ID: 1130082959

View in Genome Browser
Species Human (GRCh38)
Location 15:80750652-80750674
Sequence AGTTTTGTGCAGTTTGTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130082957_1130082959 5 Left 1130082957 15:80750624-80750646 CCTTCTGTTAACACCTTGGGTGA 0: 1
1: 0
2: 2
3: 8
4: 90
Right 1130082959 15:80750652-80750674 AGTTTTGTGCAGTTTGTACCAGG 0: 1
1: 0
2: 0
3: 7
4: 138
1130082958_1130082959 -8 Left 1130082958 15:80750637-80750659 CCTTGGGTGAACTTCAGTTTTGT 0: 1
1: 0
2: 2
3: 14
4: 248
Right 1130082959 15:80750652-80750674 AGTTTTGTGCAGTTTGTACCAGG 0: 1
1: 0
2: 0
3: 7
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130082959 Original CRISPR AGTTTTGTGCAGTTTGTACC AGG Intronic
900323520 1:2096237-2096259 GGTTTTGTGCAGTGTGTGCCTGG + Intronic
901948344 1:12721525-12721547 CGTTTTGTGCATTTTGAAGCTGG + Intronic
910848288 1:91625225-91625247 AAGGTTGTGCAGTGTGTACCAGG - Intergenic
912881555 1:113421634-113421656 TGTTATGTGAAGCTTGTACCAGG + Intronic
914017580 1:143834369-143834391 ATTTTTCTTCAGTTTATACCTGG + Intergenic
914656191 1:149742901-149742923 ATTTTTCTTCAGTTTATACCTGG + Intergenic
916849592 1:168690019-168690041 GGCTTTCTTCAGTTTGTACCAGG + Intergenic
918312363 1:183293765-183293787 AGTTTTGTGCAGATAATCCCTGG + Exonic
919814766 1:201430359-201430381 AGTTCTGTGCAGCTGGGACCAGG - Intergenic
920654978 1:207868359-207868381 AGTTCTGGGCAGTTTGGGCCAGG + Intergenic
921236200 1:213133648-213133670 GGTTTTGTGTAGTTTGTTCCAGG + Intronic
923590509 1:235314282-235314304 AGTTCTGAGCAGTTAGTACGTGG - Intronic
1067950506 10:50732244-50732266 ATTTTTGATCAGTTTGTGCCTGG + Intergenic
1068051075 10:51950346-51950368 AGTTTTATTCAGTATGTACTTGG - Intronic
1068273717 10:54764173-54764195 ATTTTTGATCAGTTTGTGCCTGG - Intronic
1070885847 10:79897481-79897503 ATTTTTGATCAGTTTGTGCCTGG + Intergenic
1072610270 10:97013322-97013344 AGTTTTGTGGATTTTGTAACTGG + Intronic
1073083129 10:100872302-100872324 ACTTTTGGGCAGTTTGAATCAGG + Intergenic
1074958157 10:118412778-118412800 AGATTTGTGCATTTTGAACATGG + Intergenic
1078582371 11:12548352-12548374 AGTTTTCTGCAGACTGTATCAGG + Intergenic
1082996321 11:59258379-59258401 ATTTTTGGGCTCTTTGTACCTGG - Intergenic
1084621564 11:70273943-70273965 AGTTTTGTACAGTTAGTCGCAGG + Intronic
1084929270 11:72541452-72541474 AGTTTTTGGCAGTGTGTACTTGG + Intergenic
1086494276 11:87386282-87386304 AGTTTTGTATAGTTTCTCCCAGG - Intergenic
1086700417 11:89895513-89895535 TGTTTTGTGCAGTTGGTTACAGG + Intergenic
1086705752 11:89949013-89949035 TGTTTTGTGCAGTTGGTTACAGG - Intergenic
1087493476 11:98858958-98858980 TGTTTTGTTCATTTTGTACCTGG - Intergenic
1088854833 11:113739227-113739249 ACTTTTGTGGATCTTGTACCTGG - Exonic
1098059484 12:66545520-66545542 AGTTTTGTTAAGTTTTTTCCAGG - Intronic
