ID: 1130081001

View in Genome Browser
Species Human (GRCh38)
Location 15:80733358-80733380
Sequence GCCTCCTTGAGAATTACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 118}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130081001_1130081011 17 Left 1130081001 15:80733358-80733380 CCTTGTGTAATTCTCAAGGAGGC 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1130081011 15:80733398-80733420 AGGGTGCTGACATCCTGGGGAGG 0: 1
1: 1
2: 1
3: 27
4: 297
1130081001_1130081009 13 Left 1130081001 15:80733358-80733380 CCTTGTGTAATTCTCAAGGAGGC 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1130081009 15:80733394-80733416 GAAGAGGGTGCTGACATCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 201
1130081001_1130081004 -2 Left 1130081001 15:80733358-80733380 CCTTGTGTAATTCTCAAGGAGGC 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1130081004 15:80733379-80733401 GCCCCAGGCTCAGCAGAAGAGGG 0: 1
1: 0
2: 0
3: 30
4: 334
1130081001_1130081008 12 Left 1130081001 15:80733358-80733380 CCTTGTGTAATTCTCAAGGAGGC 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1130081008 15:80733393-80733415 AGAAGAGGGTGCTGACATCCTGG 0: 1
1: 0
2: 3
3: 17
4: 215
1130081001_1130081003 -3 Left 1130081001 15:80733358-80733380 CCTTGTGTAATTCTCAAGGAGGC 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1130081003 15:80733378-80733400 GGCCCCAGGCTCAGCAGAAGAGG 0: 1
1: 0
2: 1
3: 33
4: 313
1130081001_1130081013 23 Left 1130081001 15:80733358-80733380 CCTTGTGTAATTCTCAAGGAGGC 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1130081013 15:80733404-80733426 CTGACATCCTGGGGAGGACTGGG 0: 1
1: 0
2: 3
3: 23
4: 222
1130081001_1130081010 14 Left 1130081001 15:80733358-80733380 CCTTGTGTAATTCTCAAGGAGGC 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1130081010 15:80733395-80733417 AAGAGGGTGCTGACATCCTGGGG 0: 1
1: 0
2: 3
3: 29
4: 212
1130081001_1130081012 22 Left 1130081001 15:80733358-80733380 CCTTGTGTAATTCTCAAGGAGGC 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1130081012 15:80733403-80733425 GCTGACATCCTGGGGAGGACTGG 0: 1
1: 1
2: 3
3: 35
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130081001 Original CRISPR GCCTCCTTGAGAATTACACA AGG (reversed) Intronic
903226089 1:21894876-21894898 GCCTCGTGGAGACCTACACATGG + Intronic
904955948 1:34284038-34284060 CCCTCCTTGACAACTACTCATGG - Intergenic
915331515 1:155115633-155115655 GCCTCCCTGACAAATACACTTGG - Intergenic
917075060 1:171196606-171196628 GCATCATTGAGAATTACTCCAGG - Intronic
920172065 1:204078349-204078371 GCTTCCTGGAGACTTACCCAGGG - Intronic
920580998 1:207107589-207107611 GCCTCCTTGAGACTGAAGCATGG + Intronic
921435549 1:215115922-215115944 GGCTCCTTTAGAGTTGCACAGGG + Intronic
922232742 1:223700634-223700656 GACTCCTTTAGCATGACACAGGG + Intergenic
1067208369 10:44238690-44238712 GGCTTGTTGAGAATTACACCAGG + Intergenic
