ID: 1130082903

View in Genome Browser
Species Human (GRCh38)
Location 15:80750190-80750212
Sequence CTTTGTAAATAGAAGAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 606
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 561}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130082902_1130082903 -8 Left 1130082902 15:80750175-80750197 CCATGCTCAGTTAATCTTTGTAA 0: 1
1: 0
2: 87
3: 2737
4: 32145
Right 1130082903 15:80750190-80750212 CTTTGTAAATAGAAGAATAAAGG 0: 1
1: 0
2: 2
3: 42
4: 561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130082903 Original CRISPR CTTTGTAAATAGAAGAATAA AGG Intronic
900201393 1:1408539-1408561 CTCTGTAAATATAAACATAATGG + Intergenic
900912310 1:5608384-5608406 AATTGAAAATAGAAAAATAATGG - Intergenic
903642573 1:24870041-24870063 CTTTGTAATTACAAGAAGAGAGG - Intergenic
905377655 1:37534686-37534708 CTTTGTCAATATTAGAATGAGGG + Exonic
906430701 1:45753710-45753732 ATTTGCAAAAAGAAGAAGAAGGG + Intergenic
906546825 1:46625644-46625666 ATCTGTAAATAAAATAATAATGG - Intergenic
906890893 1:49712723-49712745 TTTTTTAAAAAGAAGAATATGGG + Intronic
907171324 1:52468272-52468294 GTTTATAAAAAGAAGAAAAAAGG + Intronic
907588019 1:55638817-55638839 CTTTGAATATATAAGAAGAAAGG + Intergenic
907650374 1:56289015-56289037 TATTGTGAATAGAAGAATCAGGG + Intergenic
908092915 1:60705378-60705400 ATTTTTAAAAAGAAGAAGAAAGG + Intergenic
908476316 1:64492291-64492313 CTTTGTTGCTTGAAGAATAACGG + Intronic
910368873 1:86494979-86495001 CTTCTTAAAGACAAGAATAATGG - Intronic
911324653 1:96455838-96455860 CTTTTTAAATATAAGACTGAAGG - Intergenic
911440243 1:97917424-97917446 TTTGGAAAATAGAAGCATAATGG - Intronic
911656806 1:100453419-100453441 ATTTGAAAATCCAAGAATAAAGG - Intronic
911772852 1:101769255-101769277 ATTTATAAAAATAAGAATAATGG - Intergenic
912790950 1:112650135-112650157 CTTTGTAAAGAGTTGGATAATGG + Intronic
914319544 1:146545802-146545824 CTTTGGACATAGAATAAGAATGG - Intergenic
914424699 1:147564776-147564798 CTGTTTCAACAGAAGAATAAAGG - Intronic
916289778 1:163152231-163152253 CTTTGTGAAAATAAGAATAATGG - Intronic
916680425 1:167099499-167099521 ATCTGAACATAGAAGAATAAAGG + Intronic
917690221 1:177461170-177461192 AATTGTAACTAGAAGAACAATGG - Intergenic
917819820 1:178751157-178751179 CTTTGTAGAAAAAAGCATAAGGG - Intronic
917966334 1:180181229-180181251 CTTTATAAATATAAGAAAAAAGG + Intronic
918386148 1:184010196-184010218 ATTTCTAAATGGCAGAATAATGG - Intronic
918432139 1:184472233-184472255 CTTTTTAATCAGAAGAAGAAAGG + Intronic
918562064 1:185880829-185880851 CCATGTAAATGGAAGAAGAAAGG + Intronic
918640017 1:186828421-186828443 CTTTGTAAATTTAAGATTAAAGG - Intergenic
918701394 1:187612797-187612819 CCTTGTCAATATAAAAATAACGG + Intergenic
918792178 1:188842800-188842822 CTTTTTAAATTGAAGGACAAGGG + Intergenic
918827655 1:189346454-189346476 CTTTGAAGATGGAAGAAGAAGGG - Intergenic
918839800 1:189519812-189519834 ATTTTTAAATATAATAATAAGGG + Intergenic
918845570 1:189605662-189605684 CTTTGTATTAAGAAAAATAAAGG - Intergenic
919345910 1:196378124-196378146 CTCCGTAAAGAGAAGAATCAAGG + Intronic
919611915 1:199756062-199756084 CTTAGAAAACAGCAGAATAATGG + Intergenic
920536531 1:206740826-206740848 CTATATAAATAGTAGAAAAAGGG - Intergenic
920890738 1:209983242-209983264 CTTTGTAAATATAACACCAAAGG - Intronic
921418874 1:214923026-214923048 CTGTGGAAATACAAGAAAAAAGG + Intergenic
922204363 1:223433639-223433661 TTTTTTTAATAGAGGAATAAGGG + Intergenic
922537599 1:226392687-226392709 TTTGGTAAATAGAAGTATAATGG - Intronic
922854417 1:228761871-228761893 CTTTGTAAATGTATGAAAAAAGG - Intergenic
923288133 1:232517209-232517231 TTTTATAAATAAAAGGATAAAGG - Intronic
923844706 1:237716837-237716859 CTTAAGAAATATAAGAATAAAGG - Intronic
923913478 1:238476545-238476567 ATGTGTTAATAGAAGAAGAAAGG - Intergenic
924173260 1:241363505-241363527 ATTTCTAATTAGAAGAAAAATGG - Intergenic
924252596 1:242148430-242148452 ATTTTGAAATAGAAGAAGAAAGG - Intronic
924612216 1:245583038-245583060 CCCTGAAAATAGAAGAAGAAAGG + Intronic
1063762290 10:9093544-9093566 CTGTGTAAATAAATAAATAATGG - Intergenic
1063783558 10:9354098-9354120 CTTTGCAAGTAGATCAATAAGGG + Intergenic
1063863392 10:10337457-10337479 GTTTGAAAATAGAAAAAAAATGG - Intergenic
1065011621 10:21426438-21426460 CTATGTAAAGTGAAGAAAAATGG - Intergenic
1065108991 10:22421684-22421706 GTTTATAAATGCAAGAATAATGG - Intronic
1065509830 10:26467223-26467245 CTTTGAGAATAGAAGTATGAGGG + Intronic
1065707657 10:28486068-28486090 CTTTTAAAATAGAAGAAAACTGG + Intergenic
1066506671 10:36052235-36052257 TTTTATAAATAGAAAACTAAGGG + Intergenic
1066589455 10:36978091-36978113 GCTTGTAAAAAGAAAAATAATGG - Intergenic
1068134995 10:52942984-52943006 CTTTCTGAATAGAGGAACAAGGG + Intergenic
1068539181 10:58272045-58272067 CCTTGCAAATAGAAGAGAAAGGG - Intronic
1068820241 10:61367809-61367831 GTAAGTAAATAGAAAAATAAAGG - Intergenic
1070640300 10:78163830-78163852 CTTTTTAAGAAGATGAATAATGG + Intergenic
1071385414 10:85114642-85114664 TTTTGGAGATAGAAGAATATAGG - Intergenic
1071740240 10:88350134-88350156 CTTTTTAAGTAGAACAAAAAAGG - Intronic
1072038425 10:91585396-91585418 CTTTGTAATCAGTAGAATTAGGG - Intergenic
1072156221 10:92726289-92726311 CTTTGTTAATAAAAAAATAAAGG + Intergenic
1072435571 10:95412055-95412077 CTTTCTAAATGGAGGAATCAAGG - Intronic
1072515460 10:96177390-96177412 TTTTTTAGATAGAAGAAAAATGG + Intronic
1073091217 10:100941330-100941352 CTATGTATCTAGCAGAATAATGG - Intronic