1098690034 12:73475366-73475388 AGTTTTGTTCTGCTTGTTCCTGG - Intergenic
1098988779 12:77041949-77041971 AGTATTGTGCTGTTTGTGCTGGG - Intronic
1099270217 12:80499315-80499337 AGTTCTGTGCATTTTCCACCTGG + Intronic
1107081146 13:36376269-36376291 AGTTTTCTCCAGTTTGAACTTGG - Intergenic
1116455630 14:45117691-45117713 AGTTTGCTACAGTTTGTACTGGG + Intronic
1117589419 14:57251233-57251255 AGCTGTGTGCAGGTTGTTCCAGG - Intronic
1121616842 14:95319393-95319415 AGTTTGGAGAAGTTTGTACGTGG - Intronic
1121659051 14:95621063-95621085 AGTTTTGTGGAAATTGGACCTGG + Intergenic
1121782606 14:96631595-96631617 AACTTTGAGCAGTTTGTCCCGGG + Intergenic
1121882878 14:97516020-97516042 TGTGTTTTGAAGTTTGTACCAGG - Intergenic
1128605465 15:69033495-69033517 ATTTTTGTGCACTATGCACCAGG + Intronic
1130032149 15:80325913-80325935 AGTTTTGAGCATTTCCTACCTGG + Intergenic
1130082959 15:80750652-80750674 AGTTTTGTGCAGTTTGTACCAGG + Intronic
1140559876 16:75966660-75966682 AGTTTTGCCCAGCTTCTACCTGG - Intergenic
1144150814 17:12441937-12441959 AGTTTTGTTCATTTTGTTCAGGG - Intergenic
1144517012 17:15925612-15925634 ATTTCTGTGCAGTTAGTACTAGG + Intergenic
1145079599 17:19883818-19883840 AGTTTTGTCTGGTTTGTATCTGG - Intergenic
1146722188 17:35131351-35131373 AGTTCTGAGCAGTTTATACAAGG + Exonic
1155571451 18:27198313-27198335 ACTTTATTGCAGTTTGAACCAGG + Intergenic
1157008827 18:43621517-43621539 AAGTTTGTGCAGTTTATTCCAGG + Intergenic
1157050247 18:44155374-44155396 AGATGTGTTCAGTTTGTCCCTGG + Intergenic
1158587578 18:58755051-58755073 AGTTTGGTGCTGTTTGCTCCAGG - Intergenic
1160597999 18:79990495-79990517 AGATTTCTCCAGTGTGTACCTGG - Intronic
1164645076 19:29853251-29853273 AGATTTGTGCATTTTATACATGG + Intergenic
1164733640 19:30524630-30524652 AGATTGGTCCAGTTTGTTCCTGG + Intronic
1166635776 19:44450793-44450815 AGTGTTTTGCAGTTTGTATGAGG - Intergenic
926184849 2:10681927-10681949 ATTTTCATGCATTTTGTACCAGG - Intronic
929616081 2:43309044-43309066 TGTTTTGCACAGTTTTTACCTGG - Intronic
932531066 2:72533137-72533159 GTTATTGTGCAGTTTGTTCCAGG - Intronic
934580890 2:95436801-95436823 TGTTTTGTGCAGTTAGTTACAGG - Intergenic
934598561 2:95639914-95639936 TGTTTTGTGCAGTTAGTTACAGG + Intergenic
935026404 2:99281519-99281541 AGTATTTTGCAGTTTGCACTGGG - Intronic
935642062 2:105300287-105300309 AGTTTTGTTCTGCTTGTAACTGG - Intronic
937814921 2:126240669-126240691 AGTTCTGTGCATTTTGCACTGGG - Intergenic
940952122 2:159687192-159687214 AGTTTTATAAAGTTTGTGCCAGG - Intergenic
943110867 2:183603912-183603934 ATTTATTTGCAGTCTGTACCTGG + Intergenic
943250002 2:185507688-185507710 TGTTCTGTGCTGTTTGTACTAGG - Intergenic
946093803 2:217254325-217254347 AGTCTTGTGCTGTTAGTAACTGG - Intergenic
946524098 2:220498949-220498971 AGTTTTGTACAGTTTGGAGAGGG + Intergenic