1067564607 10:47327546-47327568 GCCTGCTTGAAAATTTCACTCGG + Intergenic
1071841865 10:89479767-89479789 GCCTCCATGAGCCTTACATAAGG + Intronic
1071868652 10:89766948-89766970 ACCTTCTTGAGAACTACACTCGG - Intronic
1073791233 10:106942404-106942426 GCCTTCTTGTGTGTTACACAAGG + Intronic
1074146928 10:110725118-110725140 TCATTCTTGTGAATTACACAGGG - Intronic
1074883186 10:117674196-117674218 AACACCTTGAGAATTTCACATGG - Intergenic
1076414927 10:130279097-130279119 GCCTCCTTAAAACTTGCACAGGG + Intergenic
1076458854 10:130624256-130624278 GCCTCCTTGAGACCTTCAGAAGG - Intergenic
1077871036 11:6261346-6261368 GCCTCCTTGAGAATTAAAGTTGG + Intronic
1079355562 11:19727512-19727534 GCTTCCCTGAGCATTAGACAAGG - Intronic
1085050066 11:73375841-73375863 GCCTCCTGGAGGATTTCACTAGG + Intergenic
1088104657 11:106193146-106193168 ACCTGCTTTAGAATTACTCAAGG - Intergenic
1090702660 11:129310502-129310524 TCCTCCTTGAGTATCAGACAAGG - Intergenic
1094741608 12:33296163-33296185 GACTCCTTGAGAAATACAGGAGG + Intergenic
1102867386 12:116384955-116384977 GCCTCCTTAAAAATTGCACCTGG + Intergenic
1106416295 13:29548787-29548809 GGCTCTTTGAGAATAAAACAGGG - Intronic
1112869803 13:103956212-103956234 CTTTCCTTGAGAATTACAAATGG - Intergenic
1114258710 14:21022901-21022923 GCCTCCTGGAGAGACACACACGG + Exonic
1115785923 14:36826208-36826230 GCCTCCTTGAATAGTACACAAGG + Intronic
1117816532 14:59604786-59604808 GCCTCCTGGTGACTTACACGTGG - Intronic
1118820842 14:69344799-69344821 GCCTCTTTGATAACTGCACAGGG - Intronic
1121660267 14:95630013-95630035 ACATCTTTGAGAGTTACACACGG - Intergenic
1121803405 14:96794322-96794344 GCCTCCTTAAGCATTAAACCAGG + Intergenic
1124163983 15:27302022-27302044 CCATCCTTAAAAATTACACAAGG + Intronic
1126296383 15:47141367-47141389 CCCTCCTTGAAAATAAAACAGGG + Intergenic
1127642650 15:60930423-60930445 GCATCTTTGAGAATTACATATGG + Intronic
1128551291 15:68599636-68599658 CCCTCCTTTAGAATTCCTCAAGG - Intronic
1130081001 15:80733358-80733380 GCCTCCTTGAGAATTACACAAGG - Intronic
1132001992 15:98189975-98189997 GCCACCTTGAGAAGTAGTCAAGG + Intergenic
1135165690 16:20137343-20137365 GCCTCATCGAGAATTAGTCATGG + Intergenic
1135655454 16:24244508-24244530 GCCACCTTCAGAATAACAAACGG - Intergenic
1137276630 16:46938814-46938836 GACTCCTTGGCATTTACACAAGG + Intergenic
1138111638 16:54328960-54328982 GCCTCCTGGAGGATGAGACATGG - Intergenic
1138457831 16:57131570-57131592 GCCTCCTTGTAAATGTCACAGGG + Intronic
1140322102 16:73962828-73962850 GCCCCTTTGAGAACTGCACAGGG + Intergenic
1140785969 16:78342523-78342545 GCCTCCCTCATAATTACATAGGG - Intronic
1149734273 17:58977708-58977730 GCCTATTTGAGGATTAAACAGGG + Intronic
1152503912 17:80734341-80734363 GGATCCTGGAGAATTACAAAGGG - Intronic
1153430709 18:5013623-5013645 CCCACCTTCAGAAGTACACATGG + Intergenic
1153587272 18:6635329-6635351 GCCTTCTTTAAAATTAAACAAGG - Intergenic