1074060316 10:109959530-109959552 TTTTGCAAATAGAAGAACATAGG - Intergenic
1075032430 10:119032885-119032907 CTTTAAAAATAGATGAATAGTGG - Exonic
1075533290 10:123248614-123248636 CTCTCTAAATAGAAGAGAAATGG - Intergenic
1075745516 10:124724643-124724665 TTTTGTAAATGGCAGCATAAAGG + Intronic
1075828994 10:125388149-125388171 ATTCCAAAATAGAAGAATAATGG - Intergenic
1078815298 11:14815213-14815235 CTTTGTCAGTGGAAGAATTATGG + Intronic
1079529374 11:21431287-21431309 TTTTGTAAAAAGGAAAATAAAGG - Intronic
1080935792 11:36862086-36862108 CTCTCTTAATAGAAGAATTATGG - Intergenic
1081954045 11:47074027-47074049 TTTTTTTAATAGAAGAAGAAAGG - Intronic
1085440133 11:76553928-76553950 CTTTATAAATAGAAAACTGAGGG + Intergenic
1085832326 11:79914733-79914755 CTTTGTGAACTGAAGAATATGGG + Intergenic
1085869182 11:80329158-80329180 TTTTAAAAATAAAAGAATAATGG - Intergenic
1086446251 11:86874101-86874123 CTTTGTGAAGAGAAGAATAAAGG + Intronic
1086537088 11:87860607-87860629 CTTTGTAAATAGAAAGAATATGG + Intergenic
1086745656 11:90423626-90423648 ATTTGTAAAAAAAAGAAAAAGGG + Intergenic
1086799217 11:91150820-91150842 CTTTTTAAATATAACACTAAAGG - Intergenic
1087408238 11:97756244-97756266 CCATGTGAATAGAATAATAAGGG - Intergenic
1088046235 11:105455814-105455836 CTTTGTAAATAGTGTTATAAAGG + Intergenic
1088137028 11:106568168-106568190 TTTGGTACAGAGAAGAATAAGGG - Intergenic
1088158690 11:106841867-106841889 ATTTGTAAATAGGAAAAAAAAGG - Intronic
1089475704 11:118759629-118759651 TTTTGTATATAGAATAATACCGG + Intronic
1089657374 11:119960057-119960079 CCTTTTAAATATAAGAATAAGGG - Intergenic
1089757038 11:120694835-120694857 CTTTATAAAAAGAAGAAGACAGG + Intronic
1090089774 11:123684953-123684975 CTTTGTTTATAAAAAAATAATGG - Intergenic
1090132190 11:124156003-124156025 CTTTATAAATAGGAGAATTAAGG + Intergenic
1090760461 11:129832756-129832778 CTTTTTAAGTAGAAGAGTAATGG + Intronic
1091081819 11:132677849-132677871 CTTTTTAAATAAAACAACAAAGG + Intronic
1092607974 12:10140766-10140788 CTTTGTAAAAATAAGAGTGAAGG + Intergenic
1092713215 12:11359884-11359906 TTTTGTAATTAGAAAAAAAAAGG - Intronic
1092716923 12:11399061-11399083 TTTTGTAATTAGAAAAAAAAAGG - Intronic
1092820718 12:12350830-12350852 GTTTGTAGATAGGATAATAATGG + Intergenic
1092897365 12:13025590-13025612 TTTTTTTAATGGAAGAATAACGG - Intergenic
1094078949 12:26511550-26511572 ATTTGGAAATAGAAAAAAAATGG - Intronic
1094253739 12:28397836-28397858 CTTTTTTAATAAAAGATTAAGGG - Intronic
1094812688 12:34154686-34154708 CATTATTAATAGAAGAAAAATGG + Intergenic
1094877069 12:34660766-34660788 CTTTGTAGATTGTAGAAAAACGG - Intergenic
1095393065 12:41731758-41731780 CTTTTAAAACAGAACAATAAAGG - Intergenic
1095657804 12:44691083-44691105 CTGTTTAAAAAGAAGAATACAGG + Intronic
1097983935 12:65762992-65763014 CTTTGTAAATAGAATTTTAATGG + Intergenic
1098009465 12:66034926-66034948 TTATGAAAATAGAATAATAAAGG + Intergenic
1098187680 12:67915591-67915613 CTTTCTACACAGAAGAACAAAGG - Intergenic
1098674936 12:73277767-73277789 CTTTTAAAATGGAAAAATAATGG - Intergenic
1098769205 12:74532050-74532072 ATTTGTATATATAAGCATAAAGG - Intergenic
1099820527 12:87703581-87703603 CTCTGTAAATGGAACAACAAAGG - Intergenic
1100664829 12:96739634-96739656 ATGAGTGAATAGAAGAATAAAGG - Intronic
1100816820 12:98394933-98394955 CTTTGGAAATAAGAAAATAATGG + Intergenic
1101220705 12:102636379-102636401 ATTTGTAAAAAGAAGTATATTGG + Intergenic
1101457549 12:104851803-104851825 CTTTCTAAAGAAAAGAATAGAGG + Intronic
1101553259 12:105783324-105783346 CTCTGTAAAGAGTAGAATGATGG - Intergenic
1101903554 12:108809133-108809155 TTTTGTAAAAAGAAGTAAAATGG - Intronic
1102332875 12:112050074-112050096 CTTTTCAAAGAGAAAAATAAGGG + Intronic
1102977106 12:117214641-117214663 CTTTCTAACTAGAACAATTATGG + Exonic
1104300302 12:127558904-127558926 TTTTTAAAAGAGAAGAATAATGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1105807591 13:23965255-23965277 ATAGGTAAATAGAAGTATAAAGG - Intergenic
1107791031 13:44002453-44002475 CATTTTAAACAGCAGAATAATGG - Intergenic
1108091180 13:46851788-46851810 TTTTGTAATCAGCAGAATAATGG + Intronic
1108124577 13:47227694-47227716 TTTTTTATATAGAAGAATCAAGG + Intergenic
1109210854 13:59534302-59534324 GTTTATAAATAGAATAAGAAAGG - Intergenic
1109278188 13:60325202-60325224 CTTAGTACAAAGAAGAAAAAGGG - Intergenic
1109294939 13:60518597-60518619 CTTTGTAAATACATGTAAAAAGG + Intronic
1110744990 13:79041898-79041920 ATTTGTCAAAAGAATAATAACGG - Intergenic
1110995756 13:82107125-82107147 CTCTATAAATGGAACAATAATGG - Intergenic
1111092885 13:83470477-83470499 CTATGTAATTAGAAGAGAAAGGG - Intergenic
1111156031 13:84327676-84327698 CTATGTACAAAGAACAATAAAGG - Intergenic
1111203777 13:84975902-84975924 CTTTTTAAAAAGTAGAAGAAAGG + Intergenic
1111342243 13:86901621-86901643 TTTTGTAAATAGACAAATAGTGG + Intergenic
1111920610 13:94406944-94406966 CTTTGCCAACAGAAGAGTAAAGG + Exonic
1112442942 13:99437935-99437957 TTTTATAAATGGAAGATTAAAGG - Intergenic
1113329399 13:109314079-109314101 CTCTTCAAATATAAGAATAAAGG + Intergenic
1114028001 14:18546176-18546198 CTTTGTAAAAGGAAAAATAAAGG - Intergenic
1114058042 14:18992022-18992044 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
1114104506 14:19409732-19409754 CTTTCTAAGAAGAAGAAAAAGGG - Intronic
1114144555 14:19959081-19959103 CTCTGTCAATAGAATTATAATGG + Intergenic
1114369708 14:22072972-22072994 ATTTGATAATAAAAGAATAAAGG - Intergenic
1115135274 14:30100333-30100355 CTTTGTAAATAACAAAATGAAGG + Intronic