948510731 2:238462799-238462821 AGTTTTCTTCAGTATATACCTGG + Intergenic
1169050013 20:2567964-2567986 AGTTCTGTGCATTTTCTTCCAGG - Intronic
1169584137 20:7060861-7060883 AGTTTTGTGAGGTTTATAACAGG + Intergenic
1171357632 20:24561683-24561705 AGTTTTGTCCAGTTGTTTCCTGG + Intronic
1175326317 20:58130948-58130970 AGTTTTGTTCATTTTGCACGAGG - Intergenic
1175837576 20:62006017-62006039 ACTTATGTGCAGTTTGGATCTGG - Intronic
1180754606 22:18152298-18152320 GGTTTTCTGCAGCTTGTTCCTGG + Intronic
1183319022 22:37153935-37153957 AGTCTTGGGCAGTATGTGCCAGG - Intronic
952588543 3:34923227-34923249 ATTTTTCTGCAGTTTTAACCAGG - Intergenic
953729746 3:45436933-45436955 AATCTTGTGTAGTTTGTAACAGG + Intronic
959489004 3:106964680-106964702 CATTTTGGGCAGTTTGTTCCTGG - Intergenic
960157864 3:114316092-114316114 AGTTTTGTTCAGTTTGTTGTGGG + Intergenic
960176644 3:114525214-114525236 AGTTTTGTTTAATTTGTGCCTGG + Intronic
961824228 3:129590370-129590392 ATTTTTGTGCAAATTGCACCAGG - Intronic
962072023 3:132043720-132043742 TGATGTGTGCAGTTTGTCCCAGG + Intronic
966167841 3:177041225-177041247 AGTTCTGTGAAGTTTGTCCCTGG - Intronic
967254773 3:187578746-187578768 TGTTTTATGGAATTTGTACCAGG - Intergenic
968339007 3:197938993-197939015 ACTTTTGAGCAGAGTGTACCAGG - Intronic
971237914 4:24859837-24859859 ATTTTTTTGCAGTTTGTAAAAGG - Intronic
972815593 4:42641565-42641587 AGTTTTCCGCATTTTGTACATGG + Intronic
978208001 4:106103262-106103284 AGATTTGTTCAGTTGGTATCTGG + Intronic
978466119 4:109011701-109011723 AGGTTTATGCATTTTCTACCAGG + Intronic
980581623 4:134761835-134761857 ATTTTTTTTTAGTTTGTACCAGG - Intergenic
983720314 4:170843257-170843279 AGTTCTGTTCAGTATATACCAGG + Intergenic
983855357 4:172636776-172636798 AGATGAGTGCAGTTTTTACCAGG - Intronic
986447104 5:7831253-7831275 AATTTTGTGCAGTAGGGACCAGG - Exonic
987703331 5:21429939-21429961 AGTTTAGTTCAGCATGTACCTGG + Intergenic
989416326 5:41181541-41181563 CATCTTCTGCAGTTTGTACCTGG + Exonic
989655263 5:43740791-43740813 TGTTTTCTTCAGTTTGTAACAGG + Intergenic
990490684 5:56300127-56300149 AGTTTTGTGCACTTTGTTTAAGG - Intergenic
992356538 5:75990552-75990574 AGGTTTCTGCAGTTTATACCTGG + Intergenic
996292593 5:121870553-121870575 AGTTTTGTGCAAAATGTACTTGG - Intergenic
997240320 5:132301814-132301836 AGGTTTGTGGAGTTTCTATCAGG + Intronic
999816283 5:155179876-155179898 GGTTTTGGGCAGTTTGAACATGG - Intergenic
1001927355 5:175648174-175648196 AGTCTTGGGCAGCTTGTTCCCGG - Intergenic
1003497927 6:6680183-6680205 AGTTTTATGCAGTTCATATCTGG - Intergenic
1007440644 6:41856655-41856677 AGTTTGGCACAGTTTGCACCTGG - Intronic
1010490289 6:76467752-76467774 AGTGTTGATCAGTTTGTACATGG - Intergenic
1012389069 6:98716490-98716512 AGAATTGTGCAAATTGTACCCGG + Intergenic
