACTGACTCCTGG - Intronic
1105826732 13:24129760-24129782 CCACATGGTAAGCTGATGCCAGG - Intronic
1113177342 13:107579828-107579850 CCACCTTTTAAACTGTTGGTGGG + Intronic
1115330860 14:32196491-32196513 CCACCTTCCAAAATGTTTCCGGG - Intergenic
1117036170 14:51732048-51732070 CCACCTTCTAAGCTTTTGCCTGG - Intergenic
1118002693 14:61538241-61538263 CAACCTGGCAGACTGTTGCCAGG + Intronic
1121001042 14:90452340-90452362 CCACCTTGTAAGTTGTTGGGAGG + Intergenic
1128158799 15:65409602-65409624 CCGCCTTGGAAACTCTTCCCTGG + Intronic
1130080437 15:80728113-80728135 CCACCTTGTAAACTGTTGCCAGG + Intronic
1132308989 15:100842425-100842447 CCACCTCATAAACTGTTGAGAGG + Intergenic
1137343742 16:47636190-47636212 CCACATTTTAAACTGTTTTCTGG - Intronic
1149651839 17:58280586-58280608 CCACCTTGGGAACTGTTACCTGG + Exonic
1151583412 17:74993053-74993075 CCCCCTTGGAAACTGTTACATGG - Intronic
1157904553 18:51557901-51557923 CCACCTTGGAAAGTGTAGCAGGG - Intergenic
1158953837 18:62522483-62522505 CCACCTTGTGAAACTTTGCCAGG - Intergenic
1163625242 19:18385852-18385874 CCACCTCTTAAACTCTTGTCTGG + Intronic
1166709597 19:44928111-44928133 CCATCTTTTAAAATGTGGCCTGG - Intergenic
926762295 2:16288904-16288926 CTACCTTGAGACCTGTTGCCAGG - Intergenic
927453810 2:23232119-23232141 TCATCTTGCAAACTATTGCCTGG + Intergenic
934016031 2:87883420-87883442 CCACTTTGTTAACTGTTTTCTGG - Intergenic
934987973 2:98900928-98900950 CCACCTTCTATAATGGTGCCAGG + Intronic
936038590 2:109130900-109130922 CCACCTTGTGAACAGTTACCAGG + Intronic
937500337 2:122471608-122471630 CCACATTTTCAACTGTTTCCTGG - Intergenic
939112566 2:138026319-138026341 CCAAATGGCAAACTGTTGCCTGG - Intergenic
939525091 2:143283171-143283193 CAAACTTGTAAATTTTTGCCAGG + Intronic
943266186 2:185736270-185736292 CCACCTTCCAAATTGTTGCCAGG + Intergenic
943395369 2:187326914-187326936 CCACCTTGTTAATTTTTGCGTGG - Intergenic
943653522 2:190482625-190482647 GCTCTTTGTAAACTGTTGCTTGG - Intronic
945699325 2:213151076-213151098 CCTCCTTGTAATCTGTTTCTGGG - Intronic
946779433 2:223177853-223177875 CCAGCTTGGAAACAGTGGCCAGG + Intronic
948151728 2:235749735-235749757 CCACACTGTTAACTGATGCCGGG - Intronic
1170885067 20:20333645-20333667 CCATCTTCTAAGCTGTTCCCGGG + Intronic
1171431092 20:25083554-25083576 CCCCCTTGCAAGCTGTTCCCGGG + Intergenic
1173235457 20:41241119-41241141 ACACCTTGTACACTGTTGCTGGG - Intronic
1173342168 20:42162405-42162427 TCACCCTGAAAACTGATGCCTGG + Intronic
1173653234 20:44681036-44681058 CCACATTGTGAAATGTGGCCAGG + Intergenic
1177750251 21:25272821-25272843 ACACCTTGTACACTGTTGTTGGG + Intergenic
1181787590 22:25238227-25238249 CTACCTTGTCACCTGTTGCCAGG + Intergenic
1181819332 22:25463265-25463287 CTACCTTGTCACCTGTTGCCAGG + Intergenic
949669670 3:6384785-6384807 GCATCCTGTAAACTGTAGCCAGG - Intergenic
950266369 3:11576134-11576156 CCACGTTAGCAACTGTTGCCAGG + Intronic
951935111 3:28014405-28014427 CCACCCTGTAAACTGTATCCTGG - Intergenic
952313867 3:32215387-32215409 CCACCTTGGGGACAGTTGCCTGG - Intergenic
952521277 3:34160197-34160219 CTACCTTGTAAAATGTTTACTGG + Intergenic
959022021 3:101198108-101198130 TCTCCTTGTACACTGTTTCCAGG - Intergenic
959854008 3:111126699-111126721 CCACTTTGTACACAGTTGTCTGG + Intronic
959927934 3:111945768-111945790 CCACCTTCTAAAATGTTTGCAGG - Intronic
961009398 3:123425740-123425762 CCAGCTTGTAAGCTGGGGCCAGG - Intronic
962280317 3:134047252-134047274 CCAGTTTGCAAACTGTTCCCTGG + Intronic
962681555 3:137805699-137805721 CCACCATGTAGACTGGTGTCTGG - Intergenic
963392641 3:144687197-144687219 ACACCTTGTTAACTGTGGACAGG - Intergenic
967249323 3:187520709-187520731 CCACCTTGTTAACTGCTATCTGG + Intergenic
968504726 4:966571-966593 CCACCTTGGAAGCAGCTGCCCGG + Intronic
969620148 4:8274827-8274849 CCACCTTGTAAACTGCTCTGGGG - Intronic
970691705 4:18628533-18628555 CCACCTTGGAAACTGTTGGGAGG - Intergenic