1116178291 14:41501925-41501947 CCTTGTATATATAAGAATGAAGG + Intergenic
1116408764 14:44598652-44598674 ATTTATAATTAGAACAATAATGG - Intergenic
1116424911 14:44779105-44779127 CTTAGTAAATAGGGGAATTATGG + Intergenic
1116791156 14:49341821-49341843 CTTTGTAAATACTATTATAAAGG - Intergenic
1117020446 14:51565131-51565153 CTGTGTACACAGAAGAACAAAGG - Intronic
1117139138 14:52768478-52768500 AGTTATAGATAGAAGAATAAAGG - Intronic
1117487574 14:56213589-56213611 CATTGTAAAGAGAAGAATGGTGG + Intronic
1119694490 14:76701809-76701831 CTTTGTAAAAAGAATATTTAAGG - Intergenic
1120199369 14:81519551-81519573 CCTTGTAAATAGAAGAAGTTTGG + Intronic
1120535669 14:85691976-85691998 CCTTGGAAATAGAAGAGGAAAGG + Intergenic
1121158069 14:91705761-91705783 CACTGTAACTAGAAGAATCAGGG + Intronic
1121904562 14:97727873-97727895 CATTGTCAAAAGAAGAAAAAGGG - Intergenic
1122714977 14:103690909-103690931 CTTTCTAAGTAGAAAAATACTGG + Intergenic
1124716228 15:32064974-32064996 ATGTGAAAATAGCAGAATAATGG + Intronic
1125101815 15:35922451-35922473 CTGTGTAAATAAATGAGTAAGGG + Intergenic
1125786263 15:42320994-42321016 CTGAGTAAAGAGAAGAAAAAAGG - Intronic
1125935651 15:43633275-43633297 CTGTGTTGATAGAAGAACAAGGG - Intronic
1125948420 15:43729739-43729761 CTGTGTTGATAGAAGAACAAGGG - Intergenic
1126386743 15:48100999-48101021 CTTTGTTTATGGAAGAAAAAAGG - Intergenic
1126484600 15:49166415-49166437 TTTTATGAACAGAAGAATAAGGG + Intronic
1126612425 15:50543251-50543273 CTTTGTAAATAGAGGCTGAATGG - Intronic
1126741806 15:51784792-51784814 CTTTGTATGTAAATGAATAAAGG + Intronic
1126884393 15:53134121-53134143 CTTTGTAGCTGTAAGAATAAGGG - Intergenic
1127438706 15:58985031-58985053 AGTTGTATTTAGAAGAATAATGG - Intronic
1127581770 15:60345381-60345403 CTTTGCAAAGAGAAGGAAAAGGG - Intergenic
1127858301 15:62971196-62971218 TTTTGTAAATAGAAAAAAAAAGG - Intergenic
1128431228 15:67596444-67596466 TTTTGTATATAGAAAAAAAAGGG + Intronic
1129284257 15:74511346-74511368 CTTTGTCACTTGAAGAATACAGG + Intergenic
1130082903 15:80750190-80750212 CTTTGTAAATAGAAGAATAAAGG + Intronic
1130785649 15:87093014-87093036 CTTTGTAATTTGAAGTTTAATGG + Intergenic
1131333860 15:91528495-91528517 GTCTGCAAATAGAAGAATCAAGG + Intergenic
1131878937 15:96841933-96841955 CTTTATAAATGGAACAATAAAGG + Intergenic
1131892730 15:96991252-96991274 CCTTTTATATAGAAGAGTAAAGG - Intergenic
1132673411 16:1111821-1111843 CTTTTTAAATACAAGGAAAAAGG + Intergenic
1133505865 16:6411598-6411620 ATTTGAAAATAGATAAATAATGG + Intronic
1133655287 16:7856359-7856381 CTTTGAAAATTAAAGAATCATGG - Intergenic
1135576959 16:23593522-23593544 CTTTGTAAATATAAATAAAATGG + Intronic
1137348386 16:47686164-47686186 TTTTGTAAATGGAAGTCTAAGGG + Intronic
1138752166 16:59436451-59436473 TTTTTTAACTAGAAGAAAAAAGG - Intergenic
1139091615 16:63654969-63654991 CAATATAGATAGAAGAATAAAGG - Intergenic
1139203301 16:65001436-65001458 CAGGGTAAATAGAAGAACAAAGG - Intronic
1140013979 16:71164279-71164301 CTTTGGACATAGAATAAGAATGG + Intronic
1140178442 16:72689293-72689315 ATTTTTAAATGGAAAAATAAAGG + Intergenic
1140650207 16:77079752-77079774 CTTTATACTTAGAAGAATAAAGG + Intergenic
1141024872 16:80537080-80537102 CTTTGTTCAAAGAAGAAGAAAGG - Intergenic
1141640763 16:85339683-85339705 TTTTTTAAAGAGAAGAAAAATGG - Intergenic
1143596392 17:7916556-7916578 CTTTGTACATGGTAGAATTAAGG - Intergenic
1143693444 17:8590702-8590724 CTGTGTAAGTAAATGAATAAAGG - Intronic
1145353241 17:22109270-22109292 ATGAGTAAATAGAAGAATCAAGG - Intergenic
1145361029 17:22212564-22212586 CTTTTAAAATAGAACAATACAGG + Intergenic
1146637301 17:34515968-34515990 ATTAGTAAATAAATGAATAAAGG - Intergenic
1146817444 17:35954108-35954130 CATTGTAAAAATAACAATAAAGG - Intergenic
1148173718 17:45546529-45546551 TTTGTTAAATAGAAGAAAAATGG - Intergenic
1148275551 17:46298919-46298941 TTTGTTAAATAGAAGAAAAATGG + Intronic
1148490553 17:48021221-48021243 ATTTGTAAAAAGAAGGCTAACGG + Intergenic
1149006737 17:51813816-51813838 CTTTGTAGATAGGAGAATAAAGG + Intronic
1149118972 17:53137920-53137942 TTTTTTAAAAAGGAGAATAAAGG - Intergenic
1149853769 17:60060191-60060213 CATTTTAATTGGAAGAATAAAGG + Intronic
1150198982 17:63333559-63333581 CATTGTAAAAATAACAATAAGGG + Intronic
1150978510 17:70116081-70116103 GTATGTGAATAGAAGAAAAAAGG + Intronic
1151740053 17:75975109-75975131 TTTAGGAAATAGAAAAATAAGGG - Intronic
1151752901 17:76051554-76051576 CTTTCTTAAGAGAAGAAAAAGGG - Intronic
1152280195 17:79380592-79380614 CTTTGGAAATGGGAGAAAAATGG + Intronic
1153540724 18:6151222-6151244 TTTTGTAAATAACAAAATAAAGG + Intronic
1153818508 18:8811476-8811498 CTTTCTAAATAGAATAATACTGG + Intronic
1153919898 18:9779324-9779346 TTATGTAAATTGAAGAATACGGG - Intronic
1154047426 18:10919909-10919931 CCTTGAAAATAGAATCATAAAGG + Intronic
1155125124 18:22866876-22866898 CTTTGAAATTTGAAGATTAATGG - Intronic
1155369248 18:25080468-25080490 CGTTGCAAATATAACAATAAAGG + Intronic
1155664159 18:28286854-28286876 CTTTGTAAATAGCAAAATCATGG + Intergenic
1155733214 18:29188050-29188072 CCTTGTAAATAGAAAAATACTGG + Intergenic
1156569093 18:38232555-38232577 CATTTAAAATAGAAAAATAAAGG + Intergenic
1156878135 18:42041583-42041605 CTTTGTAAAAAAAAAAAAAAAGG + Intronic
1157814603 18:50721726-50721748 CTTTGTCAAAAGTAGAAAAAGGG - Intronic
1158117926 18:54017313-54017335 CTATGTAATTAGAGGATTAATGG + Intergenic
1158169154 18:54576881-54576903 CTATGCAAATAGAGGAATCAAGG - Intergenic
1158298441 18:56025463-56025485 CTCCTTTAATAGAAGAATAACGG - Intergenic