1156655010 18:39274822-39274844 GGCTGCTGAAGAATTACACATGG - Intergenic
1157530979 18:48420150-48420172 GCCTCCCTGAGCCCTACACAGGG + Intergenic
1157585907 18:48801013-48801035 GCCTCCTTGGGAACAACACAAGG + Intronic
1158432063 18:57398294-57398316 GCCACTCTGAAAATTACACAGGG + Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1161729384 19:5949825-5949847 GCCTCTGTGAGAAGTACGCAGGG + Intronic
1165364030 19:35352928-35352950 GCCCCCTTGCGAGTTTCACATGG - Exonic
1168327066 19:55543939-55543961 ACCTCGTTGAGAATTAGAAAGGG + Intronic
926851107 2:17198294-17198316 GCTTCCTTGAAAATTACCCAAGG + Intergenic
928610276 2:32985780-32985802 GCTTCCTGGAGGGTTACACAGGG - Intronic
928862119 2:35871820-35871842 GCGTCCTTGGGAATTTCAAAAGG + Intergenic
931393773 2:61867493-61867515 ATCTCCTTGAGTATTTCACAAGG - Intergenic
933231497 2:79812941-79812963 GTCTCCTTCAGAATTGCACCTGG - Intronic
935675628 2:105592908-105592930 GGCTCCTTTAGAATGACACGAGG + Intergenic
940704609 2:157088115-157088137 GTCTCATTGAGAATTACCCAAGG + Intergenic
942266205 2:174228131-174228153 GCCTCCTTGATATTGACACTTGG - Intronic
1169236336 20:3933001-3933023 ACCAGCTTCAGAATTACACAGGG + Exonic
1174397450 20:50256705-50256727 GCTTCCTTGTGAATTTCCCATGG - Intergenic
1180825275 22:18857091-18857113 GCCTCCTTGAGAAATATGGATGG + Intronic
1181187454 22:21117456-21117478 GCCTCCTTGAGAAATATGGATGG - Intergenic
1181211744 22:21293037-21293059 GCCTCCTTGAGAAATATGGATGG + Intergenic
1181980446 22:26762290-26762312 GCCTGCTTTAGAATTTCAAAAGG - Intergenic
1183393537 22:37559646-37559668 CCCTCCTTGAGGATGGCACAGGG + Intergenic
1183476964 22:38041050-38041072 GCCTCCTGGAAAATAACACAGGG - Intronic
1203215209 22_KI270731v1_random:2395-2417 GCCTCCTTGAGAAATATGGATGG - Intergenic
1203275424 22_KI270734v1_random:82994-83016 GCCTCCTTGAGAAATATGGATGG + Intergenic
951641893 3:24845560-24845582 GCCTCCTTTACAGTTAAACATGG - Intergenic
956393826 3:68803519-68803541 TTCTCCTTGGGACTTACACATGG - Intronic
957376822 3:79369453-79369475 CCCTTCATGAGAATTACATAAGG - Intronic
959672318 3:108992902-108992924 GTCTTCTTCAGAATTACAGAAGG + Intronic
960007268 3:112793270-112793292 CCCTCCTTGAGAGTTAACCAGGG + Intronic
960693165 3:120368700-120368722 GCCTCCTTGCTTATTACACAGGG - Intergenic
963593767 3:147299092-147299114 CCATCCTTGAGAACTACACTAGG + Intergenic
963842390 3:150120917-150120939 GCTTCCTAGGGAATTCCACATGG + Intergenic
965616103 3:170594011-170594033 GCCTCCTCTACAATAACACAGGG - Intronic
967528473 3:190521629-190521651 GCCTCGGTGAGAATTACAACCGG + Intronic
969660950 4:8527207-8527229 GCCTTATTGAGAATGCCACATGG + Intergenic
974927797 4:68322588-68322610 GCTTCATTGAGGATTTCACATGG - Intronic
979197928 4:117942040-117942062 GCCCACTTGAGAACCACACAGGG - Intergenic
984097711 4:175452080-175452102 CCCTCCTTTAGCATTACACTGGG - Intergenic
986482374 5:8202345-8202367 GCCTCCCTGAGATGTACACCTGG + Intergenic