971392428 4:26198406-26198428 CCACCTTCTAGAATGGTGCCTGG + Intronic
972686580 4:41359251-41359273 CTACCTTTTAGATTGTTGCCTGG - Intergenic
972814519 4:42629276-42629298 CTAAACTGTAAACTGTTGCCAGG + Intronic
973695384 4:53485607-53485629 CCACCTTGTAAATTGCTCACAGG + Intronic
981692542 4:147525719-147525741 CCAACTTGTTAAAAGTTGCCTGG + Intronic
983138485 4:164117393-164117415 CCACCTTTTAAAATGTTCCTAGG - Intronic
987086050 5:14468901-14468923 CCCCCCTGAAAACTGTTCCCTGG + Intronic
989491993 5:42067808-42067830 CAACCGTGTACACTGTTGCTGGG - Intergenic
992085365 5:73273567-73273589 GAACCTTGTAACCTGCTGCCAGG - Intergenic
1000956466 5:167549861-167549883 CCTCCTTTAAAACTATTGCCAGG + Intronic
1004240221 6:13914662-13914684 CCAGTTTGTAAAATGTGGCCTGG - Intergenic
1004382062 6:15140966-15140988 CCACCATGTAAACTTTTGGAGGG + Intergenic
1009342253 6:62570448-62570470 TCACCTGGTATACTGTTTCCAGG + Intergenic
1012167277 6:95972841-95972863 CCAACTTGTACACTGTTTCTGGG + Intergenic
1013156540 6:107496355-107496377 CCACATTTTAATCTGCTGCCAGG - Intronic
1013838011 6:114355803-114355825 CCACTTGATAAACTGGTGCCTGG + Intergenic
1013946642 6:115729415-115729437 CCATATTGTGAACTTTTGCCAGG - Intergenic
1015664413 6:135611720-135611742 CCACCTTGCACACTGTTGGTGGG - Intergenic
1019884610 7:3893038-3893060 ACACCTGGTAAACGGCTGCCTGG - Intronic
1020456483 7:8379404-8379426 CCACAATGCAAACTGTTACCAGG - Intergenic
1021617706 7:22520019-22520041 CCCTCTTGTAGACTTTTGCCTGG - Intronic
1021653179 7:22851199-22851221 CCACCTTGAAAACAGGTGACAGG + Intergenic
1021919774 7:25473145-25473167 CTGCCTTGTAAACTCTTGCCTGG - Intergenic
1022451571 7:30520748-30520770 CCACCCTAAAAACTGTTGGCTGG + Intronic
1023937568 7:44750200-44750222 ACACATTGTAAACTGATGCCAGG + Intronic
1029688893 7:102167431-102167453 ACACCTTGTAACCAGATGCCCGG + Intronic
1030680637 7:112430360-112430382 CCACCTTCCAGATTGTTGCCAGG - Intronic
1043531759 8:81158958-81158980 TCACCTTTCATACTGTTGCCAGG + Intergenic
1045424630 8:102052605-102052627 CCATTTTGGAAACTGTTACCAGG - Intronic
1045617038 8:103928029-103928051 CCAGCTTGTAAAATTTTGCATGG + Intronic
1046597724 8:116281006-116281028 CCACTTTGTTCACTGTTGTCAGG - Intergenic
1047421438 8:124711121-124711143 CCACTTTCTAAAGAGTTGCCAGG + Intronic
1048378561 8:133844340-133844362 CCACCTTAGAGACTGTTTCCTGG - Intergenic
1048673516 8:136750255-136750277 CCATCTTGTTAATTGTTTCCTGG + Intergenic
1049407701 8:142459059-142459081 CCACCCTGTCACCTGTTGCCGGG + Intronic
1053471942 9:38352809-38352831 CCATCTTGCAAATTGTTTCCTGG - Intergenic
1056533295 9:87506082-87506104 CCACCTTTTAATCAGCTGCCTGG - Intronic
1056534879 9:87518558-87518580 CCACCTAGTAAACAGTTGTGAGG - Intronic
1057449744 9:95146775-95146797 CCACTTTGAAAATTGTTGCATGG - Intronic
1058588432 9:106534827-106534849 CCAGTTTGCAAACTGTTCCCGGG + Intergenic
1059055132 9:110971429-110971451 CCACATTGTACCCTGCTGCCTGG + Intronic
1061927333 9:133812337-133812359 CCACTTTGTAGACTGAGGCCCGG - Intronic
1062422712 9:136491111-136491133 ACACCTTTTAAAGTGTGGCCAGG + Intergenic
1186324315 X:8462175-8462197 CCACTTTGTACACTGTTGGTGGG + Intergenic
1190067625 X:47252614-47252636 CCAACTTTTACACTGTTGGCAGG - Intergenic
1190210777 X:48445421-48445443 ACACCTTGTAAAATGCTGCTGGG + Intergenic
1190526505 X:51333598-51333620 CACGCTTGCAAACTGTTGCCAGG + Intronic
1194889318 X:99357737-99357759 CCACCTTTTATACTGTTGGTGGG + Intergenic
1196350902 X:114727724-114727746 CCACATTGTAAACTTTTTCCTGG - Intronic
1197695610 X:129546921-129546943 CTATTTTGTAAACTGTGGCCAGG + Intronic
1198397178 X:136231816-136231838 TCACCTTGGGAACTGTTTCCAGG + Exonic
1198656035 X:138914222-138914244 CCATCTAGTATCCTGTTGCCTGG - Intronic
1199128459 X:144155122-144155144 CCACGTTGTTAACTGTTTTCTGG + Intergenic
1199978533 X:152908302-152908324 CCACCTTTGAAAGTGGTGCCAGG - Intergenic