1158463154 18:57664898-57664920 CTTTGGAAGGAGAAGAACAATGG - Intronic
1158891969 18:61880850-61880872 GTGAGTAAAGAGAAGAATAAGGG - Intronic
1159049878 18:63410477-63410499 CTTTCTACATAGAATACTAATGG - Intronic
1159084422 18:63772334-63772356 CTCTGCAAATGGAAGAATATAGG + Intronic
1159098670 18:63935858-63935880 TTTTTTAAATAGCAGAAAAAGGG - Exonic
1159885676 18:73902361-73902383 CAATGTAAATAGAAAAATGATGG - Intergenic
1160299425 18:77666868-77666890 CTTTTTAAAAAGATGACTAACGG - Intergenic
1164887305 19:31791990-31792012 ATTTTTAAAAAGAAGAACAAAGG + Intergenic
1166591256 19:44001564-44001586 TTTTTTAAAAAGAAGAATATTGG + Intergenic
1166595895 19:44049944-44049966 CTTTTTAAAAAGAAAAATATAGG + Intergenic
926163846 2:10505778-10505800 CTTTTTAAAAGGAAGAAAAATGG + Intergenic
926660588 2:15461654-15461676 TTTTGTAAATAAAATAATTATGG - Intronic
926872953 2:17442776-17442798 TTATGTAAATAGAAACATAATGG + Intergenic
926874591 2:17461024-17461046 CTGGGTAAATAGAATAATAGAGG - Intergenic
927352467 2:22133400-22133422 CTTTATAATTACAATAATAAAGG + Intergenic
928682589 2:33717554-33717576 CTTGGTAAAGGGAAGAACAAGGG + Intergenic
928997071 2:37303750-37303772 TTTTTTAAAAAGAAGAATGAAGG + Intronic
929304118 2:40340555-40340577 CTTCTTAAAAAGAAGAAGAAGGG + Intronic
929306625 2:40370740-40370762 CTTTGTAAATTGTAAAATACTGG - Intronic
930583410 2:53241389-53241411 ATTTGTAAATATAACTATAATGG - Intergenic
931314845 2:61119241-61119263 ATTTTTAAATAAAAGAATTAGGG - Intronic
931437177 2:62257742-62257764 CTGTGGAAACAGAAGAACAAAGG + Intergenic
931657904 2:64526515-64526537 CTTTGTAGATTAAAAAATAAAGG + Intronic
931914015 2:66933320-66933342 CTTTATAAATAAATGAGTAATGG + Intergenic
932078535 2:68689636-68689658 CTTTCTTAATTGAAAAATAAGGG - Intronic
932202879 2:69848124-69848146 CTATCTACATGGAAGAATAATGG - Intronic
932295000 2:70616765-70616787 CTCTGGAAATAGAAGACTCAGGG + Intronic
932558273 2:72844521-72844543 CTTTTTGAATAGAAGAGCAAAGG - Intergenic
933582324 2:84141793-84141815 CTTTGTCAATAGATAAATAAGGG - Intergenic
934583557 2:95467614-95467636 CTTTCTAAAAAGATGAAAAATGG + Intergenic
934595895 2:95609100-95609122 CTTTCTAAAAAGATGAAAAATGG - Intergenic
935401067 2:102660738-102660760 AGTTGCAAATAGAAGAATAGGGG + Intronic
935432858 2:102995352-102995374 CTTTTTAAATACAACAATAAAGG - Intergenic
937161825 2:119770668-119770690 TTTTTTAAAAAGAAGAAGAAAGG - Intronic
937720021 2:125083275-125083297 CTATGCATATAGAAGAATACAGG + Intergenic
937741135 2:125355592-125355614 TTTTGTAAATAGTAGAAAACTGG + Intergenic
938283177 2:130082204-130082226 CTTTCTAAGAAGAAGAAAAAGGG - Intronic
938333810 2:130470770-130470792 CTTTCTAAGAAGAAGAAAAAGGG - Intronic
938356007 2:130649897-130649919 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
938432433 2:131256696-131256718 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
939208327 2:139137959-139137981 CTTTTTAAATACAAGAACCAGGG - Intergenic
939269376 2:139917701-139917723 CTTTATAATTAGACGAATTATGG - Intergenic
939430609 2:142101122-142101144 GTTTGTACATAAAGGAATAAAGG + Intronic
939440367 2:142240979-142241001 CCTTGTAAATAGAAGAAGTTTGG + Intergenic
940039107 2:149341270-149341292 CATTGTAAATTGTGGAATAATGG - Intronic
940051876 2:149473591-149473613 GTTTGTAAATCAATGAATAAAGG + Exonic
941101792 2:161304667-161304689 CTTTTAAAATATATGAATAAAGG - Intergenic
941164623 2:162072115-162072137 TTTTGTAAATATAAATATAAAGG - Intronic
941350865 2:164433485-164433507 CTTTGTAAAGATAAAAACAAAGG + Intergenic
941410906 2:165156175-165156197 CTTTGTAAAGAGTAGAAATATGG - Intronic
941524438 2:166588880-166588902 CATTTTAAAAAGAAAAATAAAGG - Intergenic
941595838 2:167475979-167476001 CTTTGTAAAAAGAAGAAATGTGG - Intergenic
941733090 2:168940879-168940901 TTCTATAAATAGAATAATAAAGG + Intronic
942403538 2:175628950-175628972 CTTTATAAGTAAAAGGATAAAGG - Intergenic
942746918 2:179244673-179244695 TTTTCTAAATAGAAAGATAATGG + Intronic
942823914 2:180150611-180150633 ATTTATAAATAGAAAAACAAGGG + Intergenic
942964297 2:181872188-181872210 ATTTGTAAATGGAAAAAAAAAGG - Intergenic
945050338 2:205818137-205818159 ATTTGGAAATAGAAAAATAGGGG - Intergenic
945174800 2:207032431-207032453 ATATGCAAATAGAAGAAAAAAGG + Intergenic
945191391 2:207191488-207191510 CTTTGAATATGGAAGAGTAAAGG - Intergenic
945555344 2:211268729-211268751 TTTTGTCAACAGAAGAAAAAGGG + Intergenic
946672323 2:222118645-222118667 TTTTGAACATGGAAGAATAAAGG + Intergenic
947115232 2:226763069-226763091 CTTTCTGAATAGAAAGATAAAGG + Intronic
947288809 2:228547990-228548012 CTGTTTACTTAGAAGAATAAAGG + Intergenic
947887764 2:233588490-233588512 CTTTACAAATTTAAGAATAAAGG + Intergenic
1168947568 20:1774202-1774224 TTTTTTTAATAGAAGAAGAATGG + Intergenic
1169222149 20:3830555-3830577 CTTTTTAAATACAACAGTAAAGG - Intergenic
1169240507 20:3974957-3974979 TTTTGAAAAAAGAAGACTAAAGG + Intronic
1169836288 20:9883425-9883447 CATTTGAAATGGAAGAATAATGG + Intergenic
1169905397 20:10598253-10598275 ATTAGTAAATGAAAGAATAAAGG - Intronic
1169924741 20:10770820-10770842 CTTTGAAATGAGAATAATAATGG - Intergenic
1170760702 20:19248240-19248262 CTTTGAAAGTAGAAGAGAAATGG - Intronic
1171507433 20:25649446-25649468 ATTTTTAAAAAGAAGAAAAAAGG - Intergenic
1172073440 20:32276175-32276197 ATTTTTAAATAAAATAATAAAGG - Intergenic
1172555891 20:35841023-35841045 CTTTTTAAAGAGGAGAAAAAAGG - Intronic
1172758227 20:37302646-37302668 CTTTGAAAATTGATAAATAAAGG - Intronic