988157463 5:27473520-27473542 GACTCCTTGAGAAAAACAGAAGG + Intergenic
988526483 5:31991578-31991600 GCCTCCTTAACAATTCCACTTGG - Intronic
990775544 5:59301831-59301853 GCCTCCTTGGGAATGACAGATGG + Intronic
990798471 5:59572175-59572197 GTCTCCTTAAGAATTACAAAAGG + Intronic
992891667 5:81209792-81209814 GCATTCTTGACAATTACAGATGG + Intronic
996173176 5:120321847-120321869 GGCTCCAAGAGAATTACGCATGG + Intergenic
997010053 5:129866125-129866147 GACTTCTTCAAAATTACACATGG + Intergenic
998799384 5:145853780-145853802 GACTGCTTGTGACTTACACATGG + Intergenic
1001735574 5:173996126-173996148 AGCTCCATGAGATTTACACATGG + Intronic
1004856991 6:19761284-19761306 GCCTCCTTTAGAATTAAAGTAGG + Intergenic
1005888000 6:30111846-30111868 GAGTCCTTAATAATTACACAAGG - Intronic
1007899244 6:45394719-45394741 GCCTCCTCCAGCATTCCACATGG - Intronic
1016135847 6:140541434-140541456 GCCAACGTGAGAATGACACACGG - Intergenic
1018605938 6:165597960-165597982 GCCTCCTTGTGAACGAAACAGGG + Intronic
1019117107 6:169774224-169774246 GCCTCCTTGAGAATGCCTTAAGG + Intronic
1020177792 7:5896982-5897004 GCCTCATTTAGAAATAAACAAGG - Intergenic
1020305125 7:6827992-6828014 GCCTCATTTAGAAATAAACAAGG + Intergenic
1020924203 7:14303862-14303884 GCCACCATGAAAATTACCCAAGG + Intronic
1022526562 7:31041766-31041788 CCCTCCTTGAGAAGTGAACATGG + Intergenic
1023132141 7:37013895-37013917 GCCTCCTGGAGAAATAATCATGG - Intronic
1024419813 7:49151207-49151229 GCCTGCTTGAGAATTAAATAAGG - Intergenic
1026145589 7:67743803-67743825 GCCTCCTTGAGAAGGTCTCATGG - Intergenic
1028676577 7:93470626-93470648 TCAACCTTGAGAATGACACAAGG - Intronic
1028893546 7:96014995-96015017 AACTCCTGGAGAATTGCACAAGG + Intronic
1033615146 7:143007267-143007289 GTCTCCTTGGGGATTACAGAAGG - Intergenic
1034859849 7:154585839-154585861 CCCTCCTTCAGAATTACAGTCGG - Intronic
1038397994 8:27261282-27261304 GCCTCCTGGAGAACCACACGGGG - Intergenic
1043192135 8:77238896-77238918 TCCTCCTTGAGATTTTCTCAAGG + Intergenic
1048218291 8:132516760-132516782 GGCACCTTGAGAATGACAAATGG + Intergenic
1048642886 8:136384054-136384076 TGCTCCTTGAAAATTACAAAGGG - Intergenic
1050060436 9:1703731-1703753 GCATACTTGAGAATGATACAAGG - Intergenic
1051091845 9:13418923-13418945 GCCACCTTGAGAAGTCCGCATGG - Intergenic
1053455783 9:38232341-38232363 GCCACCATAAGCATTACACATGG + Intergenic
1058067568 9:100566333-100566355 GCCTCCTTTACATTTCCACATGG + Intronic
1058200535 9:102033534-102033556 GCCTACTTGACAATTTCACATGG + Intergenic
1059282144 9:113144150-113144172 GCCTCCTAGGGAATTTCTCATGG + Intergenic
1062480482 9:136748605-136748627 GCCTCCTGCAAAATTACCCAGGG + Intergenic
1186146480 X:6629399-6629421 ACCTCCTTGGGAAGGACACAAGG - Intergenic
1189233241 X:39468684-39468706 GCCCACTTGAGAATTACGGAAGG - Intergenic
1190712978 X:53082721-53082743 CCCTCCTCGAGAATGACATAGGG - Exonic
1196779964 X:119375037-119375059 GTCTGCTTGTGAATTACAAAAGG - Intergenic