1012452040 6:99362885-99362907 AGTGTTTTGCACTTTGTCCCAGG - Intergenic
1013007311 6:106085961-106085983 AGATTTGTGTCTTTTGTACCTGG + Intergenic
1013259041 6:108419854-108419876 AGTTTTCTAAAGTTTGTAGCTGG - Intronic
1016496130 6:144663939-144663961 ATATTTGTGAAGTATGTACCAGG + Intronic
1016787219 6:148024233-148024255 CCTTTTGTGCTTTTTGTACCTGG + Intergenic
1022131698 7:27410672-27410694 AGTTTTCTGGAGTATATACCTGG - Intergenic
1024112627 7:46162534-46162556 AGTTCTGTGCTGTTTGCAGCAGG - Intergenic
1024947491 7:54824903-54824925 AATTTTTTCCAGTTTATACCAGG + Intergenic
1027947432 7:84766701-84766723 AGTTTTCTGCAGTTTGAACATGG + Intergenic
1032513036 7:132487016-132487038 ATTTTTGTGCTGTTTGTCCAAGG - Intronic
1036625596 8:10469110-10469132 AGTTTTCAGCAGTTTGAACATGG - Intergenic
1037276067 8:17180108-17180130 AGTTAGGTGCAGTTTATTCCTGG - Intronic
1038456888 8:27678709-27678731 ATTTTCTTGCAGTTTGTATCAGG - Intergenic
1040000690 8:42574039-42574061 TATTTTGTACACTTTGTACCAGG + Intergenic
1042894565 8:73651824-73651846 AGGTCTGTGCAGATTGCACCTGG + Intronic
1043102972 8:76069632-76069654 AGTATTGTGCAATTGCTACCAGG + Intergenic
1044118028 8:88358251-88358273 GGTTTTATGCACTTTGTATCAGG + Intergenic
1051402648 9:16699593-16699615 AGTCTTATGCAGTTTGCACTTGG - Intronic
1051892507 9:21957652-21957674 AATATTATGCAGTTTGTACATGG - Intronic
1053713580 9:40854881-40854903 ATTTTTGTGCAATCTGCACCTGG + Intergenic
1054423964 9:64985229-64985251 ATTTTTGTGCAATCTGCACCTGG + Intergenic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1055978758 9:81979631-81979653 AGCTTTCTGCAGTTTGTAATAGG - Intergenic
1056146968 9:83741421-83741443 AGCATTGAGCAGTTTGTTCCAGG - Intronic
1056232164 9:84557834-84557856 AGTTTTCTGAAGTTTTTGCCCGG - Intergenic
1059815475 9:117908223-117908245 AGCTATGTGCAGATTGTTCCAGG - Intergenic
1186222027 X:7359443-7359465 AGTTTTGTTTTGTTTTTACCTGG - Intergenic
1186848421 X:13554520-13554542 TGTTCTGTGCAGTGTCTACCTGG - Intergenic
1187724718 X:22190533-22190555 AGTTCTTTGCATTTTATACCAGG - Intronic
1188067394 X:25678985-25679007 AGTTTTGACCAGTTCCTACCAGG + Intergenic
1193026337 X:76849854-76849876 ACTCTTGTGCTGTGTGTACCTGG + Intergenic
1193571357 X:83149214-83149236 AGCTTTGTGCAGTTTGAAAATGG - Intergenic
1194371977 X:93084965-93084987 AGTTTTGTTCATTTTGTTCAGGG + Intergenic
1194687682 X:96943751-96943773 TGTTTTGTGTACTGTGTACCAGG + Intronic
1197845716 X:130799806-130799828 AGTTTTGTGTAGGTGGTACTAGG - Intronic
1198773074 X:140151156-140151178 TGTTTTGTGGAGTTTGCAACTGG + Intergenic
1200680022 Y:6199002-6199024 AGTTTTGTTCATTTTGTTCAGGG + Intergenic
1201776578 Y:17672380-17672402 AGTTTTTTCTAGTTTTTACCTGG + Intergenic
1201824978 Y:18233612-18233634 AGTTTTTTCTAGTTTTTACCTGG - Intergenic