1173187545 20:40852434-40852456 CTTTGAGAATATGAGAATAAGGG + Intergenic
1174231759 20:49051148-49051170 CTTGGAAAATAGTAGAGTAAGGG + Intronic
1174655028 20:52164322-52164344 ATTAGTAAAGAGAGGAATAAGGG - Intronic
1176167116 20:63680174-63680196 CTTTCTCAAAAGCAGAATAATGG - Intronic
1177413471 21:20762486-20762508 CTTTGTAAAAACAATATTAATGG - Intergenic
1177777713 21:25587757-25587779 CGTAGTAAATAGAAGGAGAATGG + Exonic
1178763162 21:35423330-35423352 CTTTTTAAAAAGAAAAAAAATGG + Intronic
1178916337 21:36707564-36707586 CTTTTTAAATTGAGGAATAGTGG + Intronic
1178946018 21:36948312-36948334 ATTTGAAAATACAAGACTAAAGG + Intronic
1179165415 21:38931808-38931830 CTTTGTAAATATAAGAAGATGGG + Intergenic
1179282994 21:39951067-39951089 CTTAGTAAATACCAGAGTAATGG - Intergenic
1180452126 22:15473231-15473253 CTTTGTAAAAGGAAAAATAAAGG - Intergenic
1180476527 22:15714638-15714660 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
1181018546 22:20085679-20085701 CTTTGCAGGTAGAAGAAGAAAGG + Exonic
1181887935 22:26036500-26036522 CTTTGTAAATAGCTGCATGAAGG + Intergenic
1183823796 22:40369296-40369318 GTATGTAAATACAAAAATAAAGG - Intronic
1183843797 22:40523102-40523124 CTTTGAAAAATGAAGAAAAATGG + Intronic
949299406 3:2566470-2566492 GTATGTAAATGAAAGAATAAAGG - Intronic
950383593 3:12638037-12638059 CTGAGTAAAGAGAAGAATGATGG - Intronic
950991905 3:17448743-17448765 CTCTGTAAATAGAACAGTAAAGG - Intronic
952443496 3:33357497-33357519 CTTTGTACATAGAAAAATGCTGG - Intronic
952560577 3:34588275-34588297 TTTTGTAAATAGTATAAGAAAGG + Intergenic
953266900 3:41398770-41398792 CTTTTTAAAAAGAAGAATATAGG - Intronic
953575071 3:44106595-44106617 CCTTGTGAATAGAAGAATCCAGG + Intergenic
954193162 3:48978996-48979018 TTTTTAAAATAGAAGAAAAAGGG + Intronic
955534450 3:59908267-59908289 CTTTGCAAAGAGAATAATGAAGG + Intronic
955879289 3:63526666-63526688 CTAAGTAAATAGAAGCCTAAGGG + Intronic
956151269 3:66245539-66245561 CTTTGTAATTAGAAAAGTAATGG + Intronic
956410891 3:68978170-68978192 ATTTGCAAATAGGAGAAAAAGGG - Intronic
957828804 3:85487991-85488013 CTTTCTAAATACAAAAATAAAGG - Intronic
958570260 3:95872069-95872091 CTTAGAAAATAGTAAAATAATGG + Intergenic
958606691 3:96367048-96367070 CTTTGTACATAGAAATATGATGG - Intergenic
959370476 3:105518546-105518568 CTTTGTTAAAATAAAAATAAAGG - Intronic
959917227 3:111829389-111829411 TTTTTTAAACAAAAGAATAATGG - Intronic
963883498 3:150554281-150554303 CTTTGAAAATTGATAAATAAAGG + Intronic
964359979 3:155885385-155885407 ATTTGTTAATATAAGACTAATGG + Intronic
964559605 3:157979451-157979473 ATTTGTAATTTGAAGAATATTGG - Intergenic
965722728 3:171679460-171679482 CTTTGTTAAAAGAAGAAAAGAGG + Intronic
965777811 3:172251375-172251397 TTTTGTAGATAGAAGAAGGAGGG - Exonic
965896301 3:173581034-173581056 CTTTGATAATAGAAAGATAAGGG - Intronic
966496130 3:180583405-180583427 TTTTGTGAATAAATGAATAAAGG - Intergenic
966661789 3:182422904-182422926 CTTTGCAAACAGAAAAATAGGGG - Intergenic
967372799 3:188766761-188766783 ATTAGCAAATAGAAGAAGAAAGG + Intronic
967377189 3:188817717-188817739 CTTTGTATACAGAACAAAAATGG + Intronic
967420486 3:189266812-189266834 CTTTGTAACTAGAAAGATCAAGG - Intronic
967566927 3:190984127-190984149 CTTTATTAATAGAAAAATAGAGG - Intergenic
967677077 3:192313451-192313473 CTATTGAAATCGAAGAATAAAGG + Intronic
968780638 4:2578464-2578486 TTTTGTAAATGGAAGATTGAGGG - Intronic
970821059 4:20214663-20214685 CTTAGTCCATAGATGAATAATGG + Intergenic
971380473 4:26092688-26092710 AGTAGTATATAGAAGAATAATGG + Intergenic
971573169 4:28239557-28239579 CATTTTAAATAGGAAAATAAAGG + Intergenic
972473474 4:39429348-39429370 CTTTAGAAATAGATGAAGAAGGG - Intronic
974280648 4:59787241-59787263 ATTTATAAATAAAAGCATAACGG + Intergenic
974731631 4:65874168-65874190 CTTGATAAAAAGAAGAAAAATGG + Intergenic
975247394 4:72135443-72135465 CCTTGAAAATAGAAGAATGAGGG - Intronic
975402050 4:73949889-73949911 GTTTGTAAAGAGAAAAAGAAAGG + Intergenic
975429316 4:74270084-74270106 TTTTTTAAATAGAAAGATAAAGG + Intronic
975437362 4:74368372-74368394 CTTGGAAAATATAAAAATAAGGG - Intronic
975941344 4:79650709-79650731 CTTTTCAAATTGAAGAATCAAGG - Intergenic
976551464 4:86400864-86400886 TTTTAAAAATAAAAGAATAATGG - Intronic
976773487 4:88681055-88681077 TTTTCAAAATAAAAGAATAAAGG - Intronic
976877596 4:89873672-89873694 CTGTGTAAATAAAATAATCAGGG + Intergenic
976880128 4:89911553-89911575 CTTTTTAAATATAACAATATAGG + Intronic
977441978 4:97079413-97079435 CTTTGAAAATGGAAGAAGGAGGG - Intergenic
977860191 4:101948586-101948608 CATTTTAGATAGAAGAAAAAGGG - Intronic
978249690 4:106615564-106615586 CTTTGTAAACAGAAGAAAAGAGG + Intergenic
978713921 4:111819030-111819052 TTTTTTAAAAAGAAAAATAAAGG + Intergenic
978859865 4:113435504-113435526 CTATATAAATAGAAGAAACAAGG + Intergenic
978881864 4:113714364-113714386 ATTTTTAAAAAGAAGAAGAATGG - Intronic
979101282 4:116618312-116618334 TTTGGTAAATGGAAGCATAAAGG + Intergenic
979194330 4:117901839-117901861 TTTTGTGAATAAATGAATAAAGG + Intergenic
979604886 4:122627144-122627166 CTATATACATAGAACAATAAAGG + Intergenic
979717994 4:123864690-123864712 AATTATAAATAGAATAATAAAGG - Intergenic
979834001 4:125338843-125338865 TTTTAAAAACAGAAGAATAAAGG - Intronic
979857102 4:125647725-125647747 CTTTTTAAACAGAAAAAAAATGG + Intergenic
979877204 4:125907808-125907830 CTTTGAAAATAAAAAAATTAAGG + Intergenic
980052134 4:128049055-128049077 TTTTGTAATTAGAAAAATATTGG + Intergenic
980190436 4:129518313-129518335 CTTTGTACATCCAAGAAAAAAGG - Intergenic
980234399 4:130086442-130086464 CTTTGTACAGAGAAAAATTATGG + Intergenic
980327442 4:131365932-131365954 ATTGGTCAATTGAAGAATAAAGG - Intergenic
980345061 4:131603733-131603755 ATTTGAACATAGAATAATAATGG - Intergenic
980721981 4:136709419-136709441 CTTTGTAGCTAGGAGAATAGTGG + Intergenic
980817919 4:137972645-137972667 GATTGTAAATAAAAGAAAAATGG + Intergenic
980999529 4:139815210-139815232 GTTTGTAAATTCAGGAATAAGGG + Intronic
982485945 4:155965874-155965896 ATTTGTAAAAATAAAAATAAGGG + Intergenic
982547677 4:156755632-156755654 CTCTATGAATAGAAGAATATAGG - Intergenic
982799137 4:159681011-159681033 CGTTGTCAAGAAAAGAATAAGGG + Intergenic
982928390 4:161368964-161368986 CTTGAAAAATAAAAGAATAAAGG - Intergenic
983030157 4:162790757-162790779 CTATGTAACTAGTAAAATAATGG + Intergenic
983345095 4:166519267-166519289 TTGTCTAAATAGAAAAATAATGG - Intergenic
983449502 4:167892929-167892951 CTTTGTAAAATTAAGTATAAAGG + Intergenic
983705678 4:170655942-170655964 CTTTTTTAATGGAAGAATATAGG + Intergenic
983855824 4:172642928-172642950 CTTTGTAATTATGAAAATAAGGG - Intronic
983970547 4:173866543-173866565 CTTTGTCAAGAGAAAAAAAATGG - Intergenic
984156692 4:176203251-176203273 GTATGTAACTGGAAGAATAAAGG + Intergenic
984192174 4:176619288-176619310 CTTTATATAAAGAAGAAGAAAGG + Intergenic
984314648 4:178112221-178112243 CTTTGTAAATAGAACCCTAAAGG - Intergenic
984356116 4:178661019-178661041 TTTTCTAAAAAGAAAAATAAGGG - Intergenic
984520824 4:180798727-180798749 CTTTATAAAATGAAGAGTAAGGG + Intergenic
984673804 4:182523800-182523822 ATTTTTAAATAGGAAAATAAGGG - Intronic
985042052 4:185900660-185900682 TTTTGCAAATAGAAAAATATTGG - Intronic
985246775 4:187986874-187986896 CTTTCTTAAGAAAAGAATAAAGG + Intergenic
986594155 5:9403211-9403233 CTTTGTAAGTGAAATAATAAGGG - Intronic
986610667 5:9563918-9563940 CATTGAAAATAGAAGCTTAATGG - Intergenic
986702584 5:10425480-10425502 CTCTGTAAATTTAAGAAAAATGG + Intronic
987403228 5:17499064-17499086 CTTTCTAGTTGGAAGAATAAAGG + Intergenic
987410707 5:17611820-17611842 CTTTCTAGTTGGAAGAATAAAGG + Intergenic
987677644 5:21095642-21095664 CTTTGTCAATAAAAGAAGGAAGG - Intergenic
987716828 5:21582182-21582204 CTTTGTGCAAAGTAGAATAAAGG + Intergenic
987960368 5:24799560-24799582 CTTAGCAAATAGAAAAAAAAAGG - Intergenic
988378331 5:30468648-30468670 CTTTGGAAAAATAAGAAAAAAGG + Intergenic
988423583 5:31036147-31036169 CTATGGAAAAAGAAGAATAATGG + Intergenic
988700495 5:33669073-33669095 CTTTGAAAATAGAAAAACAATGG + Intronic
989051958 5:37330133-37330155 CTGTGTAAAAAGAGGAATATTGG + Intronic
989154088 5:38327405-38327427 CTTGCCAAATAGAAGAATATGGG + Intronic
989783902 5:45304181-45304203 CTTCGTAAATAAAAGATAAAAGG - Intronic
990107462 5:52281840-52281862 CTTTGTAAATAAAACATGAAGGG - Intergenic
990315541 5:54579526-54579548 CTCTGTAAATAGATGGATGAAGG - Intergenic
992601026 5:78399832-78399854 CTTTTTAGATAGAACAACAATGG - Intronic
992817076 5:80453367-80453389 TTTTTTAAATAGAAGATTAGGGG + Intronic
993083749 5:83337367-83337389 ATTTATAAATAGTAGAATACAGG + Intronic
993094618 5:83467180-83467202 TTTTGTCAATAGAATAAAAATGG + Intergenic
993216824 5:85035323-85035345 CTTAGAAAATAGATGAATAGGGG - Intergenic
993382599 5:87224841-87224863 CTTTGAAAATGGAAGAATGGAGG + Intergenic
993441768 5:87965203-87965225 TTTTGTAAATAGTAGAGTGATGG - Intergenic
993559930 5:89393715-89393737 CTTTTTAAAAAGAATAATCAGGG + Intergenic
993588375 5:89760941-89760963 TTTAGTAAATAAAAGAATATTGG - Intergenic
993776392 5:92003488-92003510 CTCTACAAATAGAAGAATTATGG - Intergenic
993993824 5:94694665-94694687 CTATATATATAGACGAATAAAGG - Intronic
994678702 5:102858676-102858698 TTTTGTAACTAGAAGAAAACAGG - Intronic
994954801 5:106514270-106514292 CTTAGTGAATAAAAGAACAAAGG + Intergenic
995439928 5:112180004-112180026 TTTAGTATATAGAAGAACAAAGG - Intronic
995915361 5:117239485-117239507 TTTTGGAAAAAGAAGACTAAGGG + Intergenic
996340045 5:122427498-122427520 TTTTGTAAATTCTAGAATAAAGG - Intronic
996351170 5:122543431-122543453 CTTTTGAGATAGAAAAATAAAGG + Intergenic
996934386 5:128931631-128931653 CTTTTTAAATCAAAGAGTAAAGG - Intronic
997036342 5:130196760-130196782 CTGTTGTAATAGAAGAATAATGG - Intergenic
997078200 5:130706090-130706112 ATTTTTAAATAAAAGAAAAAAGG + Intergenic
998942716 5:147302125-147302147 GTTTGTAATAAGCAGAATAAAGG - Intronic
999448706 5:151662601-151662623 CTTGATTAATAGAAGAAAAAAGG + Exonic
1000210257 5:159101317-159101339 CTTTTTAACAGGAAGAATAAAGG - Intergenic
1000578435 5:163006039-163006061 GTTTGTGAGTAAAAGAATAAAGG - Intergenic
1001037986 5:168311558-168311580 CTTTGTAAAAATAAGGCTAAGGG + Intronic
1001624191 5:173116897-173116919 ATTTGTAAAAATAAGAATATAGG - Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1004221411 6:13750432-13750454 TTTTTTAAAAAGAAGAATGAAGG - Intergenic
1004726337 6:18314651-18314673 CTTTTTAAAGAGAAAAATCAAGG - Intergenic
1004999286 6:21224566-21224588 CTTTGAAAATGGAAAAAAAAGGG + Intronic
1005095635 6:22112033-22112055 CTTTGAAAATAAAAGTAAAAGGG - Intergenic
1005197857 6:23310006-23310028 CATGGTAAAGAGAAGAACAATGG + Intergenic
1005355812 6:24982254-24982276 CTTTGTATAAAGCAAAATAAAGG + Intronic
1006995766 6:38258588-38258610 CTTTGTAACTACAGCAATAATGG + Intronic
1007794209 6:44334480-44334502 CTATGTCAATGGAACAATAATGG + Intronic
1007979299 6:46134158-46134180 CTTTGTAACTAGAATGATAAAGG + Intronic
1008046388 6:46855515-46855537 CTTTATAAAAAGAACAAAAAAGG + Intronic
1008186528 6:48398827-48398849 CCTTGACAATAAAAGAATAAAGG - Intergenic
1008821536 6:55637873-55637895 CTTTGTAAATCCAAGAGGAAGGG + Intergenic
1008952366 6:57174617-57174639 TTTTTTAAAAAGAAGAAAAAAGG - Intronic
1009486274 6:64226405-64226427 TTTTATAAATAGTAAAATAAAGG - Intronic
1009551516 6:65100282-65100304 CTTAATAAATAAAAGAATAAAGG + Intronic
1009890574 6:69675938-69675960 CTATGTAAATATAAGACTACTGG - Exonic
1009924385 6:70102320-70102342 CATTCTAAACAGTAGAATAAAGG - Intronic
1010693602 6:78942176-78942198 CTTTGTAAATAAGAAAATCATGG + Intronic
1011477759 6:87764452-87764474 GTTTGGAAATAGAAGAAAATGGG + Intergenic
1011538292 6:88402143-88402165 CTTTTTAAATTAAAAAATAAAGG - Intergenic
1011704985 6:89992160-89992182 CTTTGTAAAAAGAAACAGAAAGG - Intronic
1011710345 6:90046820-90046842 CACTGTAATTACAAGAATAAAGG + Intronic
1012226707 6:96712390-96712412 CTTTGAAAATAGAACACAAATGG + Intergenic
1012226715 6:96712547-96712569 CTTTGAAAATAGAACACAAATGG + Intergenic
1012270655 6:97205888-97205910 TTTTGCAAATAGAAGAGTTACGG - Intronic
1012536713 6:100307374-100307396 TTTAGTAATTAGAATAATAATGG - Intergenic
1012603331 6:101126181-101126203 CTCTGTGAATAGAAGAAAGAAGG - Intergenic
1012852283 6:104461816-104461838 CATTGTAAAATAAAGAATAATGG - Intergenic
1012996111 6:105976618-105976640 CTTTGAAAATGTAACAATAAAGG + Intergenic
1013600625 6:111701099-111701121 CTTTATAAAAAAAAGAAGAAAGG + Intronic
1014037874 6:116788704-116788726 CTGTGCCAATAGAACAATAAAGG - Intergenic
1014245449 6:119063107-119063129 CCTAGTAAATAGGAGAATATTGG + Intronic
1014293235 6:119585739-119585761 CTTTGTAAGGAGATTAATAAAGG - Intergenic
1014383336 6:120771635-120771657 CTTTTTAAATAGGAGAAAGAGGG - Intergenic
1014447920 6:121550397-121550419 CTTCATATATAGAAGAATAGTGG + Intergenic
1014605586 6:123470107-123470129 TTTAATAAATAAAAGAATAAGGG - Intronic
1015127994 6:129775707-129775729 GTTTGTACATAGAAGAAAAATGG + Intergenic
1015381231 6:132571693-132571715 CTTTGTAAAGAAAAGAGGAAAGG - Intergenic
1015428340 6:133099306-133099328 TTTTGGAAATATAAGAACAAAGG - Intergenic
1015469949 6:133593016-133593038 CTTTGTTAATAGAAGTAGATTGG + Intergenic
1015690846 6:135921010-135921032 CTTTGTTAAAAGAATAATAGAGG + Intronic
1015736915 6:136410734-136410756 CTTTGGAATAAGAATAATAAAGG + Intronic
1016354559 6:143204049-143204071 ATTTGTAGATAGAAGAAGGAAGG + Intronic
1016826819 6:148396077-148396099 CTTTGTGAATACAAGGAAAAGGG + Intronic
1017404293 6:154101385-154101407 CTTTGGAAATAGAAGGGAAATGG + Intronic
1018584610 6:165343362-165343384 CTATGTCAATATAAGAATCAAGG + Intronic
1018646741 6:165955545-165955567 CTTTGTAAGAAGAAGATTACGGG - Intronic
1018845026 6:167549783-167549805 TTTTGTAAAAAGAACAATAATGG - Intergenic
1020370299 7:7424713-7424735 CTCTCTCAAAAGAAGAATAACGG + Intronic
1022191978 7:28025278-28025300 CTTTGAAGAAAGTAGAATAAAGG - Intronic
1022549305 7:31222732-31222754 ATATGTAAATAGAAGAACCAGGG - Intergenic
1022952419 7:35351397-35351419 CTTTGTAACTAGAGCAATATGGG + Intergenic
1022996294 7:35759024-35759046 CTTTACAAATATAACAATAAGGG - Intergenic
1023783026 7:43675907-43675929 CTATTTAAATAAAAGAATTATGG + Intronic
1024409349 7:49021836-49021858 ATTTTTAAAGAGAAGGATAAAGG + Intergenic
1024498981 7:50081227-50081249 CATGGTAAATAGAGCAATAAAGG + Intronic
1025274230 7:57560829-57560851 ATGAGTAAATAGAAGAATCAAGG + Intergenic
1027717990 7:81698188-81698210 CTATTTAAATAGCAGAATATAGG + Intergenic
1027914724 7:84301734-84301756 ATTTGTGAATAGAAGTATATGGG - Intronic
1027980096 7:85207155-85207177 CTTTCTAAATATACAAATAAAGG - Intergenic
1028808357 7:95055088-95055110 ATTTGGAAATAGAAGTATCAAGG - Intronic
1030832241 7:114238944-114238966 ATTTATAAATATAAAAATAATGG + Intronic
1030992420 7:116316351-116316373 CTTTGCAAATATGAGAATATAGG - Intronic
1031042494 7:116853076-116853098 CTTATGAAATAGAAGAACAAAGG - Intronic
1031177586 7:118372254-118372276 ATTGGTAAATAGAACCATAATGG - Intergenic
1031210013 7:118811745-118811767 TTTTGAAAACAGAAAAATAATGG - Intergenic
1031430222 7:121658799-121658821 CTTTGTTAATTGAGGAATTATGG + Intergenic
1032023948 7:128426617-128426639 CCTTGTACACGGAAGAATAAAGG + Intergenic
1032587223 7:133157878-133157900 CTTTGTAAATAGTAGGTTTATGG + Intergenic
1032733738 7:134670807-134670829 CTTTGGAATTAGAAAAAAAAGGG - Intronic
1032750630 7:134836862-134836884 AATTGTTAATAGAAGAATGAGGG - Intronic
1035666353 8:1383187-1383209 TTTTGTAACGAGAAAAATAAGGG + Intergenic
1037048934 8:14344247-14344269 CTATTTTAATTGAAGAATAATGG + Intronic
1037296928 8:17411777-17411799 CTTTGTATATAGAACAGAAAAGG + Intronic
1038120166 8:24604296-24604318 GTGGGTAAATAGAATAATAATGG + Intergenic
1038143064 8:24867264-24867286 CCTTGTACATAGAAGAATCTTGG + Intergenic
1038161118 8:25039189-25039211 GTTAGTATATAGAAAAATAATGG + Intergenic
1038528944 8:28301307-28301329 ATTTTTAAATGGAAGAATGATGG - Intergenic
1039179379 8:34848072-34848094 CATTATAAATAGAATAATAGTGG - Intergenic
1039995758 8:42531534-42531556 CATAGAATATAGAAGAATAAAGG + Intronic
1040513310 8:48114547-48114569 ATATGTAAACACAAGAATAATGG - Intergenic
1040680725 8:49805077-49805099 CTTTGTGATTAGAAAAAAAATGG + Intergenic
1041843731 8:62302755-62302777 CTTAGTAAACAAAAGCATAAGGG + Intronic
1042328421 8:67552841-67552863 CATTGTAACAAAAAGAATAAAGG + Intronic
1042581942 8:70289655-70289677 CTTTTTAAAAAGTAGAATTAAGG - Intronic
1042962061 8:74314404-74314426 CGATGTAAATATCAGAATAAAGG + Intronic
1043085901 8:75832601-75832623 ATTTTTAAGTAAAAGAATAAAGG + Intergenic
1043305546 8:78789556-78789578 GTTTTTAAAAAGAAGAAAAATGG + Intronic
1044011155 8:86995560-86995582 TTTAGTAAAAAGAAAAATAAGGG + Intronic
1044104566 8:88187471-88187493 CTTTGTAATTATTAAAATAAAGG - Intronic
1044332269 8:90934869-90934891 TTTTGGAAACAGAAGAAGAATGG + Intronic
1044477909 8:92650130-92650152 ATTTGTAAATCCAGGAATAAAGG + Intergenic
1045490435 8:102664250-102664272 CTTTGTTAAGAAAAAAATAAGGG - Intergenic
1047225794 8:122954630-122954652 CTTTGAAAAAAGAAGAAAAATGG + Intronic
1048606583 8:135974705-135974727 TTTTGTAAATAAAAGTATATTGG - Intergenic
1048935544 8:139352809-139352831 CTTTGGAAATAATAAAATAAAGG + Intergenic
1050060122 9:1699692-1699714 CAATGTAAAGAGAAGAAGAAAGG - Intergenic
1050466727 9:5934217-5934239 ATTTGTAAATAAAAGCATATAGG - Intronic
1050740716 9:8816791-8816813 CTTTAGGAATAGAAGAAGAAAGG + Intronic
1051370843 9:16357822-16357844 CTCTGTAAAAATAAGGATAATGG + Intergenic
1051687989 9:19678505-19678527 TTTTTTAAATAGAAAAATAAAGG - Intronic
1051752461 9:20357450-20357472 CTCTGAAAATAGAAGAATTGTGG + Intronic
1052391901 9:27889005-27889027 TTTTGGAAAGAGAAGAAGAAGGG + Intergenic
1052439499 9:28476586-28476608 TTTATTAAATAGATGAATAAAGG + Intronic
1052582471 9:30376317-30376339 CTTTTTAGATAGAACACTAAAGG - Intergenic
1052898079 9:33766970-33766992 TTTTTTAAGTAGAAGAGTAATGG + Intronic
1052913375 9:33904562-33904584 TTTTGTAACTTGAAGAATAAGGG + Intronic
1055418654 9:76112121-76112143 CTTTGCAATTAGAAGCAGAAAGG - Intronic
1055883078 9:81025341-81025363 TTTTATAAAGTGAAGAATAAAGG + Intergenic
1056036602 9:82612903-82612925 CTTTGTCAAAAGAAGGAAAAGGG + Intergenic
1056290156 9:85135003-85135025 TTTTATAAATTGAACAATAAAGG + Intergenic
1058062873 9:100516663-100516685 CTTTTTAAACAGAAGAGGAAGGG + Exonic
1058182844 9:101818743-101818765 CTGGGTAAATAGCAAAATAAGGG + Intergenic
1058547461 9:106076150-106076172 TTTTATAAAGAGCAGAATAATGG + Intergenic
1059129763 9:111734562-111734584 CCTTATAAAAAGAACAATAAGGG - Intronic
1059364309 9:113774122-113774144 CTTTGAGAATAAAAGAATAATGG + Intergenic
1059370647 9:113830603-113830625 ATTTTGAAAAAGAAGAATAAAGG + Intergenic
1059489337 9:114654377-114654399 CTCAGAAAAGAGAAGAATAAAGG - Intergenic
1060123582 9:121019872-121019894 CTTTGGGAATAAAAGTATAAAGG + Intronic
1060373625 9:123098666-123098688 CTATGTTAACAGAAAAATAAAGG - Intronic
1060740590 9:126095429-126095451 CTTTGAAAACAGAAAAATCATGG - Intergenic
1061346865 9:130033428-130033450 CTGTGCAAATAGAAGTACAAGGG + Intronic
1185953949 X:4468484-4468506 CTTGGTAGAGAGAAGAATCATGG + Intergenic
1186009743 X:5116214-5116236 CTTTGGAAATAAAATAGTAATGG + Intergenic
1186009816 X:5116808-5116830 CTTTGGAAATAAAATAGTAACGG - Intergenic
1186077510 X:5897356-5897378 CTTTGGGAATAGGAGAAAAAGGG - Intronic
1186564490 X:10647570-10647592 TTTTGAAAATGGAAGAATAAAGG + Intronic
1186764143 X:12753834-12753856 CTTTGTAAAAAAAAAAAAAAGGG - Intergenic
1186926472 X:14338141-14338163 AAATGTAAATACAAGAATAATGG + Intergenic
1186942267 X:14522840-14522862 CTTTATAAATGGAACAACAAAGG - Intergenic
1187775857 X:22756243-22756265 CTTTAAAAATAAAGGAATAATGG - Intergenic
1187887926 X:23907041-23907063 CTTTTTAAAAAGTAGAATAATGG + Intronic
1187915836 X:24150974-24150996 TTTTTTAAATCGAGGAATAAGGG + Intronic
1187994467 X:24910511-24910533 CACTTTAAATAGAAGAATATTGG + Intronic
1188343153 X:29029783-29029805 CTTTGTAAATAAAACACTAGAGG - Intronic
1188502983 X:30849242-30849264 CTTTGCAAATAACAGATTAAGGG + Intronic
1188863760 X:35288897-35288919 CTTGGTAAATACAAGTAAAATGG - Intergenic
1188891434 X:35615558-35615580 CTTTGTTATTATAGGAATAAAGG - Intergenic
1189199387 X:39178730-39178752 CTTTTAAAATTGAAGAAAAATGG - Intergenic
1189648708 X:43164556-43164578 CTTTGTAAAGAGAAAAATGAAGG + Intergenic
1190443449 X:50498945-50498967 CTTTGTACATATAAGAAAGAAGG + Intergenic
1190587113 X:51956824-51956846 ATTTATATGTAGAAGAATAAAGG - Intergenic
1192015978 X:67331595-67331617 TTTTTTAAATTGAAGTATAATGG - Intergenic
1192118700 X:68434599-68434621 GGTTGTAAATAGAATAATAGTGG + Intergenic
1192346999 X:70318296-70318318 CATTTTAAATGGAAGAATGAAGG - Intronic
1192570191 X:72197093-72197115 ACTTGTAAATAGTAGAATAAGGG + Intronic
1193377226 X:80775936-80775958 CTTTGTAAATAAAGAAATTAAGG + Intronic
1193728224 X:85068704-85068726 CTTAGAAAAAAGAAGAATCAGGG - Intronic
1194490853 X:94547348-94547370 CTTTGTATAAAGAAGCAGAAAGG + Intergenic
1195726170 X:107918907-107918929 CTTTGTAAAGAAAAGCTTAAAGG + Intronic
1196200219 X:112878340-112878362 CTTTTCAAATAGAATAAAAAGGG + Intergenic
1196429895 X:115613217-115613239 CTTTTGAAATAAAAGAATAATGG + Intronic
1196495519 X:116319647-116319669 CTTTCTACTTAGAATAATAATGG - Intergenic
1197966094 X:132063549-132063571 TTTTTTAAATTGAAGATTAATGG + Intergenic
1198979254 X:142376260-142376282 ATATGCAAATAGAATAATAATGG - Intergenic
1198997946 X:142597096-142597118 CTTGGGAAAGAGAAAAATAATGG - Intergenic
1200670492 Y:6082515-6082537 CTATGTAGATAAAACAATAAGGG - Intergenic
1200950361 Y:8892779-8892801 GTTTGTGAAAAGAAGATTAATGG - Intergenic
1201728091 Y:17175936-17175958 CTTGGTAAATGAAAGAAAAATGG - Intergenic
1201777758 Y:17685145-17685167 GTTTGTAAGGAGAAAAATAAAGG - Intergenic
1201780686 Y:17718252-17718274 CTATCTAAATAAAACAATAAGGG - Intergenic
1201820867 Y:18187738-18187760 CTATCTAAATAAAACAATAAGGG + Intergenic
1201823800 Y:18220847-18220869 GTTTGTAAGGAGAAAAATAAAGG + Intergenic
1202021649 Y:20470920-20470942 CCCCCTAAATAGAAGAATAATGG - Intergenic